ID: 1165645051

View in Genome Browser
Species Human (GRCh38)
Location 19:37428756-37428778
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165645051_1165645056 17 Left 1165645051 19:37428756-37428778 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1165645056 19:37428796-37428818 TCCCAAATAGCTAGAACTACAGG 0: 11
1: 531
2: 8015
3: 69954
4: 236570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165645051 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr