ID: 1165645056

View in Genome Browser
Species Human (GRCh38)
Location 19:37428796-37428818
Sequence TCCCAAATAGCTAGAACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315081
Summary {0: 11, 1: 531, 2: 8015, 3: 69954, 4: 236570}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165645052_1165645056 14 Left 1165645052 19:37428759-37428781 CCGTCTCCTGGATTCAAGTGATT 0: 79
1: 2045
2: 19892
3: 49941
4: 86213
Right 1165645056 19:37428796-37428818 TCCCAAATAGCTAGAACTACAGG 0: 11
1: 531
2: 8015
3: 69954
4: 236570
1165645053_1165645056 8 Left 1165645053 19:37428765-37428787 CCTGGATTCAAGTGATTCTCCTG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
Right 1165645056 19:37428796-37428818 TCCCAAATAGCTAGAACTACAGG 0: 11
1: 531
2: 8015
3: 69954
4: 236570
1165645051_1165645056 17 Left 1165645051 19:37428756-37428778 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1165645056 19:37428796-37428818 TCCCAAATAGCTAGAACTACAGG 0: 11
1: 531
2: 8015
3: 69954
4: 236570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165645056 Original CRISPR TCCCAAATAGCTAGAACTAC AGG Intronic
Too many off-targets to display for this crispr