ID: 1165645267

View in Genome Browser
Species Human (GRCh38)
Location 19:37430885-37430907
Sequence AGGGAGACCAGAGTGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165645261_1165645267 14 Left 1165645261 19:37430848-37430870 CCATATGGTTCTGAGAGAGAATC 0: 1
1: 0
2: 1
3: 29
4: 217
Right 1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG 0: 1
1: 0
2: 4
3: 69
4: 321
1165645260_1165645267 24 Left 1165645260 19:37430838-37430860 CCGGCAGTGGCCATATGGTTCTG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG 0: 1
1: 0
2: 4
3: 69
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165645267 Original CRISPR AGGGAGACCAGAGTGATTGC AGG Intronic
900174510 1:1285872-1285894 AGGGAGGCCTGAGTGGGTGCAGG + Intronic
902603019 1:17552885-17552907 AGGGGGACCACAGGGATTTCAGG - Intronic
904309088 1:29614048-29614070 AGAGTGACCAGAGAGACTGCAGG + Intergenic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905227005 1:36485639-36485661 AGGGAGAGGAGAAGGATTGCAGG - Intergenic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905932770 1:41801292-41801314 AGGGAGACCAGATTGAAGGGAGG - Intronic
907119926 1:51999431-51999453 AGGGACACCAGAGAAAATGCTGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
912530005 1:110313414-110313436 AGAGAGCCCAGTGTGTTTGCGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913045319 1:115069098-115069120 AGGCAGCCCAGAGTGGTTGGTGG - Intronic
913290613 1:117268473-117268495 AGGCAGACCAGTGTGAATCCTGG + Intergenic
916052872 1:161048462-161048484 AGGGAGACCAGAGGGCTGGAGGG - Exonic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917641038 1:176983299-176983321 AGGGAGTCCAGTGGGAGTGCTGG - Intronic
918402634 1:184178720-184178742 AAGGAGATCAGAGGGATTGTTGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919761263 1:201099611-201099633 AGGAAGCCCAGGGTGCTTGCAGG + Intronic
920427687 1:205891234-205891256 AGGGTCACCAGAGTGATGGTTGG + Intergenic
922185890 1:223274005-223274027 AGGGAGCCCAGATTTATAGCTGG + Intronic
922603457 1:226874045-226874067 AGGGAGAGCAGAGTGAGCCCTGG + Intronic
923570322 1:235107671-235107693 AGGTAACCCAGAGTTATTGCAGG - Intergenic
924738679 1:246781606-246781628 AGGGATTCCAGAGGGATTCCAGG + Intergenic
1064000489 10:11660037-11660059 AGAGAGACTAGAGTGATGGAAGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065330577 10:24593302-24593324 AGGGAGACCAGAAACATTTCTGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1070526175 10:77297879-77297901 AGGGAGACCTGTGTGATAACTGG + Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074229451 10:111519291-111519313 AGCGATACCAGAGTAATAGCAGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074853630 10:117457699-117457721 AAGGAGACCAAAGTAATTACAGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082941559 11:58710504-58710526 AGGAAAGCCAGAGTGAATGCAGG + Intronic
1084002229 11:66302596-66302618 ATGGAGCCCAGAGTGGTTGCAGG - Intergenic
1084273550 11:68040942-68040964 AGGGAGGCCAGAGTGAAGGTGGG + Intronic
1084661543 11:70549358-70549380 AGGGGGACCAGTGTGACTGTGGG - Intronic
1084989364 11:72909058-72909080 AGGGAGACCGGAGAGATGGAGGG - Intronic
1085974897 11:81640717-81640739 ATGGCGACAAGAGTGATCGCTGG + Intergenic
1086103360 11:83124693-83124715 AGGGAGCCCATTGTCATTGCTGG - Intergenic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088755006 11:112878392-112878414 AGAGAGAACAGAGTGAGAGCTGG - Intergenic
1088815222 11:113416261-113416283 AGGGAGGCAAGAGCGATGGCAGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090498951 11:127242951-127242973 AGGGAGACCAGAGGCATTAGAGG - Intergenic
1091288621 11:134423965-134423987 AGGGAGACCAGAGAGGATGAAGG - Intergenic
1091436068 12:474058-474080 ATGTAGAACAGAGTCATTGCTGG + Intronic
1092332886 12:7601872-7601894 AGGAAGACCAAAGTATTTGCTGG + Intergenic
1094045362 12:26160660-26160682 AGGGAGACTAGGGTGATAGCAGG - Intronic
1094587262 12:31788902-31788924 AGGGAGACCAGAGTAATGCAAGG - Intergenic
1096480068 12:51934224-51934246 AGGGAGTCCAGAGTGGCTGGAGG - Intergenic
1097066315 12:56323178-56323200 AGGGAGTCCAGAGGGTGTGCTGG - Exonic
1097118657 12:56717202-56717224 AGGGAGACAGGAGTCACTGCTGG + Intronic
1097268726 12:57761110-57761132 GAGGAGACCATACTGATTGCTGG - Intergenic
1098466349 12:70790881-70790903 AGGGAGACAAGAATGATGGCTGG - Intronic
1099024395 12:77447602-77447624 AGGGAGAACAAAGCAATTGCAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099979154 12:89579004-89579026 ACAGAGACCAGAGGGAGTGCTGG + Intergenic
1100785536 12:98074038-98074060 AGGGAGACATGAGAGACTGCAGG - Intergenic
1101223808 12:102667617-102667639 AGGGTCACCAGAGTGATGGCTGG - Intergenic
1101999180 12:109545966-109545988 AGGGAGGCCAGAGGAATTTCAGG + Intergenic
1102580465 12:113883233-113883255 ATGGTGAACAGACTGATTGCAGG + Intronic
1102810046 12:115816227-115816249 AGGGAGAACAGATCGAATGCCGG + Intergenic
1103968064 12:124652709-124652731 AGGCAAAGCAGAGTGAGTGCTGG + Intergenic
1104286985 12:127432563-127432585 AGGGAGCACAGAGAGACTGCAGG + Intergenic
1104482696 12:129121971-129121993 AGGGAGACGAGATGGATGGCAGG + Intronic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110373797 13:74769065-74769087 AGGAAGTTCAGAGTGATTCCTGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110689306 13:78413196-78413218 AGGGAGGCCAGAGTGGCTGAAGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112129007 13:96500558-96500580 TGGGAGAACAGGGTGACTGCAGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115467161 14:33728124-33728146 AGGGAGAAGAGAGTGTTTGCTGG - Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1117082314 14:52165140-52165162 AGGGTCACCAGAGTGATGGCTGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117843768 14:59889205-59889227 AGGGAGACCAAAGTTATCACTGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118977104 14:70687280-70687302 AGGGAGGCCAGAGGTTTTGCAGG - Intergenic
1119165439 14:72488762-72488784 ATGGAGCCCTGAGTGAGTGCTGG - Intronic
1119640986 14:76314778-76314800 AGAGAGGCCAGAATGCTTGCCGG - Intronic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1122088286 14:99321851-99321873 AGGGTGACCAAAGTGTTTGCTGG - Intergenic
1123136311 14:106030733-106030755 TGGGACACCAGATTGATTTCAGG + Intergenic
1123453748 15:20396194-20396216 AGGGAGAAAAGAGTGAGTGAGGG - Intergenic
1127904415 15:63365727-63365749 AGGGAGACCAGAGGGATGTAGGG - Intronic
1129844315 15:78761268-78761290 AGGCAGACCGGGGAGATTGCAGG + Intronic
1130275806 15:82475842-82475864 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1130468165 15:84203234-84203256 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130496099 15:84470308-84470330 AAGGAGACCACAGTGCTTGCTGG - Intergenic
1130590458 15:85207832-85207854 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1131153802 15:90062707-90062729 AGGGAGAACAGAGTGATACCGGG + Intronic
1132796639 16:1727684-1727706 GGGAAGACCAGACTGACTGCTGG + Intronic
1133214071 16:4280239-4280261 AGGGACAATAGAGTGCTTGCAGG - Intergenic
1133524958 16:6595672-6595694 AGGGAAGCCAGAGACATTGCTGG - Intronic
1134135369 16:11673544-11673566 AGGGAGACCATGGATATTGCTGG - Intronic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1135424785 16:22326992-22327014 CGGGGGAGCAGAGTGCTTGCTGG + Intronic
1135825130 16:25720430-25720452 AGGGAGACAAGAGAGAATGCAGG + Intronic
1135958817 16:26978982-26979004 AGAGAGAACAGAGAGATGGCAGG - Intergenic
1136516793 16:30773313-30773335 TGGGAGACAGGAGTGATGGCAGG + Intronic
1137737857 16:50738335-50738357 GGGGAGTGCAGAGGGATTGCAGG + Intergenic
1139611469 16:68061923-68061945 AGGAAGACCACTGTGCTTGCTGG + Intronic
1140830598 16:78747069-78747091 AAGAAGACTAGAGTGGTTGCAGG - Intronic
1141661565 16:85444370-85444392 AGGGAGGCGAGAGAGATGGCAGG + Intergenic
1142191927 16:88722071-88722093 AGGGAGACCCGCGTGTTTGGGGG + Intronic
1142230003 16:88895656-88895678 AGTGAGAGCAGAGTGAGCGCTGG - Intronic
1142794272 17:2295250-2295272 AGGGAGAGCAGCGTGATTTATGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143779258 17:9220904-9220926 ACGGAGGCCAGGGTGGTTGCAGG + Intronic
1144838647 17:18172010-18172032 AGGGAGGCCAGAGAGATGGGAGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146017634 17:29246782-29246804 AGGGAGAGCAGAGTGCTGACAGG + Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150448030 17:65242814-65242836 AGGATGACCAGAGAGACTGCAGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151519414 17:74617552-74617574 AGGGAGACCTGGGTGTTTCCTGG + Intronic
1152152837 17:78613427-78613449 ATGGAGACCAGATGGATTGAGGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156497938 18:37538114-37538136 CGGGAGGCCAGAGGGATGGCGGG + Intronic
1156595356 18:38542319-38542341 AGGGGGACCTGATTCATTGCAGG - Intergenic
1158860286 18:61584814-61584836 AGGAAGCCCAGAGTCAGTGCAGG - Intergenic
1159013376 18:63080837-63080859 AGGGAGGCCCCAGTGATTTCTGG - Intergenic
1164770290 19:30803061-30803083 AGCAAGGCCAGAGTAATTGCTGG - Intergenic
1165633288 19:37319747-37319769 AGGGAGGTCAGAGGGATAGCCGG - Intronic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1166749834 19:45159479-45159501 AGGGAGGCCGGAGTGATGGGTGG + Intronic
1166828616 19:45625050-45625072 AGGGGGACCAGAGAGAGGGCAGG - Intronic
1166839682 19:45689260-45689282 AGAGAGACCAGAAAGATTCCAGG - Intronic
1167131592 19:47589843-47589865 AGGGAGACCAGGGAGAAAGCCGG - Intergenic
1167164455 19:47789022-47789044 AGGGATTCCACAGTGATTCCTGG - Intergenic
1167839184 19:52100006-52100028 AGTGAGTCCAGAGTGATGACTGG - Intergenic
1167863782 19:52307445-52307467 AGGGTCACCAGAGTGACGGCTGG - Intronic
925119992 2:1410903-1410925 ATGGAGAGCAGAGAGATTGCAGG - Intronic
925538800 2:4944239-4944261 AAGGAGTCAAGAGTGTTTGCAGG + Intergenic
926318041 2:11725803-11725825 AGGGAGAAAAAAGTGATTCCGGG - Intronic
926481547 2:13403050-13403072 AGGGAGAAAAGAGTGAGTGAGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926792759 2:16591759-16591781 AGGGAGCTCAGAGTGCCTGCTGG - Intronic
928455326 2:31415776-31415798 AAGAAGACCAGAGTGAATGCTGG - Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929911358 2:46092150-46092172 AGGTAGCTGAGAGTGATTGCTGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
931044971 2:58341224-58341246 AGGCAGGCCAGAGTGATCCCAGG - Intergenic
931151173 2:59575114-59575136 AGGGAGACTAGTGTGACTGGAGG + Intergenic
933856583 2:86420054-86420076 ATGGAGACCAGAGTGGCTGCAGG - Intergenic
936444737 2:112586586-112586608 AGGGAGACCAGGGAGAAGGCTGG - Intronic
938652744 2:133400623-133400645 AGGGAGCCCAGCCTCATTGCAGG + Intronic
938935933 2:136127609-136127631 AGGGGGACCAGGGAGATTACAGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940864180 2:158800751-158800773 AGAGTGACCAGAGTGAAGGCAGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
945491712 2:210463726-210463748 AGAGAGACCAGAGGGATTTATGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947996911 2:234535520-234535542 AGGGGGATAAGAGTGATTGATGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169535817 20:6538854-6538876 TGGGAGCCCAGAGAGACTGCTGG - Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170021804 20:11844879-11844901 TGGGAAACAAGAGTGATTACAGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170828551 20:19819307-19819329 AGAGACACCAGAGAGCTTGCTGG - Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172448499 20:35005599-35005621 AGGGAGACAAGAATGACTGAGGG - Intronic
1172778443 20:37421713-37421735 AGGGAGACAAAAGTGAGTGGAGG - Intergenic
1172894007 20:38286800-38286822 AGGGAGTCCAGAGTGGTGGCTGG + Intronic
1173556122 20:43967114-43967136 AGGGAGACCAGAGTCACCCCAGG + Intronic
1174185313 20:48702281-48702303 AGGGAGACCTGTGTGATCCCAGG - Intronic
1174209770 20:48868188-48868210 AGGGAGACAAGAGGGAGTGGTGG + Intergenic
1174872448 20:54195699-54195721 CTGGAGACCAGAGGGTTTGCAGG + Intergenic
1175723092 20:61299340-61299362 ACGGAGATCAGAGTGTCTGCAGG - Intronic
1175853605 20:62107069-62107091 AAGGAGACCAGAGTGGCTGGAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180889913 22:19279544-19279566 AGTGAGCCCATATTGATTGCAGG - Intronic
1182153400 22:28047352-28047374 AGGGATACAAGAGTGCTTCCTGG + Intronic
1182676242 22:32042150-32042172 AGGCAGACCAGAGTCCTGGCAGG + Intergenic
1183827043 22:40396739-40396761 AGGAGGACCAGAGTGAATGGGGG + Intronic
950833685 3:15899629-15899651 AGGGAGGCATGAGTGATTGGGGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952500771 3:33959759-33959781 AGTGAGCTCAGAGGGATTGCGGG + Intergenic
952841660 3:37651821-37651843 AGGACAACCAGAGTGATAGCTGG + Intronic
953824591 3:46239996-46240018 AGGGAGATAAGATTGACTGCTGG - Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954505206 3:51064051-51064073 GGAGAAACCAGAGTTATTGCTGG + Intronic
954633430 3:52058897-52058919 AGAGAGACAGGAGTCATTGCAGG - Intergenic
957089703 3:75717605-75717627 ATGGAGATCAGTGTGAGTGCCGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957635406 3:82777671-82777693 ATGGTGACCAGAGTGATGGGTGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960052124 3:113249088-113249110 GAGGAGAGCAGGGTGATTGCAGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964092578 3:152893900-152893922 AGGCAGACAAGACTGATGGCAGG + Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965261908 3:166497782-166497804 AGGGAAACAAGAGTGATGACAGG - Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973973054 4:56234032-56234054 AGTGAGTCCAGAAAGATTGCAGG - Intronic
975043021 4:69768643-69768665 ATGGTGACCAGAGTGACTTCTGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975352038 4:73357690-73357712 AGGGTCACCAGAGTGATGGTTGG + Intergenic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977271802 4:94926059-94926081 AGGGAGACGGGAGGGATTGGGGG - Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979565764 4:122152542-122152564 AGAGAGGCCAGAGGGATTTCGGG + Exonic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980622098 4:135320795-135320817 AGAGACAGCAGAGTGATTACGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
985124652 4:186681086-186681108 AGGGAAACAAGAGTGAATGTAGG + Intronic
985487367 5:158980-159002 AGGGAAACTAAAGTGACTGCTGG - Intronic
987198119 5:15547731-15547753 AGGGAGACCAGAAAGAGTCCGGG + Intronic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
991080794 5:62596852-62596874 AGGGAGACAAGAGAGAAAGCTGG - Intronic
991632002 5:68665607-68665629 AGGAAGAAAAGAGTGAGTGCAGG + Intergenic
991661025 5:68950889-68950911 AGAGACACTAGACTGATTGCTGG - Intergenic
991930920 5:71751726-71751748 AGGGACACCAGAGAGCTTGCTGG - Intergenic
992562464 5:77966066-77966088 AGGCAGACCAGAGGGAATGGTGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994095658 5:95845286-95845308 AGGGAGACCAGGGTGTCTGCAGG - Intergenic
995278129 5:110301290-110301312 AGGCACACCAGTGGGATTGCTGG + Intronic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997919548 5:137965448-137965470 ATGGAGACCAGAGGAATTACCGG - Intronic
1002057005 5:176603907-176603929 AGGGAGACAAGAGGGAGTGGTGG + Intronic
1004151558 6:13124804-13124826 AGAGACACCAGAGAGCTTGCTGG - Intronic
1005252556 6:23964155-23964177 AAGGAGGGCAGTGTGATTGCAGG - Intergenic
1007095007 6:39207667-39207689 AGGGATACCAGGGTGTTTGAAGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011781152 6:90790716-90790738 AGGGAGTCCTGTGTGATGGCAGG - Intergenic
1012961661 6:105628713-105628735 GGGAAGAGCAGGGTGATTGCAGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017328598 6:153169984-153170006 AGAGAGACCAGAGTGGATGCTGG + Intergenic
1017738761 6:157386102-157386124 AGGGTGACCAGAGTCCTTGGGGG - Intronic
1017928678 6:158933383-158933405 AGGGAGGCCAGAGTGATTTAGGG + Intergenic
1018069968 6:160155610-160155632 AGGGAGAAAAGAGTGATGGGAGG + Intronic
1019187062 6:170226857-170226879 AGGCAGACCAGGGTGGTTGGTGG + Intergenic
1019374132 7:680180-680202 AGAGAGACCAGAGAGGCTGCAGG + Intronic
1020588419 7:10103110-10103132 TTGGAGCCCAGAGGGATTGCTGG - Intergenic
1020802415 7:12748109-12748131 ATGGCGATCAAAGTGATTGCTGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1030691465 7:112539262-112539284 GGGAAGACCAGAGGGCTTGCAGG - Intergenic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033162499 7:139010040-139010062 ATGGCGACCAGAGTGACTTCTGG - Intergenic
1033664760 7:143429874-143429896 AGGGATTTCAGAGTGGTTGCAGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034189386 7:149202062-149202084 AGGGAGACGAGTGTGCTTGGGGG - Intronic
1034487117 7:151372978-151373000 AGGCAGAACAGAGTGGCTGCTGG - Intronic
1035235826 7:157497143-157497165 AGGGAGAGCAGAGGGAGGGCTGG - Intergenic
1035600527 8:894602-894624 GGGGAGAGCAGAGTGACAGCTGG + Intergenic
1037913221 8:22756720-22756742 AGGGAGAAGAAAGTGGTTGCTGG + Intronic
1038753236 8:30316345-30316367 AAGGAGACCAGAGAGATGCCAGG + Intergenic
1039751296 8:40481364-40481386 AGGGAAACAAGAGTGAAAGCAGG - Intergenic
1040289572 8:46117409-46117431 AGCGAGACCACAGGGAATGCTGG - Intergenic
1040300122 8:46183614-46183636 AGCGAGACCACAGGGAATGCTGG - Intergenic
1040300305 8:46184551-46184573 AGTGAGACCACAGGGAATGCTGG - Intergenic
1040300994 8:46187948-46187970 ATTGAGACCAGAGGGAATGCTGG - Intergenic
1040303680 8:46201179-46201201 AGTGAGACCACAGGGAATGCTGG + Intergenic
1040307300 8:46218781-46218803 AGCGAGACCACAGGGAATGCTGG - Intergenic
1040313832 8:46250547-46250569 AGCGAGACCACAGGGAATGCTGG + Intergenic
1040317758 8:46273974-46273996 GATGAGACCACAGTGATTGCTGG + Intergenic
1040325122 8:46337770-46337792 AGTGAGACCACAGGGAATGCTGG + Intergenic
1040329383 8:46378197-46378219 AGTGAGACCACAGGGAATGCTGG + Intergenic
1040331927 8:46390082-46390104 AGCGAGACCACAGGGAATGCTGG + Intergenic
1040335073 8:46411969-46411991 AGCGAGACCACAGGGAATGCTGG + Intergenic
1040335206 8:46412615-46412637 AGCGAGACCACAGGGAATGCTGG + Intergenic
1040335811 8:46415397-46415419 AGGTAGACCACAGCGAATGCTGG + Intergenic
1040336165 8:46417116-46417138 ACCGAGACCACAGTGAATGCTGG + Intergenic
1040336695 8:46419664-46419686 AGAGAGACCACAGGGAATGCTGG + Intergenic
1041104058 8:54424583-54424605 AGGGAGACCTAAGAGATGGCGGG - Intergenic
1042944732 8:74143963-74143985 AGGGAGACCAGTGAGATAGTGGG + Intergenic
1042987886 8:74604222-74604244 ATGGAAACCAGTGTGATTGAAGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044183567 8:89224653-89224675 AGGAAGAAAAGAGTGAATGCAGG + Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046544958 8:115638235-115638257 TGGGAGACTTGAGTGATTACCGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047968342 8:130063945-130063967 AGGGAGAAAAGAGTGCTGGCTGG + Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048409678 8:134159499-134159521 AGAGAGAAGAGAGAGATTGCTGG - Intergenic
1050697786 9:8298273-8298295 AGGAAGACAGGGGTGATTGCTGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052441681 9:28504964-28504986 GAGGAGACCAAAATGATTGCAGG + Intronic
1053527296 9:38843037-38843059 ATGAAGACAGGAGTGATTGCAGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054199519 9:62067468-62067490 ATGAAGACAGGAGTGATTGCAGG - Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054638836 9:67520889-67520911 ATGAAGACAGGAGTGATTGCAGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1058522918 9:105829442-105829464 AGGGAGACAGCACTGATTGCAGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059035515 9:110749938-110749960 AGTGAGACCAGAATAATTCCAGG - Intronic
1059232407 9:112733248-112733270 AGAGACACCAGAGAGCTTGCTGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1203487864 Un_GL000224v1:74121-74143 ATGGAGATCAGTGTGAGTGCCGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1203500485 Un_KI270741v1:16016-16038 ATGGAGATCAGTGTGAGTGCCGG - Intergenic
1185871470 X:3668291-3668313 ACAGAGACCAGAGTGAAGGCAGG - Intronic
1187251001 X:17597902-17597924 AGGGTGCCCAGAATGATCGCAGG + Intronic
1187362889 X:18644548-18644570 AAGGAGATCAAAGTGATTTCAGG - Exonic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1192048444 X:67700824-67700846 AGGGAGATCTGAGTCATTGGTGG + Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192564649 X:72153666-72153688 AGGCAGACCAGAGTGAGTCTGGG + Intergenic
1192690085 X:73353692-73353714 AGTGAGACCAGAGTGCTTGTTGG + Intergenic
1193848965 X:86511960-86511982 AAAGAGACCAGAGTAATTGAAGG + Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195950820 X:110270773-110270795 AGGGAGATCAGAAAGAGTGCTGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198685363 X:139222829-139222851 AAATAGTCCAGAGTGATTGCAGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200978425 Y:9238604-9238626 AAGGTCACCAGAGTGATGGCTGG + Intergenic
1201614717 Y:15884724-15884746 AGGAAGACAAGAGACATTGCAGG + Intergenic