ID: 1165645341

View in Genome Browser
Species Human (GRCh38)
Location 19:37431253-37431275
Sequence AGCTGCGAGCTGCACTACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 4, 2: 40, 3: 127, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165645341_1165645349 18 Left 1165645341 19:37431253-37431275 CCGAGGTAGTGCAGCTCGCAGCT 0: 1
1: 4
2: 40
3: 127
4: 296
Right 1165645349 19:37431294-37431316 TTCCACTTGAGAAGAGGAGAAGG 0: 6
1: 78
2: 186
3: 344
4: 846
1165645341_1165645347 12 Left 1165645341 19:37431253-37431275 CCGAGGTAGTGCAGCTCGCAGCT 0: 1
1: 4
2: 40
3: 127
4: 296
Right 1165645347 19:37431288-37431310 CCTTCCTTCCACTTGAGAAGAGG 0: 6
1: 57
2: 156
3: 291
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165645341 Original CRISPR AGCTGCGAGCTGCACTACCT CGG (reversed) Intronic
900394259 1:2446702-2446724 AGCTGAGAGCTGGCCAACCTGGG + Intronic
900814195 1:4830904-4830926 AGCTGCCAGCTGCTCGACCTCGG + Intergenic
902515977 1:16989869-16989891 AGCTGGGGGCGGCCCTACCTTGG + Exonic
902632647 1:17714575-17714597 TGCTGCGACCTGCAGTACCTGGG + Intergenic
902763646 1:18600448-18600470 AGCTGCGAGCTGCGTCTCCTGGG - Intergenic
906765506 1:48427818-48427840 AGGTGCTATGTGCACTACCTGGG - Intronic
906915435 1:50004473-50004495 TGCTGTAAGCTGCACTGCCTGGG - Intronic
907023690 1:51094582-51094604 AGCTGCGAGCTGTGCTGCCCGGG - Intergenic
907518466 1:55008127-55008149 AGCCGCTAGCTGCAAGACCTAGG - Intronic
907604992 1:55807229-55807251 AGCTGTGAGCTGTACAGCCTGGG - Intergenic
909209763 1:72808406-72808428 ATCTTCAAGCTGCACTGCCTGGG + Intergenic
909231289 1:73093691-73093713 AGCTATAAGCTGCACTGCCTTGG + Intergenic
909271250 1:73626701-73626723 AGCTGTGAGTTGCACTGTCTGGG - Intergenic
910102549 1:83594181-83594203 AGCTGTGAGCTGCACCACCTGGG + Intergenic
910716457 1:90236385-90236407 TGCTGTGAGCTGCACTGCCTGGG + Intergenic
911239454 1:95449335-95449357 AGCTGTGAGCTACGCTGCCTGGG + Intergenic
912152705 1:106879796-106879818 TGCTGTAAGCTGCACTGCCTGGG - Intergenic
912558133 1:110530832-110530854 AGCTACTAGCTGCATGACCTTGG + Intergenic
912633317 1:111267956-111267978 AGCTTTGAGCTGCACTGCCTAGG + Intergenic
912873187 1:113328516-113328538 AGCTGTGAGCTGCACTGCCTGGG + Intergenic
913147140 1:116003269-116003291 AGCTGTGAGCTGTGCTGCCTGGG + Intronic
916492148 1:165311468-165311490 AGCCGACAGCTGCAGTACCTGGG - Intronic
916993237 1:170267512-170267534 AGCTGCAAGCTGTGCTGCCTGGG + Intergenic
918357944 1:183723863-183723885 AGCTGTGAGCTGCACTGCGTGGG - Intronic
918697940 1:187567425-187567447 TGCTGCGAGCAACAGTACCTAGG + Intergenic
919336560 1:196243901-196243923 AGCTGTGAGCTGCACCGCCTGGG - Intronic
919727949 1:200895855-200895877 TGCTGCGGTCTGTACTACCTTGG - Intronic
920297799 1:204969780-204969802 AGCTGAGAACTGCTCTAGCTGGG + Intronic
921002198 1:211055620-211055642 AGCTGTGAGCTGCGCTGTCTGGG - Intronic
921774617 1:219082422-219082444 AGCTGTGAGCTGCGCTTCCTGGG + Intergenic
921929453 1:220743195-220743217 AGCTGTGAGCTGTGCTGCCTGGG + Intergenic
921954706 1:220970184-220970206 AGAAGTGAGCTGCACAACCTTGG + Intergenic
922358176 1:224796112-224796134 AGCTGCAAGCTGCACTGCCTGGG + Intergenic
922388612 1:225114428-225114450 AGCTGGGAGCTGTGCTGCCTGGG + Intronic
922642160 1:227245193-227245215 TCCTGTGAGCTGCACTGCCTGGG - Intronic
922807605 1:228398767-228398789 AGCTGGGAGCAGCTCCACCTTGG + Intronic
922878760 1:228963004-228963026 AACTTGGAGCTGCACCACCTTGG + Intergenic
923540973 1:234887974-234887996 AGCTGCATGCTGCCATACCTGGG - Intergenic
1062836115 10:636940-636962 AGCTGCGACCGGCACCACATGGG + Intronic
1064446523 10:15398718-15398740 TGCTGTGAGCTGTACTGCCTGGG - Intergenic
1066154656 10:32661814-32661836 AGCTGTGAGTTGCACTGCCTGGG + Intronic
1066176101 10:32907937-32907959 AGCTGCGAGTTGGACAAGCTTGG + Intronic
1066649780 10:37643301-37643323 TGCTGTGAGCTGCGCTGCCTAGG + Intergenic
1066708178 10:38203565-38203587 AGCTGTGAGTTGCACTGTCTAGG - Intergenic
1066981325 10:42419018-42419040 ACCTGTGAGCTGCACTGTCTAGG + Intergenic
1067764188 10:49072778-49072800 GGCTGAGAGTGGCACTACCTTGG + Intronic
1068373652 10:56151591-56151613 AGCTGCAAGTTGCGCTGCCTGGG - Intergenic
1070034730 10:72711294-72711316 CGCTGCGATCTCCACTTCCTGGG + Intronic
1070641525 10:78173862-78173884 AGCTGCGAGCTGCAGCCTCTGGG - Intergenic
1071321697 10:84466578-84466600 CGCTGCAAGCTCCACTTCCTGGG + Intronic
1071935582 10:90526696-90526718 AGCTGTGAGCTGTGCTACCTGGG + Intergenic
1071962923 10:90824080-90824102 AGCTGCAAGCTGCACTGCCTGGG - Intronic
1072344373 10:94488944-94488966 TGCTGCAAGCTTCACTACCTGGG + Intronic
1074501368 10:114028002-114028024 ATCTGCTAGCTGCATGACCTTGG - Intergenic
1075496325 10:122922523-122922545 AGCTGTGAGCTGTGCTGCCTGGG - Intergenic
1075580114 10:123611108-123611130 CTCTGCTAGCTGTACTACCTTGG + Intergenic
1076300449 10:129421617-129421639 AGCTGCATGGTGCACTACCTGGG + Intergenic
1077835427 11:5923034-5923056 TGCTGCAAGCTGCACTGCCTGGG - Intronic
1078578198 11:12518675-12518697 AGCTGCCAGCTGCACAGCCAGGG + Intronic
1079473946 11:20808453-20808475 AGCTGTGAGCTGCACTGCCTGGG + Intronic
1081047833 11:38297822-38297844 AGCAGGGAGCTGCACCACCTGGG + Intergenic
1081212652 11:40355260-40355282 AGCTGCAAGCTGCACTGCTTTGG + Intronic
1081245699 11:40764017-40764039 AAGTGCAAGCTGCAATACCTGGG - Intronic
1082131102 11:48490608-48490630 TGCTGCAAGCTGCACTGCCTGGG + Intergenic
1082245707 11:49919514-49919536 TGCTGCAAGCTACACTGCCTGGG - Intergenic
1082564600 11:54661472-54661494 TGCTGCAAGCTGCACTGCCTGGG + Intergenic
1084763908 11:71295042-71295064 AGCTGTGAGCTGCACTGCCTGGG + Intergenic
1085223386 11:74895630-74895652 TGCTGTGAACTGCACTGCCTGGG - Intronic
1086984409 11:93232712-93232734 ATCTGCCAGCTGCAAAACCTAGG - Intergenic
1087032085 11:93715924-93715946 AGCTGTGAGCTGTGCTGCCTGGG + Intronic
1088181762 11:107121101-107121123 TGCTGTGAGCTGCCCTGCCTGGG - Intergenic
1088362092 11:109001658-109001680 AGCTGTGAGCTGCATAGCCTGGG + Intergenic
1088746099 11:112806293-112806315 AGCTCTGAGCTGGACTACTTGGG + Intergenic
1088944523 11:114495951-114495973 AGCTGCAAGCTGCACTGCTTGGG + Intergenic
1090111157 11:123910856-123910878 TGCTACAAGCTGCACTGCCTGGG - Intergenic
1091051167 11:132373971-132373993 AGCTGTTAGCTGGACTGCCTGGG - Intergenic
1091275911 11:134350058-134350080 TGCTGTGAGCTGCGCTACCTGGG + Intronic
1092403436 12:8197469-8197491 AGCTGCAAGCTGTGCTGCCTGGG + Intergenic
1092497575 12:9012178-9012200 AGCTGCAAGCTCCACTGCCTGGG - Intergenic
1093931680 12:24960692-24960714 AGCTGCAAGCTGTGCTGCCTAGG - Intergenic
1094258500 12:28464396-28464418 AGCTGGGAGCTGTACAACCTGGG - Intronic
1095169638 12:39019433-39019455 AACTGTGAGCTGCACTGCCTGGG - Intergenic
1095181771 12:39154458-39154480 AGCTGTGAGCTGCATTGCCTGGG + Intergenic
1095604745 12:44053162-44053184 AGATGCGAGCTGGACATCCTAGG + Intronic
1095625043 12:44304528-44304550 AGCTGTGAGCTGCACTACTAGGG - Intronic
1097899329 12:64857530-64857552 TGCTATGAGCTGCACTGCCTGGG + Intronic
1098147963 12:67516936-67516958 ACCTGCTAGCTGCATAACCTTGG - Intergenic
1099616084 12:84937889-84937911 TGCTGCGAGCTGCACTGCCTAGG - Intergenic
1099826169 12:87780180-87780202 TTCTGTGAGCTGCACTGCCTTGG + Intergenic
1101090376 12:101279415-101279437 AGTTACCAGCTGCACAACCTTGG + Intergenic
1101331082 12:103758462-103758484 AGCTGTCAGCTGCTCTAGCTGGG + Intronic
1101607424 12:106258241-106258263 AGCTGCAAGCTGTGCTGCCTGGG - Intronic
1103157553 12:118699225-118699247 AGCTGCTAGCTGTATGACCTTGG - Intergenic
1103558488 12:121779835-121779857 ACCTGCGGGCTGCACTGCCCTGG - Exonic
1107370223 13:39737592-39737614 AGCTACAAGCTGCATCACCTGGG + Intronic
1107524262 13:41214361-41214383 TGCTGTGAGCTGCACTGCCTGGG + Intergenic
1107754005 13:43599731-43599753 AGCTGTGAGCTGTGCTGCCTGGG - Intronic
1107774479 13:43823383-43823405 CTCTGTGAGCTGCACTGCCTGGG + Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1108098912 13:46934609-46934631 AGCTGTGAGCTGTGCTGCCTGGG - Intergenic
1108879097 13:55087256-55087278 AGCTGTGAGCTGCACTGCCTAGG + Intergenic
1109031755 13:57199533-57199555 AGCTGCTAGCTGTTCTGCCTGGG + Intergenic
1109336735 13:61003906-61003928 TGCTGCAAGCTGAACTGCCTAGG + Intergenic
1109583656 13:64371451-64371473 AGCTGGGAGCTGTGCTGCCTGGG + Intergenic
1109961711 13:69639653-69639675 AGCTGCAAGCTGCATTGCCTGGG + Intergenic
1110079000 13:71287110-71287132 AGCTGTGAGCTGTGCTGCCTGGG + Intergenic
1110341659 13:74398798-74398820 GGTTGTGAGCTGAACTACCTGGG + Intergenic
1110665814 13:78116405-78116427 AGCTGTGAGCTGCTCTCCCTGGG + Intergenic
1110901452 13:80830717-80830739 AGCTGCAAGCAGCACTGCCTTGG - Intergenic
1111542651 13:89689164-89689186 TGCTGTGAACTGCACTGCCTAGG - Intergenic
1112658010 13:101473712-101473734 AGCTATGAGCTGCACTGCCTAGG - Intronic
1113253885 13:108486014-108486036 CACTGTGAGCTGCACTGCCTGGG - Intergenic
1115330281 14:32189339-32189361 CGCTGCAAGCTGCACTTCCCAGG - Intergenic
1115925199 14:38425442-38425464 AGCTGTGGGCTGCACTGCCTGGG + Intergenic
1116114924 14:40635757-40635779 AACTGCAAGCTGAACTTCCTGGG - Intergenic
1116275664 14:42828065-42828087 AGCTGCAAGCTTCACTGCCTGGG + Intergenic
1116407000 14:44578879-44578901 AGCTGATAGCAGCACTCCCTTGG - Intergenic
1116765891 14:49070278-49070300 TGCTGTGAGCTGCACTGCCTAGG - Intergenic
1117161501 14:52994631-52994653 AGCTGGGAGCTGCATTGCCTGGG + Intergenic
1117384320 14:55195457-55195479 TGCAGAGAGCTGCACTGCCTGGG + Intergenic
1117460293 14:55938596-55938618 AGCTGCGAGCTGCCAAGCCTAGG + Intergenic
1117504489 14:56388744-56388766 AGTTGTGAGCTGTACTGCCTGGG + Intergenic
1118084474 14:62399117-62399139 AGCTGCAAGCTGCCCTGCGTGGG + Intergenic
1120697376 14:87659411-87659433 TGCTGTGAGCTGTACTAACTGGG - Intergenic
1121965996 14:98306304-98306326 AGCTGGAGGCTGCACTAGCTGGG + Intergenic
1122454052 14:101835796-101835818 TGCTCCGAGCTGCCCTGCCTGGG + Intronic
1122543468 14:102510039-102510061 AGCTCCGAGCTGCCCTAGCCCGG + Intergenic
1123931358 15:25173216-25173238 AGCTGGGAGCTGCCCTGCATGGG - Intergenic
1123940889 15:25216138-25216160 AGCTGGGAGCTGCCCTACATTGG - Intergenic
1123943454 15:25227703-25227725 AGCTGGGAGCTGCCCTACATTGG - Intergenic
1123944604 15:25232983-25233005 AGCTGGGAGCTGCCCTACATTGG - Intergenic
1123947117 15:25244200-25244222 AGCTGGGAGCTGCGCTATGTTGG - Intergenic
1123947934 15:25247932-25247954 AGCTGGGAGCTGCTCTATGTTGG - Intergenic
1124492644 15:30167576-30167598 GGCTGGGAGCTGCAGTCCCTGGG + Intergenic
1124750890 15:32370749-32370771 GGCTGGGAGCTGCAGTCCCTGGG - Intergenic
1124795155 15:32771152-32771174 AGCTGCAAGCTCCACCTCCTGGG + Exonic
1125567223 15:40685879-40685901 AGCTGTGAGCTGCACTGCCTGGG + Intergenic
1126053389 15:44707669-44707691 AGCTTTGAGCTGCCCTGCCTGGG + Intronic
1126285856 15:47009656-47009678 AGCTGCAAGCTGCATGTCCTGGG + Intergenic
1126368991 15:47926104-47926126 AGCCAAGGGCTGCACTACCTCGG + Intergenic
1127132583 15:55882733-55882755 AGCTGCATGCTGCACTGCCTGGG - Intronic
1127170840 15:56299591-56299613 AGCTTCGAGCTGAGCTACCTGGG - Intronic
1127241834 15:57124520-57124542 AGCTGTTACCTGCAATACCTGGG - Intronic
1128901126 15:71423616-71423638 AGAGGCAAGCTGCACTGCCTGGG + Intronic
1129030683 15:72615642-72615664 TGCTGCAAGCTGCACTGCCTGGG + Intergenic
1129642335 15:77393343-77393365 AACTGCAAGCTGCACCGCCTGGG - Intronic
1130961668 15:88663576-88663598 AGCTGCTTGCTGCACTGCCTGGG - Intergenic
1130979695 15:88803892-88803914 GGCTGGGGGCTGCACTGCCTTGG + Intronic
1131315180 15:91329396-91329418 AGCTGTGAGCTGTGCTGCCTAGG + Intergenic
1131944854 15:97608761-97608783 ACCTGCGAGCTGCACTGCCTGGG - Intergenic
1134533256 16:15001852-15001874 AGCTGCCAGGTTCATTACCTGGG - Exonic
1138806882 16:60100541-60100563 AGCTGTAAGCTGCACTACCTGGG + Intergenic
1139862776 16:70038887-70038909 AGCTGCCAGGTTCATTACCTGGG + Intergenic
1143413639 17:6728792-6728814 AGTTATGAGCTGCACTGCCTGGG - Intergenic
1145069135 17:19788272-19788294 TGCTGTGAGCTGCGCTGCCTGGG - Intronic
1145117516 17:20225204-20225226 AGCTGTGAGCTGTGCTGCCTGGG + Intronic
1148757945 17:49984394-49984416 AGGTGCGAGGTGAACTGCCTGGG + Intergenic
1150192654 17:63259265-63259287 AGCTGTGAGCTGCACTGCTTGGG + Intronic
1151668616 17:75559298-75559320 TCCTGCGAGCTGCTCTACCTGGG + Exonic
1153129180 18:1834863-1834885 AGCTGTGAGCTGTACTGCCTGGG - Intergenic
1154474840 18:14746309-14746331 CACTGCAAGCTGCACTTCCTGGG - Intronic
1157936922 18:51883586-51883608 AGCTGCGAGCTGCACTGCCAGGG - Intergenic
1158025043 18:52886095-52886117 TGCTGCAAGCTGCACTGCCTGGG + Intronic
1158116803 18:54005073-54005095 AGCTGTGAGCTGCACTGCCTTGG - Intergenic
1159080573 18:63731141-63731163 TGCTGTGAGCTTCACTGCCTGGG - Intergenic
1159142522 18:64414776-64414798 AGCTGAGATCCTCACTACCTGGG + Intergenic
1159260171 18:66003941-66003963 TTCTGTGAGCTGCACTGCCTGGG - Intergenic
1159564906 18:70037331-70037353 TGCTGCGAGCCGCACTGCCTGGG - Intronic
1159775397 18:72598488-72598510 AGCAGTGAACTGCATTACCTGGG + Intronic
1160138466 18:76296233-76296255 AACTGCAAGCTGCACTGCCTGGG + Intergenic
1160543622 18:79638641-79638663 GGCTCCGAGCTGCTCTACGTGGG - Intergenic
1161802778 19:6425017-6425039 AGCTGCGAGCTGCCCGTGCTGGG + Intergenic
1162596084 19:11630352-11630374 AGCTGCTGGCTGTACTGCCTGGG - Intergenic
1162930063 19:13953101-13953123 AGCTGGGAGTTCCAGTACCTGGG + Intronic
1164672092 19:30078006-30078028 GGCTCCTAGCTGCACTGCCTGGG + Intergenic
1165645341 19:37431253-37431275 AGCTGCGAGCTGCACTACCTCGG - Intronic
1167507247 19:49877422-49877444 GTCTGAGAGCTGCACCACCTGGG - Exonic
926780678 2:16468576-16468598 ACCTGCAAGCTGCATGACCTTGG + Intergenic
927570342 2:24153637-24153659 TGCTGCAAGCTGCACTGCCTGGG + Intronic
928293500 2:30060972-30060994 TTCTGGGAGCTGCACTGCCTGGG - Intergenic
928864050 2:35895977-35895999 AGCTGTGAGCTGTACTACCTGGG + Intergenic
929281784 2:40087855-40087877 AGCTGTGAGCTGTGCTGCCTGGG + Intergenic
930041580 2:47129222-47129244 AGCTGCAAGCTGTGCTGCCTGGG + Intronic
930230735 2:48841499-48841521 AGCTGTGAGCTGCATTGCCTGGG + Intergenic
930432821 2:51302469-51302491 AGCTGCAAGCTGGAGTACCACGG + Intergenic
930778204 2:55196393-55196415 AGTTGTGAGCTGCACTCTCTGGG - Intronic
930895494 2:56441044-56441066 AGCTGCAAGCTCCGCTTCCTGGG + Intergenic
931012235 2:57930003-57930025 AGCTGTGAGCTGCACCACCTGGG + Intronic
931406966 2:61988600-61988622 AGCTGTGAGCTGTGCTGCCTGGG + Intronic
931582958 2:63796903-63796925 AGCTGCAAGCTGCGCTTCCTGGG - Intronic
931600921 2:64001802-64001824 AGCTGTGAGCTGGGCTGCCTGGG + Intronic
932517505 2:72368105-72368127 AGCTATGAGCTGCACTGCCTGGG - Intronic
933240588 2:79916656-79916678 AGCTGCAAGCTCCACCTCCTGGG + Intronic
934870565 2:97861333-97861355 AGCTGTGAGCTGTGCTGCCTGGG - Intronic
934928915 2:98404405-98404427 AGCTGCAAGCTGCACTGCATGGG - Intergenic
936511344 2:113150041-113150063 AGCTGTGAGCTGCACTGCCTGGG + Intergenic
937194009 2:120133814-120133836 AGCTGTAAGCTGCACTGCCTGGG - Intronic
937301182 2:120843336-120843358 AGCTCTGAACAGCACTACCTCGG - Intronic
937739419 2:125332980-125333002 AGCTGTGAGCTGTACACCCTGGG - Intergenic
939144473 2:138396058-138396080 GGCTGCAAACTGCACTGCCTGGG - Intergenic
939273543 2:139970686-139970708 TGCTGCAAGCTTCACTGCCTAGG - Intergenic
940795310 2:158071237-158071259 TGCTGCGAGTTGCACTGCCTGGG - Intronic
941047586 2:160694379-160694401 TGCTCCCAGCTGCACTGCCTGGG + Intergenic
941528295 2:166632666-166632688 AGCTGCAAGCTGCACTGACTGGG + Intergenic
941672642 2:168311073-168311095 TGCTGTGAGCTGCACTGCTTAGG + Intergenic
941851872 2:170191271-170191293 AGCTGTGCGCTGCACTGCCTGGG + Intronic
941916196 2:170815607-170815629 CCCTGCGTGCTGCACCACCTGGG + Intronic
942294862 2:174507509-174507531 AGCTGTGAGCTGCACTGCCTGGG - Intergenic
942391838 2:175503001-175503023 TGCTGCAAGCTGCACTGCCTAGG + Intergenic
942862723 2:180635744-180635766 TGCTTTGAGCTGCACTGCCTGGG - Intergenic
943067679 2:183105879-183105901 AGCTATGAGCTGCACTGCTTAGG + Intergenic
943117553 2:183692077-183692099 TGCTGTGAGCTGCACTGCCATGG + Intergenic
943933541 2:193885671-193885693 TGCTGTGAGCTGCACAGCCTGGG - Intergenic
944616485 2:201465541-201465563 AGCTACAAGCTGCACTGCCTGGG + Intronic
944680442 2:202072442-202072464 AGCTGTCAGCTGAACTACCCTGG - Intergenic
944760084 2:202806156-202806178 AGCTGTAAGCTGCACTGCCTGGG - Intronic
944760304 2:202807677-202807699 AGCTGTAAGCTGCACTGCCTGGG - Intronic
944855152 2:203760152-203760174 AGCTGCGAGCTGTGCTGCCTTGG + Intergenic
944990583 2:205230572-205230594 AGCCGTGAGCTGCACTGCCTGGG + Intronic
945754517 2:213829944-213829966 AGCTGTGAGCTGCACTGTCTGGG + Intronic
1169908632 20:10628750-10628772 GGCTGCAAGCTGCAATCCCTGGG + Intronic
1172418874 20:34797181-34797203 AGCTGTGAGCTGTGCTGCCTGGG - Intronic
1173709644 20:45143438-45143460 AGCTGTGTGCTGCACTGCCTGGG + Intergenic
1176246407 20:64099327-64099349 AGCTGCCTGCTGCACTTCCCGGG - Exonic
1176815830 21:13601910-13601932 TGCTGCAAGCTCCACTTCCTGGG - Intergenic
1176939999 21:14912278-14912300 AGCTGTGAGCTGCATTACCAGGG + Intergenic
1177068861 21:16476330-16476352 AGCTACTAGCTGCTCTAGCTGGG + Intergenic
1177222287 21:18209969-18209991 AGCTGCAAGCTGAACTGCCTTGG + Intronic
1177276033 21:18913830-18913852 AGCTGCCAGTTGCACTATGTGGG + Intergenic
1177539784 21:22477477-22477499 AGCTGCAAGCTGTGCTGCCTGGG - Intergenic
1177692760 21:24532239-24532261 AGCTGTGAGCTGCATTGCCTGGG - Intergenic
1177771254 21:25518919-25518941 AGCTGCAAGCTGCACTGCCGGGG - Intergenic
1179344751 21:40546271-40546293 AGCTGTGAGCAGCATTTCCTTGG + Intronic
1179444136 21:41419866-41419888 AGCTGGGGGCTGCAGGACCTGGG - Intergenic
1180080029 21:45482432-45482454 AGATGAGAGCTGCACTGCTTTGG + Intronic
1181762772 22:25069434-25069456 AGCTGCCAGCTGCACCAGGTGGG - Intronic
1183032601 22:35117036-35117058 AGCCCCGGGCTGCACTCCCTTGG - Intergenic
1183439696 22:37816218-37816240 AGCTGCTGGCTTCACTATCTCGG + Exonic
1183599779 22:38833187-38833209 AGCTGGGAGTACCACTACCTGGG - Intronic
949829324 3:8197272-8197294 AGTTGAGAGCTGCACTGCCTGGG + Intergenic
950801151 3:15552664-15552686 AGCTGCGAGCTGCACTGCCTGGG + Intergenic
951398656 3:22203096-22203118 AGCTGTGAGCTGCACTGCCTGGG - Intronic
952132870 3:30384854-30384876 TGCTGTGAGCTGCACTGCCCAGG + Intergenic
952221898 3:31331803-31331825 AGCTGTGAGCTGTACAGCCTGGG - Intergenic
952672973 3:35993543-35993565 TGCTGTGAGCTGCACTGCCTTGG - Intergenic
952912785 3:38204754-38204776 AGCTGCAAGCTGTGCTGCCTGGG + Intronic
953362464 3:42309922-42309944 TGCTGCAAGCTGCACTGCCTGGG + Intergenic
954422689 3:50426943-50426965 AGCTGGGAGCTGGTCTCCCTGGG - Intronic
954488110 3:50873484-50873506 AGCTGCAAGCTGTACAGCCTGGG + Intronic
957965777 3:87321331-87321353 AGCGGTGAGCTGCACTGCCTGGG - Intergenic
959189912 3:103097814-103097836 TGCTGTGAGCTGCACTGCCTGGG + Intergenic
959215707 3:103447995-103448017 TGCTGTGAGCTGCACTGTCTAGG - Intergenic
960067249 3:113387246-113387268 AGCTGCGAGCTGTGCTGCCTGGG - Intronic
960298130 3:115968635-115968657 AGCTGTGAGCTGCACTGCCTGGG + Intronic
960404084 3:117238412-117238434 AGCTGGGAGCTGCACTGCCTGGG - Intergenic
960490693 3:118313750-118313772 TGCTGCAAGCAGCACTGCCTGGG - Intergenic
960528246 3:118734829-118734851 AGCTGCCTGCAGCACCACCTGGG + Intergenic
963290316 3:143480632-143480654 AGCTGCGTGGGGCACCACCTGGG + Intronic
963995911 3:151708736-151708758 AGCTGCAAGCTGCACTGCCTAGG - Intergenic
964140833 3:153397098-153397120 AGCTATGAGCTGTGCTACCTGGG + Intergenic
964151609 3:153532098-153532120 AGCTGCAAACTGTACTGCCTAGG - Intergenic
964253643 3:154749808-154749830 AGCTGGGAGCTGTGCTGCCTGGG - Intergenic
964686714 3:159403835-159403857 AGCTGCAAGCTGTGCTGCCTAGG - Intronic
964965117 3:162482354-162482376 AGCTGGGAGCTGCACTGCTGGGG + Intergenic
965014628 3:163140784-163140806 AACTGTGAGCTTCACTGCCTGGG + Intergenic
965099509 3:164278175-164278197 AGCTGTGAGCTGTGCTGCCTGGG - Intergenic
965415241 3:168384773-168384795 AGCTTCCAGCTGCACTGCCTGGG + Intergenic
965867081 3:173217237-173217259 AGCTGTGAGCTGTGCTGCCTGGG + Intergenic
966328964 3:178789963-178789985 AGCTGCAAGCTGCACTGCCTGGG - Intronic
967677417 3:192316801-192316823 AGCTGCTAGCTGCACTGCCTGGG - Intronic
967697033 3:192543953-192543975 AGCTGCAAGCTACACTGCCTGGG + Intronic
968005066 3:195237029-195237051 AGCTGTGAGCTGCGCTGCCTGGG + Intronic
969762634 4:9200387-9200409 AGCTGCAAGCTGTGCTGCCTGGG - Intergenic
971095719 4:23399779-23399801 AGCTGTGACCTGCACTGCATGGG + Intergenic
972253739 4:37332241-37332263 AGCCGTGAGCTGCACTGCCTGGG - Intronic
974266949 4:59598067-59598089 AGCTGCGAGTTGAGCTGCCTGGG - Intergenic
974559219 4:63495244-63495266 AGCTGTGAGCTACACTGCCTTGG - Intergenic
976041025 4:80885428-80885450 TGCTGTGAGCTGCACTGCCCAGG - Intronic
976171775 4:82311644-82311666 AGGTGCAAGCTGCACTGCCTGGG + Intergenic
977074278 4:92433188-92433210 AGCTGCAAGCTGTACTGCATGGG + Intronic
977341501 4:95764127-95764149 AGCTGTGAGCTGTGCTGCCTTGG - Intergenic
977964970 4:103134804-103134826 AGCTGGTATCTGCCCTACCTGGG - Intronic
978654309 4:111048570-111048592 AGCTGTGAGCTGCACTTCCCAGG - Intergenic
979213345 4:118133002-118133024 TGCTGTGAGTTGCACTTCCTGGG + Intronic
979504509 4:121480197-121480219 TGCTGCAAGCTGCGCTGCCTGGG + Intergenic
979565133 4:122146101-122146123 AGCTGCAAGCTGCACTGCCTGGG + Intergenic
980937003 4:139235113-139235135 TGCTGGGATCTGCACTGCCTCGG + Intergenic
981140177 4:141259042-141259064 AGCTGTGAGCTGTGCTGCCTGGG - Intergenic
981530863 4:145752588-145752610 AGCTGTAAGCTGTACTGCCTGGG + Intronic
982683436 4:158459580-158459602 TGCTGTGAGCTGCACTACCTGGG + Intronic
982719691 4:158847308-158847330 AGCTACGAACTACACTGCCTGGG - Intronic
982911506 4:161148422-161148444 AGGTGTGAGCTGCACTGCCTGGG - Intergenic
982932628 4:161428426-161428448 AGCTGCAAGCTGCACTACCTGGG - Intronic
983493064 4:168411799-168411821 AGCTGCGAGCTGCACTGCTTAGG - Intronic
984037458 4:174687447-174687469 AGTTGCAAGCTGAACTAGCTTGG + Intronic
984529825 4:180902387-180902409 TGCTGCGAGCTGCACTGCCTGGG + Intergenic
985444493 4:190014784-190014806 AGCTCCGAGCTCCACCACATCGG - Intergenic
986885304 5:12226483-12226505 AGCGGCGAGCTGTGCTGCCTTGG + Intergenic
987616055 5:20276243-20276265 AGCTGTGAGCTGCGCTCCCTGGG - Intronic
988064637 5:26218696-26218718 CGCTGTGAGCTGCACAGCCTGGG - Intergenic
988265371 5:28942303-28942325 AGTTGTGAGCTGCACTACCTGGG + Intergenic
988608582 5:32703794-32703816 AGCTGCAAGCTGCACTGCCTGGG + Intronic
989609866 5:43280540-43280562 AGCTGCGAGCATCTCTCCCTTGG - Exonic
990202921 5:53397955-53397977 AGCTGCAAGCTGTATTGCCTGGG + Intergenic
990827869 5:59922409-59922431 AGCTGCAAGCTGCTCTGCCTAGG - Intronic
990922067 5:60978866-60978888 AATTGCGAGCTGCACTCCCTAGG - Intronic
990982164 5:61611769-61611791 ACCTGCTAGCTGCATGACCTTGG - Intergenic
991395359 5:66198951-66198973 AGCTGTGAGCTGCACTGCCTGGG + Intergenic
991412567 5:66359345-66359367 GTCTGCTAGCTGCACCACCTTGG + Intergenic
992657176 5:78922252-78922274 GGCTGCGAGCTGCACTCCCTTGG - Intronic
993060223 5:83029846-83029868 AGCTGTGAGCTGTGCTACCTGGG - Intergenic
993267492 5:85744660-85744682 TGCTGTGAGCTGCAGTACCTGGG + Intergenic
993287412 5:86016769-86016791 TGCTCTGAGCTGCACTGCCTGGG + Intergenic
993981207 5:94545415-94545437 AGCTGTGAGCTGTGCTGCCTGGG - Intronic
994908594 5:105872481-105872503 AGGTGCCAGCTGGACTTCCTGGG + Intergenic
995049633 5:107687863-107687885 AGCTGCAAGCTGCACTGCCTGGG - Intergenic
995096316 5:108239767-108239789 AGCTGCAAGCTGTGCTGCCTAGG - Intronic
995268694 5:110195365-110195387 AGCTGCAAGCTGCACTGCCTGGG + Intergenic
995310742 5:110707718-110707740 TGCTGCAAGCTGCACTGCCTGGG - Intronic
995697858 5:114900020-114900042 AGCTGTGAGGTGTACTACCTAGG + Intergenic
995770554 5:115664919-115664941 AGCTGCAAGCTGTGCAACCTGGG - Intergenic
996518411 5:124399303-124399325 AGCTGGGGGCTGGACTACCTAGG + Intergenic
997588621 5:135059456-135059478 ATCTGAGAGCTGCACTTTCTGGG - Intronic
998291253 5:140916727-140916749 TGCTGCAAGCTTCACTGCCTGGG + Intronic
998416227 5:141948154-141948176 ATCCACGAGCTGCACAACCTTGG + Intronic
999667366 5:153927121-153927143 AGCTGCAAGCTGTGCTGCCTGGG - Intergenic
1000433468 5:161179674-161179696 AGCTGTGAGCTGCACTGTGTGGG - Intergenic
1001029088 5:168248488-168248510 TGCTGCCAACTGCACTGCCTGGG - Intronic
1005279953 6:24262565-24262587 AGCTGCGAGCTGTACTGCTTGGG - Intronic
1006018700 6:31103806-31103828 TGCTAGGAGCTGCACTGCCTGGG + Intergenic
1006559807 6:34901115-34901137 AACTGCCAGATGCACTACCAGGG + Intronic
1007021806 6:38528483-38528505 AGCTGCGAGCTGTGCTGCTTGGG - Intronic
1008642080 6:53474472-53474494 AGCTGTGAGCTGCTCTGCCCGGG + Intergenic
1009039412 6:58158738-58158760 AGCTGTGAGCTGTGCTACCTGGG + Intergenic
1009215306 6:60913581-60913603 AGCTGTGAGCTGTGCTACCTGGG + Intergenic
1009371106 6:62904939-62904961 TGCTGCTAGCCGCACTGCCTGGG - Intergenic
1009373585 6:62939011-62939033 AGCTGAAAGCTGTGCTACCTGGG + Intergenic
1009763753 6:68040904-68040926 AGGTGCCAGCTGGACTTCCTGGG - Intergenic
1009847402 6:69151046-69151068 AGCTGCAAGCTACACTGCCTAGG + Intronic
1009978689 6:70701075-70701097 AGCTGTGAGCTGTGCCACCTGGG + Intronic
1010514119 6:76752908-76752930 AACTGCAAACTGCACTGCCTGGG - Intergenic
1011271020 6:85580045-85580067 ACCTGCAAGCTGCACTGCCTGGG - Intronic
1011340934 6:86313571-86313593 AGCTGTGAGCTGCACTGTCTAGG - Intergenic
1011598329 6:89037461-89037483 AGCTGTGAGCTGCACTGCCTGGG - Intergenic
1011791906 6:90907658-90907680 TGCTGCAAGCTGCACTGCCTGGG + Intergenic
1012827278 6:104162537-104162559 AGCTGCAAGATGCGCTGCCTGGG - Intergenic
1013567573 6:111382809-111382831 AGCTGCGAGTTGTGCTGCCTGGG - Intronic
1014840855 6:126218664-126218686 AACTGCCAGCTGCGCTCCCTGGG + Intergenic
1015052876 6:128863283-128863305 TGCTGCAAGCTGCACTGTCTGGG + Intergenic
1015578875 6:134702107-134702129 AGCTGCAAGCTGTGCTGCCTGGG + Intergenic
1016061651 6:139636861-139636883 TGCTGTGAGCTACACTGCCTGGG + Intergenic
1016194562 6:141317890-141317912 AGCTGCCAGTTGCACTGCCTGGG - Intergenic
1016229736 6:141788627-141788649 AACTGTGAGCTGCGCTGCCTGGG - Intergenic
1017243499 6:152196717-152196739 AGCTGCAAGCTGTATTGCCTGGG + Intronic
1019576862 7:1741771-1741793 GGCTCCGAGCTGCACTACCGAGG + Intronic
1020038439 7:4981508-4981530 AGCTACAAGCTCCACTTCCTGGG - Intergenic
1021214674 7:17901259-17901281 ACCTGCAAGCTGCACTACTTGGG + Intronic
1021923033 7:25506053-25506075 AGCTGTGAGCTTCACTGCCTGGG - Intergenic
1022223651 7:28340572-28340594 AGCTGTGAGCTGCACTGCCTGGG + Intronic
1023646212 7:42318618-42318640 AGGTGTGAGCTGCACCGCCTGGG - Intergenic
1023716199 7:43046669-43046691 AGCTGCAAGCTGTGCTACCTGGG - Intergenic
1027604823 7:80287673-80287695 AGCTGCAAGCTGGGCTGCCTGGG - Intergenic
1028284668 7:88981439-88981461 AGCTGTGAGCTACACTGCCTGGG + Intronic
1028299603 7:89181132-89181154 AACTGTGAGCTGCACTATCTAGG + Intronic
1028929605 7:96398066-96398088 AGCTGCAAGCTGCACTACCTGGG + Intergenic
1028942195 7:96534058-96534080 AGTTGAGAGCTGAACTAGCTGGG + Intronic
1028972514 7:96875156-96875178 AGGTGTGAGCTGCACTTCCTGGG - Intergenic
1029042559 7:97593029-97593051 TGCTGTGAGCTGCATTGCCTGGG + Intergenic
1030370546 7:108694581-108694603 AGCTGCAAGCTGTGCCACCTGGG + Intergenic
1030629388 7:111879035-111879057 TGCTGCAAGCTGCACTGCCTGGG - Intronic
1031353537 7:120763521-120763543 AGCTGCAAGCTGCATTTCCTGGG + Intergenic
1031905690 7:127457841-127457863 AGCTGTGAGCTGCACTGCCTGGG - Intergenic
1032138846 7:129308031-129308053 AGCTTCAAGCTGCACTGCCTTGG + Intronic
1034126345 7:148675181-148675203 AGCTGTGAGTTGCGCTGCCTGGG - Intergenic
1034581856 7:152050563-152050585 AGCTGCGAGCTGCACTGCCTGGG + Intronic
1034847865 7:154463896-154463918 AGCTGCAAGCTGTGCTGCCTTGG + Intronic
1035346872 7:158206134-158206156 AGCTGTGAGCTGTGCTGCCTAGG - Intronic
1035754126 8:2018323-2018345 AGCTGTGAGCTGTGCTGCCTGGG + Intergenic
1036145503 8:6251204-6251226 AGTTGTGAGCTGCACTCCATGGG - Intergenic
1036272724 8:7322124-7322146 AGCTGCAAGCTGTGCTGCCTGGG - Intergenic
1036348624 8:7988224-7988246 AGCTGCAAGCTGTGCTGCCTGGG + Intergenic
1036814874 8:11894662-11894684 AGCTGTGAGCTGTGCTGCCTGGG + Intergenic
1036843894 8:12148693-12148715 AGCTGCAAGCTGTGCTGCCTGGG + Intergenic
1036865264 8:12391013-12391035 AGCTGCAAGCTGTGCTGCCTGGG + Intergenic
1040745475 8:50636222-50636244 AGCTGTGAGCTGTGCTGCCTGGG + Intronic
1042863813 8:73339236-73339258 AGCTGCAAGCTCCACCTCCTGGG - Intergenic
1042980164 8:74518160-74518182 AGCTACTAGCTGCACTTCCTGGG + Intergenic
1042980201 8:74518389-74518411 ACCTGTGAGCTGCACTTCCTGGG - Intergenic
1043016016 8:74941184-74941206 AGCTGTGAGATGCACTTCCTTGG + Intergenic
1045621167 8:103980139-103980161 TGCTGTGAGTTGCACTGCCTGGG - Intronic
1046557240 8:115790297-115790319 AGCTGCAAGCTGTGCTGCCTGGG - Intronic
1047138427 8:122107516-122107538 AGCTGTGAGTTGCACTGCCTGGG + Intergenic
1050618678 9:7429829-7429851 AGCTGTGAGCTGTGCTGCCTGGG + Intergenic
1050768785 9:9170492-9170514 AGCTGCGAGTGTTACTACCTTGG + Intronic
1051039170 9:12785298-12785320 AACTGCGAGCTGCACTGTCTGGG + Intronic
1052204975 9:25828153-25828175 TGCTGCAAGCTGTACTGCCTGGG + Intergenic
1052450547 9:28624917-28624939 TGCTGCCAGCTGCATTGCCTGGG + Intronic
1052476784 9:28970939-28970961 AGCTGCAAGCTGCACAACCTGGG - Intergenic
1052573813 9:30265170-30265192 GTCCGTGAGCTGCACTACCTGGG + Intergenic
1056799127 9:89679199-89679221 AGCTGCGAGCAGCACACACTTGG + Intergenic
1057644384 9:96859333-96859355 AGCTGCGAGCTGCACTGTCTAGG - Intronic
1058522871 9:105829081-105829103 AGCTGCAAGGTGCACTGCCTGGG + Intergenic
1058820825 9:108728037-108728059 AGCTGTGAGGTACACTATCTGGG - Intergenic
1060084184 9:120681470-120681492 TGCTGCGAGATGCACTGCCTGGG + Intronic
1060304429 9:122398090-122398112 AGCTGTGAGTTGCACTGCCTAGG - Intergenic
1061628284 9:131855413-131855435 AGCTGCCAAGTGCTCTACCTGGG + Intergenic
1185592318 X:1285617-1285639 AGCTGCAAGCTCCACCACCCGGG - Intronic
1186602198 X:11049966-11049988 ATTTGCAAGCTGCACTGCCTGGG + Intergenic
1187836166 X:23434589-23434611 AGCTGTGAGCTGTGCTGCCTGGG - Intergenic
1188207516 X:27378748-27378770 AGCTGCAATCTGCATTCCCTAGG - Intergenic
1188425055 X:30036806-30036828 AGCTGTGAGCTGCGCTGCCTGGG + Intergenic
1188651368 X:32634781-32634803 AGCTGTGAGCTGTGCTGCCTGGG + Intronic
1188743023 X:33809487-33809509 AGCTGTGAGCTGTGCTTCCTGGG + Intergenic
1189013511 X:37071331-37071353 TGCTGCAAGCTGTACTGCCTGGG + Intergenic
1189593787 X:42543166-42543188 AGCTGTGAGCTGTGCTGCCTAGG - Intergenic
1189628108 X:42921101-42921123 AGCTGTGAGCCGCACTGCCTGGG - Intergenic
1190374410 X:49775081-49775103 TGCTGTGAGCTGCACTTCCTGGG + Intergenic
1190614518 X:52216998-52217020 AGCTGCAAGCTGTGCAACCTGGG - Intergenic
1190886028 X:54531403-54531425 AGATCTGAGCTCCACTACCTTGG - Intronic
1191834176 X:65446285-65446307 AGCTGCAAGCTGAACTGCCTGGG + Intronic
1191946980 X:66545003-66545025 TGCTGCAAGCTGTACTGCCTGGG + Intergenic
1192046064 X:67675236-67675258 AGTTGGGAGCTGCATTGCCTGGG + Intronic
1192374808 X:70548967-70548989 AGCTGCAAACTGCACTGCCTGGG - Intronic
1192941138 X:75912794-75912816 AGCTGTGAGCTGTGCTGCCTGGG + Intergenic
1193004985 X:76606381-76606403 TGCTGCAAGATGCACTGCCTGGG - Intergenic
1193092503 X:77509989-77510011 AGCTGTGAGCTGTGCTGCCTGGG - Intronic
1193280398 X:79641860-79641882 AGTCGTGAGCTGCACTGCCTGGG + Intergenic
1193293850 X:79810067-79810089 AGCTGTGAGCTGTTCTGCCTGGG + Intergenic
1193463552 X:81818536-81818558 AGCTGCAAGCTGTGCTGCCTGGG + Intergenic
1193580454 X:83257777-83257799 TGTGGTGAGCTGCACTACCTGGG - Intergenic
1193676026 X:84453779-84453801 AGCTGCAATCTGTACTATCTAGG - Intronic
1193856651 X:86611353-86611375 AGCTGCAAGCTGTGCCACCTGGG + Intronic
1193896962 X:87126718-87126740 ACCTGCAAGCTGCACTTTCTGGG - Intergenic
1194327741 X:92540983-92541005 TGTTGCGAGCTGCACTGACTTGG + Intronic
1194329171 X:92560011-92560033 TGTTGCGAGCTGCACTGTCTGGG - Intronic
1194388981 X:93292828-93292850 TGCTGTGAGCTGCACTGCCTGGG - Intergenic
1194398146 X:93411821-93411843 AGCTGTAAGCTGCACTGCCTGGG - Intergenic
1194415426 X:93606107-93606129 TGTTGCGAGCTGTACTTCCTGGG - Intergenic
1194479417 X:94401541-94401563 TGCTGTGACCTGCACTACCTGGG + Intergenic
1194692986 X:97009874-97009896 AGCTGTGGGCTGCACTGCCTGGG + Intronic
1194795811 X:98210309-98210331 TGCTGTAAGCTGCACTGCCTGGG - Intergenic
1194882735 X:99273876-99273898 TGCTGCAAGCTGTACTGCCTGGG - Intergenic
1195199292 X:102532498-102532520 TGCTGCAAGCTGTACTACCTGGG - Intergenic
1195290104 X:103424124-103424146 AGCTGAGAGCTACACTGCCTGGG + Intergenic
1195917163 X:109947449-109947471 AGCTGTGAACTGCACTGCCTGGG - Intergenic
1196182188 X:112704289-112704311 TGCTTCAAGCTGCACTGCCTGGG + Intergenic
1196234545 X:113262961-113262983 AGCTGTGAGCTGGGCTGCCTGGG + Intergenic
1196385018 X:115140060-115140082 TGCTGCGAGCTGCACTGTCTGGG - Intronic
1196660469 X:118264002-118264024 AGCTGCGGGCTGTGCAACCTGGG - Intergenic
1196984603 X:121254239-121254261 AGCTGTGAGCTGTACAGCCTGGG + Intergenic
1197011533 X:121570310-121570332 AGCTTCAAACTGCACTGCCTGGG - Intergenic
1197024926 X:121737520-121737542 AGCTGCGGTCTTCACTGCCTGGG - Intergenic
1197099622 X:122637047-122637069 AGCTGCAAGCTGCACTGCTCAGG + Intergenic
1197439271 X:126470634-126470656 AGCTGTGAGCTGTGCTGCCTGGG - Intergenic
1197468534 X:126837555-126837577 TGCTGTGAGTTGCACTGCCTGGG - Intergenic
1197487795 X:127075096-127075118 AGCTGTGAGCTGCACTGCCTGGG + Intergenic
1197670652 X:129273434-129273456 AGCTGGGAGCTGCACTGCCTGGG + Intergenic
1198292954 X:135256697-135256719 TGCTATGAGCTGCACTACCAGGG - Intronic
1198761831 X:140040565-140040587 TGCTGCAAGCTGCACTGCCCGGG + Intergenic
1199036983 X:143063482-143063504 TGTTGTGAGCTGCACTGCCTGGG - Intergenic
1199223101 X:145340069-145340091 AGCTGTGAGCTGTGCTTCCTGGG - Intergenic
1199325147 X:146490303-146490325 TACTGTGAGCTGCACTGCCTGGG - Intergenic
1199568850 X:149246894-149246916 AGCTGTGAACTGAACTGCCTGGG + Intergenic
1200636456 Y:5660201-5660223 TGTTGCGAGCTGCACTGACTTGG + Intronic
1200637872 Y:5679200-5679222 TGTTGCGAGCTGCACTGTCTGGG - Intronic
1201850460 Y:18474164-18474186 AACTGCAACCTGCACTTCCTCGG - Intergenic
1201882858 Y:18846213-18846235 AACTGCAACCTGCACTTCCTCGG + Intergenic
1202191003 Y:22244284-22244306 CACTGCAAGCTGCACTTCCTGGG - Intergenic