ID: 1165641642

View in Genome Browser
Species Human (GRCh38)
Location 19:37393925-37393947
Sequence AGTGAAGTATCGCCACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165641642_1165641647 21 Left 1165641642 19:37393925-37393947 CCATGAGGTGGCGATACTTCACT No data
Right 1165641647 19:37393969-37393991 CCTGGACAGCTTTCTTAGACAGG No data
1165641642_1165641644 3 Left 1165641642 19:37393925-37393947 CCATGAGGTGGCGATACTTCACT No data
Right 1165641644 19:37393951-37393973 AGAGGAATAAGTCGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165641642 Original CRISPR AGTGAAGTATCGCCACCTCA TGG (reversed) Intergenic
No off target data available for this crispr