ID: 1165646270

View in Genome Browser
Species Human (GRCh38)
Location 19:37440808-37440830
Sequence TTCACTTCTCCAGAAATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165646270_1165646273 8 Left 1165646270 19:37440808-37440830 CCCTACATTTCTGGAGAAGTGAA 0: 1
1: 0
2: 2
3: 16
4: 290
Right 1165646273 19:37440839-37440861 TTGTAGATGAAGACTTAATATGG 0: 1
1: 0
2: 1
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165646270 Original CRISPR TTCACTTCTCCAGAAATGTA GGG (reversed) Intronic
902843553 1:19091693-19091715 TACATTTCACCGGAAATGTATGG - Intronic
903308917 1:22437138-22437160 GTCACTTCTCTACAAATCTAAGG - Intergenic
907955432 1:59223583-59223605 TGAACTTCTCCAGAACTGAAAGG - Intergenic
908564730 1:65342514-65342536 TTCTCGTCTCCAGAACTGTGAGG + Intronic
909516677 1:76516139-76516161 TGCCTTTCTCCAGTAATGTAGGG + Intronic
909855835 1:80530046-80530068 TACATTTATCCAGCAATGTAAGG - Intergenic
910795922 1:91097417-91097439 ATCAATTCCCCATAAATGTAAGG + Intergenic
911863320 1:102983638-102983660 TTCTGTCCTCCAGAACTGTAAGG + Intronic
912485265 1:110022085-110022107 TTCACTTCTTCAGAGAAGCAGGG + Exonic
913229955 1:116733574-116733596 TTCACTTTTCCTGAAATATGGGG - Intergenic
914429821 1:147611260-147611282 TTCAAAACTACAGAAATGTAAGG + Intronic
914873983 1:151498855-151498877 TTCACTTCTCCAGACATAATTGG + Intergenic
915179918 1:154049261-154049283 ATCTCTTCTCCATAAATTTAAGG - Intronic
916388610 1:164305457-164305479 TTCCCTTCTCAATAATTGTAAGG - Intergenic
916745147 1:167679552-167679574 TTCACTCCTCCAGAACTGAAGGG - Intronic
917063370 1:171065294-171065316 GTCACTTCTCTAGTATTGTATGG + Intergenic
917858357 1:179120865-179120887 TTTACTTCTCCAGATATCTCAGG + Intronic
919265025 1:195251914-195251936 ATCACTTCACAAGAAATGGAGGG + Intergenic
920392868 1:205621318-205621340 TTAACTTCTCCATAATAGTAGGG - Intronic
920839558 1:209542756-209542778 TTATCTTCTCCAGAAATAAAGGG + Intergenic
920986480 1:210895313-210895335 TTCACATCTTCACACATGTATGG + Intronic
921456673 1:215380115-215380137 TTCTCTTCTCCTCAAATGGAAGG - Intergenic
924919041 1:248606686-248606708 TCCACCTCTCCAGAAATCTTTGG - Intergenic
1063228882 10:4044073-4044095 TTCATTGCTCCAGAAAGATAAGG - Intergenic
1063675387 10:8136875-8136897 TTCATTTCTACAGATATGTTAGG - Intergenic
1063917732 10:10901369-10901391 ATCAGTTTTCCAGATATGTAAGG - Intergenic
1064368308 10:14728050-14728072 TTCCTTACTCCATAAATGTATGG - Intronic
1064861713 10:19833956-19833978 TTTTTTTCTCCAGAACTGTATGG + Intronic
1066167427 10:32802303-32802325 TTCACTGCTCAAGAGATGCAAGG - Intronic
1067410836 10:46063191-46063213 TTCACTTCTCCCGAATTTTGTGG - Intergenic
1067423844 10:46185804-46185826 TTCACTCCTTCAAAAATGTCTGG - Intergenic
1068445849 10:57122030-57122052 ATTACTTTTCCAGAACTGTAGGG - Intergenic
1068566210 10:58578635-58578657 ATCACTTCTTCCCAAATGTATGG + Intronic
1070860248 10:79651046-79651068 TTCACTCCTTCAAAAATGTCTGG - Intergenic
1072187675 10:93057019-93057041 CTCACTTCTCCAAAAGAGTAAGG - Exonic
1074143273 10:110695616-110695638 TTCATTTCATCAGAAATGTTTGG + Intronic
1074444422 10:113507603-113507625 ATCAATTCACCAGAGATGTATGG + Intergenic
1075934214 10:126325800-126325822 AACACTACTACAGAAATGTAAGG - Intronic
1075981147 10:126740962-126740984 GTCAGTGCTCCAGAGATGTAGGG + Intergenic
1078216993 11:9319961-9319983 TCCACTTCACCAGGAATGTCAGG - Intergenic
1079390712 11:20019644-20019666 TTCACCTCTCCAGAACTCCAGGG - Intronic
1080584432 11:33668265-33668287 TTCACCTTTTCAGAAATGGAGGG - Exonic
1080793311 11:35540282-35540304 ATCACTTCTCTAAAACTGTATGG - Intergenic
1081228600 11:40556436-40556458 TTCACTGGTCCAAAAATGTCTGG + Intronic
1085031348 11:73272721-73272743 TCCACTTCTCCAGCAAGGCACGG - Intronic
1085225629 11:74918396-74918418 TTCTCTTCTAAAGAAATTTATGG - Intronic
1088850001 11:113696636-113696658 TGCCCTTCACAAGAAATGTAGGG - Intronic
1089295467 11:117464760-117464782 TTAGCTCCTCCAGAGATGTATGG - Intronic
1090059634 11:123452878-123452900 TTCATTTCTCCAGGAAAGAAGGG + Intergenic
1090124822 11:124074967-124074989 TTCTCTTCACCTGCAATGTAGGG + Intergenic
1091464030 12:668322-668344 TTCACTTCTCCAGGAATCCCAGG + Intergenic
1091848537 12:3676962-3676984 GTCCCTTCTCCAGAAATCTGGGG - Intronic
1093811978 12:23502581-23502603 TACTCTTCTCCAGGAACGTAGGG + Intergenic
1095298822 12:40558569-40558591 TTCCCATCATCAGAAATGTATGG - Intronic
1096626244 12:52897758-52897780 TTCACTACTCCAGAACTGTCAGG + Intronic
1097916080 12:65021626-65021648 CTAAATTCTCCAGAAATGGAAGG + Intergenic
1098224884 12:68311216-68311238 TGCCCTTCTCCAGTAATGTTTGG - Intronic
1099393872 12:82114832-82114854 TTCATTTCACCAGCAATGTTGGG - Intergenic
1100682231 12:96938612-96938634 CTCACTTTGCCAGAAATGTTGGG - Intronic
1101129255 12:101671954-101671976 TTCCCTTCTCAAGCAAGGTAAGG - Intronic
1103630697 12:122257908-122257930 ATCAATTGTCCACAAATGTAAGG - Intronic
1106083293 13:26518366-26518388 TTCTCTTCTCCAGGATTGGAAGG + Intergenic
1106808631 13:33336870-33336892 TTCAATTGTCCAGAAATATCAGG + Intronic
1109068558 13:57733854-57733876 TTCAATTCAACAGAAATTTATGG + Intergenic
1109969430 13:69747027-69747049 TAAATTTCTCCAGAAATGCATGG + Intronic
1110257459 13:73447302-73447324 TTCACTTCTACAGACAACTACGG - Intergenic
1110552825 13:76827709-76827731 TTAACTTTTCCTGAAATATATGG - Intergenic
1110658985 13:78035943-78035965 TTCACTTTTCCCGAGATTTAAGG + Intergenic
1111735280 13:92130774-92130796 TCCACTTCTCCAACAATATAAGG - Intronic
1112611855 13:100962881-100962903 TTCACTTCTGCAGAGATTTCTGG + Intergenic
1112973221 13:105286030-105286052 TTCACTTCTCCATAGATTTTGGG - Intergenic
1113283989 13:108826265-108826287 ATCAGTTAACCAGAAATGTAAGG - Intronic
1113318327 13:109207569-109207591 TCCACTTATCCAGAAATACAGGG - Exonic
1114296539 14:21334391-21334413 TTCACTTCTCAAAAAAAGAAAGG - Intronic
1115782761 14:36788073-36788095 TTTATTTCTCAAGAAATGGAAGG + Intronic
1116482067 14:45403346-45403368 TTCAAGCCTCCAGAACTGTAAGG - Intergenic
1117357833 14:54943101-54943123 TTCACTTCCCCAGGAATGGCAGG - Intronic
1117411201 14:55452870-55452892 TGCCCTTTTCCAGAACTGTAAGG + Intronic
1117931395 14:60844798-60844820 TTCAGTACTCTAGAAATGGAAGG - Intronic
1118382052 14:65225423-65225445 TTCACTTCTCCAGTGAAGTCTGG + Intergenic
1118898845 14:69969915-69969937 CTCTTTTCTCCAGAAATGTGAGG - Intronic
1119045240 14:71313129-71313151 TTCTGACCTCCAGAAATGTAAGG - Intergenic
1120144995 14:80969680-80969702 TTCATTTCTCCAAAACTGGATGG + Intronic
1202936121 14_KI270725v1_random:89188-89210 TTCTGACCTCCAGAAATGTAAGG + Intergenic
1123674628 15:22697980-22698002 TCCACTTCTCCAACAATGTAAGG - Intergenic
1123905177 15:24913884-24913906 TTCACTTCTCTAAAAATGTACGG - Intronic
1124326642 15:28770961-28770983 TCCACTTCTCCAACAATGTAAGG - Intergenic
1128899324 15:71405488-71405510 ATCAATTGTCCATAAATGTAAGG + Intronic
1129272692 15:74427845-74427867 CTCACCTCTCCAGGAATGTGGGG + Intronic
1130913667 15:88288763-88288785 TGGACTTCTCCAGAGAGGTAAGG - Intergenic
1132411385 15:101580496-101580518 TACACTTCTCCCGCAATTTACGG - Intergenic
1135823329 16:25704179-25704201 TACACTTCCCAAGAAATGTGAGG - Intronic
1137353589 16:47735993-47736015 TTCACTACTTCAGAAATCAAAGG - Intergenic
1138429651 16:56960688-56960710 TCTATTTCTCCAGAAATGTGAGG - Intergenic
1140085726 16:71794711-71794733 TTCAATTCTCCTAAAATTTATGG + Intronic
1142513395 17:411748-411770 TCCCCTTGTCAAGAAATGTAGGG - Intronic
1142868190 17:2804008-2804030 ATCAATTCACCAGAAATGCAAGG - Intronic
1143849415 17:9798723-9798745 TTCTCTTTCCCAGAAATGAAAGG + Intronic
1147337264 17:39734916-39734938 ATCAATTGACCAGAAATGTAAGG + Intergenic
1149419754 17:56498125-56498147 TGGACTACTCTAGAAATGTAAGG + Intronic
1151094860 17:71485431-71485453 TTCAGTTCTCCAGGAATTTGGGG - Intergenic
1154494830 18:14947970-14947992 TTCCCTTCTCCTGCAATGTGTGG + Intergenic
1155644745 18:28064067-28064089 TTTATTTCTCCAGACATGTCTGG + Intronic
1156834856 18:41540314-41540336 GTTACATTTCCAGAAATGTATGG - Intergenic
1157031995 18:43922324-43922346 GTCACTTCACCAAAAATATATGG + Intergenic
1157332725 18:46715185-46715207 TTCTCTTCTGCAGAAAAGGAGGG - Intronic
1158089248 18:53691389-53691411 TTCACATCTACAAAAATGTCTGG + Intergenic
1159329542 18:66972745-66972767 TTCACTTCTCAAGTAAAGCATGG + Intergenic
1162651995 19:12095727-12095749 TTCACTTCTGAAGTAATGCAAGG - Intronic
1164744461 19:30600896-30600918 TTCACTTTTCCAGGAATCAACGG - Intronic
1165646270 19:37440808-37440830 TTCACTTCTCCAGAAATGTAGGG - Intronic
1166970763 19:46565743-46565765 TTCACTACTACAGAACAGTACGG - Intronic
1167268459 19:48494686-48494708 TTCACTTATGCAGTAATGGAGGG - Intronic
927512224 2:23651035-23651057 CTCACTATTCTAGAAATGTAAGG + Intronic
927759279 2:25737411-25737433 TTCACTTTTCCAGTAATGTTAGG + Intronic
929498031 2:42463773-42463795 TTCATTTCTCCATAACTGTCAGG + Intronic
932345676 2:70993915-70993937 TTTACTTCTCCAGACTTGGAAGG - Intronic
932723305 2:74155667-74155689 TTCTCTTATCCAGAATTTTAAGG + Exonic
933621243 2:84544389-84544411 TTCACTGTTCCGGAAATGGAAGG + Exonic
939257272 2:139760005-139760027 TTCTCTTCTCCTCAAATGGAAGG + Intergenic
939262460 2:139828328-139828350 GTGACTTCTCTAAAAATGTATGG + Intergenic
940778473 2:157908365-157908387 TTCACTTCTACTGCTATGTAGGG - Intronic
941745138 2:169079222-169079244 TTCACTTCTCAAGAAAATTTCGG - Intronic
942717684 2:178912809-178912831 TTCAATTCGCCAGGAATGTAGGG - Intronic
943010392 2:182441176-182441198 TTCACTACCCAAGAACTGTATGG + Intronic
943616580 2:190099751-190099773 TTTACTTATCAAGAAAAGTATGG - Intronic
943692598 2:190883142-190883164 TTCACTTGTCCAGAAGTTTCTGG + Intronic
943813003 2:192212834-192212856 TTCATGTTTCCTGAAATGTATGG + Intergenic
943983471 2:194588772-194588794 TTTTCTTCAACAGAAATGTAGGG + Intergenic
945041924 2:205749632-205749654 TTCCCTTCTCTAGAGATGTTTGG + Intronic
945787937 2:214267339-214267361 ATCAATTCACCATAAATGTATGG - Intronic
946222118 2:218236878-218236900 ATAACTTCACCAGAACTGTATGG - Intronic
1169720892 20:8675187-8675209 TTCACTCCTTTAGAAACGTAGGG + Intronic
1169889385 20:10435773-10435795 CTCACATCTCCAAAAATGTCTGG - Intronic
1170199573 20:13728386-13728408 TTAACTTCTTCAGCAAAGTATGG + Exonic
1170227714 20:14010485-14010507 TTCATTTCTCTAAAAATGTATGG + Intronic
1170257497 20:14361481-14361503 TTTAATTCTGCAAAAATGTATGG - Intronic
1170544306 20:17421260-17421282 CTCACTTCTCCAGAAAGCAATGG + Intronic
1171389961 20:24795003-24795025 TTCACTTCTCCTGCACTTTATGG + Intergenic
1174107722 20:48174698-48174720 ATCGCATCTCCAGAAATGAAAGG - Intergenic
1174812199 20:53655730-53655752 TTAACATCTCCAGAAATATCTGG + Intergenic
1175339242 20:58217518-58217540 TTGACTCCTGCAGAAATGAAAGG - Intergenic
1175735100 20:61380128-61380150 TTCACTTCATCAGACATTTAGGG + Intronic
1176779890 21:13181677-13181699 TTCATTTATTCAGAAAGGTATGG + Intergenic
1177708792 21:24743425-24743447 TTGACTTTTCCTGGAATGTAAGG + Intergenic
1177776761 21:25576605-25576627 CCCACTTCCCCAGAAATTTACGG + Intergenic
1180280470 22:10688868-10688890 TTCTGACCTCCAGAAATGTAAGG + Intergenic
1184548001 22:45185769-45185791 GTCACTTCTCCAGAGGTGTCAGG + Exonic
949514987 3:4799528-4799550 TTCACTTCTTCAGAGATGCTTGG - Intronic
950982531 3:17323794-17323816 TTCATTTTTCCAGAAATCAAGGG - Intronic
953236987 3:41115562-41115584 TTCCCTGCTCCCCAAATGTAGGG + Intergenic
954053675 3:48004346-48004368 TTCACTGCTCATGAAAGGTAAGG + Intronic
954088983 3:48269977-48269999 TTCACATCTAAAGGAATGTAAGG - Exonic
955196651 3:56810688-56810710 GTCATTTCTCTATAAATGTATGG - Intronic
955254414 3:57315542-57315564 TTCAGTTTTCCAGAATTTTAAGG - Intronic
955968111 3:64409732-64409754 TTCAAATCTCCAGAGCTGTAAGG - Intronic
957427634 3:80060308-80060330 TTTACTTCTCAAAAAATGTCGGG + Intergenic
957627573 3:82673181-82673203 TTCACATTCTCAGAAATGTAGGG + Intergenic
957687645 3:83523439-83523461 TTTACTTCTCCTGAAAGGAACGG - Intergenic
957783637 3:84850753-84850775 TTCCAGTCTCCAGAAATGTAAGG + Intergenic
957897283 3:86439113-86439135 TTAATTTCTCCAGAATAGTAAGG + Intergenic
958612037 3:96437841-96437863 TTCACTACCCCAGAACAGTATGG + Intergenic
959644769 3:108686031-108686053 TTCATTTCTCTATAGATGTAAGG + Intronic
959787826 3:110321806-110321828 TTCTGATCTCCAGAACTGTAAGG - Intergenic
963002389 3:140694658-140694680 TGGACTTCTTCAGAATTGTAAGG - Intronic
963007558 3:140740400-140740422 TTGACTTTTCCAGAGATGTCTGG - Intergenic
963163139 3:142173351-142173373 TTTGTATCTCCAGAAATGTAAGG + Intronic
965293333 3:166912117-166912139 TCCCATTCTCCAGAATTGTAAGG - Intergenic
967343960 3:188432813-188432835 TTTACTTTTCCTGAAATGTGTGG + Intronic
969942073 4:10742695-10742717 TTTATTCCTCCAGAAATGTAGGG - Intergenic
969968138 4:11017881-11017903 TTCTATTCTCCAGAACTGTGAGG + Intergenic
975222900 4:71833713-71833735 AGGACTTCTCCAGAAATGTCAGG - Intergenic
976230568 4:82838696-82838718 TGCTCTTCACTAGAAATGTATGG + Intronic
976867456 4:89747447-89747469 TACACTGCTTCATAAATGTAAGG + Intronic
978567607 4:110100708-110100730 TTTACTTCTTCTGAAATGTTTGG + Intronic
980762699 4:137256493-137256515 TTCCATTCTCCAGATATGTAAGG - Intergenic
981418137 4:144517652-144517674 TTAAAATCTCCATAAATGTATGG + Intergenic
982885422 4:160774227-160774249 TTCATGTCTCCAGAAATAAAAGG + Intergenic
983250044 4:165333327-165333349 TTCATTTCTACAGAATTATAAGG + Exonic
983410227 4:167386820-167386842 TTCATTTCCCCAGAAATCTATGG + Intergenic
983425113 4:167574027-167574049 CTCAGTTCTACAGAACTGTAAGG + Intergenic
984442233 4:179787010-179787032 TCCCCTTCCCCAGAAACGTAAGG + Intergenic
984496891 4:180509763-180509785 TTCACTACTGAAGAAATGAAAGG + Intergenic
985011146 4:185583363-185583385 ATAACTTATCCAGACATGTAAGG - Intergenic
985274546 4:188225096-188225118 CTCACTTTTCCTGAGATGTAAGG - Intergenic
986186130 5:5441160-5441182 TTCTCCTCTACAGAAATGTCAGG + Exonic
987030881 5:13975472-13975494 CTCAATTATCCAGCAATGTAAGG - Intergenic
987401127 5:17478122-17478144 TTCTGGTCTCCAGAATTGTAAGG - Intergenic
987618074 5:20302912-20302934 GTCACTTCTCCAGAGCTGTCAGG - Intronic
988063278 5:26201999-26202021 TTAACTTCTCATTAAATGTATGG - Intergenic
988151675 5:27390751-27390773 TTCAATTTTTAAGAAATGTATGG - Intergenic
991048986 5:62252758-62252780 CTCACTTGTACAGCAATGTAAGG - Intergenic
991384736 5:66073402-66073424 TTTTTTCCTCCAGAAATGTAGGG + Intronic
992240894 5:74768082-74768104 TTCTTTTCACCAGCAATGTATGG - Intronic
992735780 5:79719079-79719101 TTCACTTCTTCAGAAGTGTAGGG + Intronic
993017114 5:82546666-82546688 ATCTCTTCTCCAAAAATGTCAGG + Intergenic
993498911 5:88641043-88641065 TTCTAGTCTCCAGAACTGTAAGG + Intergenic
993800885 5:92334673-92334695 TTCAATTGACCATAAATGTATGG + Intergenic
993957816 5:94257941-94257963 TTCTCTTGTCAAGAAATTTAAGG + Intronic
994406704 5:99353548-99353570 ATCAATTCACCATAAATGTAAGG + Intergenic
995459482 5:112387859-112387881 ATGACTTCTGCATAAATGTAAGG - Intronic
995602710 5:113815769-113815791 TACATTTCCCCAGTAATGTATGG - Intergenic
995725393 5:115176852-115176874 TTCACTGCTAGTGAAATGTAAGG + Intronic
998182719 5:139956559-139956581 TTCACATCTTCAGAAAGGAAGGG - Intronic
998320281 5:141223895-141223917 TTTCCTTGTCTAGAAATGTAGGG - Exonic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
998330227 5:141319428-141319450 ATCTCTTCTCCAGGAATGTCTGG - Exonic
1001152305 5:169242803-169242825 TTCACTTCCCCAGACATGCATGG + Intronic
1002315021 5:178337922-178337944 GTCACTGCTCCATAAATGTCAGG - Intronic
1002342993 5:178528842-178528864 TGCACTTCTCCCGAAATGAAGGG + Intronic
1002631731 5:180586119-180586141 ATCAATTGACCAGAAATGTAAGG - Intergenic
1003207853 6:4029834-4029856 TGCACTTCTCCAGTATTTTATGG + Intronic
1003747121 6:9015088-9015110 GTCAGTTCTTCATAAATGTATGG - Intergenic
1003790993 6:9547486-9547508 TTCACTGCTCCAGAAGTAAAAGG - Intergenic
1006210526 6:32389908-32389930 TTCACTTTTCCAGAAAGGATAGG - Intergenic
1006673878 6:35747992-35748014 TTCAGTTCACCAGAACAGTAGGG + Intronic
1007980588 6:46152317-46152339 TGCACTTTTCAAGAAATATAGGG + Intergenic
1010257939 6:73781435-73781457 TTCTCTTCTCCCAAAATGTTTGG + Intronic
1012045628 6:94269304-94269326 TTCCATGCTCCAGAAATGTCTGG + Intergenic
1012331060 6:97988118-97988140 TTCTGCTCTCCAGAAATGTGCGG - Intergenic
1013894750 6:115073129-115073151 TTCAATTCACCTGAATTGTATGG + Intergenic
1014074198 6:117218077-117218099 TTCAGGTCTCCAGAAGTGTGAGG - Intergenic
1014426546 6:121313614-121313636 TTCACTTCTGTAGAAGTGAAAGG - Intronic
1015439650 6:133233343-133233365 CTCAACTCTCCAGAAATGTGTGG - Intergenic
1017183658 6:151578282-151578304 TTCTCATCTCCAGAACTGTGAGG - Intronic
1018035144 6:159875317-159875339 GCCACTTCTCCAGAAAGGTCAGG + Intergenic
1020748982 7:12115063-12115085 TTCATTTCAGCAAAAATGTATGG + Intergenic
1021213655 7:17888237-17888259 TTTAATTTTCCAGAAATTTAAGG + Intronic
1021530892 7:21643417-21643439 TTAACTTCTCCATAAAGGTTAGG + Intronic
1022571866 7:31461631-31461653 TGCACATCTCCAGAAGTTTAGGG + Intergenic
1022783672 7:33613420-33613442 TTCACTTCTCCATAATGTTATGG + Intergenic
1024178024 7:46861036-46861058 TTCTCTTGTCGAGAAATGAAGGG - Intergenic
1024192938 7:47031139-47031161 ATCGCTTCTGCAGAAATGCATGG + Intergenic
1026734302 7:72939792-72939814 TTCCCTCTTCCAGAAATGGATGG - Intronic
1026784634 7:73294700-73294722 TTCCCTCTTCCAGAAATGGATGG - Intergenic
1027109436 7:75425228-75425250 TTCCCTCTTCCAGAAATGGATGG + Intronic
1027805391 7:82815120-82815142 TTCACAACTCTAGAAATATATGG + Intronic
1027890829 7:83971946-83971968 TTCACATCTTCAGGAATCTATGG - Intronic
1028576608 7:92359016-92359038 TTCTGCTTTCCAGAAATGTAAGG - Intronic
1030555888 7:111023194-111023216 TTAACATCTGCAGTAATGTAAGG + Intronic
1030617148 7:111749954-111749976 TTCACTTCTAGGGAAATATAAGG + Intronic
1030948224 7:115754104-115754126 TTTACTTCTCAAAAAATTTAAGG - Intergenic
1031211274 7:118830404-118830426 TTTAGTTTTCCAGAACTGTATGG - Intergenic
1031248710 7:119351169-119351191 TTCTCTTCCCCAGCAATGTGGGG - Intergenic
1032638924 7:133743263-133743285 TTCCCATCTCCAGAAAAATAGGG + Intronic
1032952618 7:136932468-136932490 ATCACTTAACCATAAATGTAAGG - Intronic
1034062079 7:148101560-148101582 TTCACTTCTGCAGAACTTTATGG - Intronic
1034899945 7:154901838-154901860 TGCAATTCTCCAGCCATGTAGGG + Intergenic
1035271242 7:157721265-157721287 TTTGCTTCTTCAGAAATGTCAGG + Intronic
1035951116 8:4022325-4022347 TTCACTTCTGCTGAATTGGAGGG - Intronic
1036744440 8:11394286-11394308 TTCTCGTTTCCAGAAATGTCTGG - Intronic
1038125405 8:24667969-24667991 TTCACTTTTCCTGAGATGTCAGG + Intergenic
1038353478 8:26804206-26804228 TTAACTTCTCAAGAAATTCATGG - Intronic
1038607979 8:29029258-29029280 ATCACTTATGCAGAAATCTATGG + Intronic
1038694095 8:29790350-29790372 TTCATTTATCCAGAGATGCAAGG - Intergenic
1039129025 8:34239980-34240002 TTCAGACCTCCAGAACTGTAAGG + Intergenic
1039524608 8:38203092-38203114 ACAACTTCTCCAGATATGTAGGG - Intronic
1040434207 8:47374175-47374197 TTAACTTCTAGAGAAATGTCAGG - Intronic
1040792719 8:51252072-51252094 AACACTTCACCACAAATGTAAGG + Intergenic
1041913518 8:63115276-63115298 TTAACTTCTCCAGGTATGTTGGG + Intergenic
1042429017 8:68682478-68682500 TACACTTATAAAGAAATGTAAGG - Intronic
1043305650 8:78791059-78791081 ATCACTTCACCAGAGATGTATGG - Intronic
1043376593 8:79656593-79656615 TGCACTTCTCCAGAGAACTAAGG + Intronic
1044256497 8:90069638-90069660 TTCACTTCACATGAAATTTATGG - Intronic
1044806466 8:96013229-96013251 TTCCATTCTCCAGAACTGTGAGG - Intergenic
1044913207 8:97084001-97084023 TTCACTTCTGGAAAAATGTGGGG - Intronic
1045832291 8:106477026-106477048 TTCACTTATCCTGAAATGGTGGG + Intronic
1046500421 8:115069645-115069667 TTCACAGGTCCAGAAATTTAGGG + Intergenic
1046832809 8:118764756-118764778 TTCAGTTCTTCAGAAATTAAGGG - Intergenic
1047078302 8:121430643-121430665 TTCTCCTCTCTAGAACTGTAAGG + Intergenic
1047235810 8:123041373-123041395 TACATTTGTCCAGAAATGGAAGG - Intronic
1049516004 8:143056707-143056729 TTAACTTTTCCAGAAAAATATGG + Intronic
1049921788 9:371432-371454 TTCACTTCTTCATAAAAGTCAGG - Exonic
1049925912 9:406914-406936 TTGAGTTCTACAGAAACGTAAGG - Exonic
1050348024 9:4712622-4712644 TTAACTTTTCCAGAAAAATATGG + Exonic
1051382572 9:16473163-16473185 TTCTCTTCTGCAGAGATGTAAGG - Intronic
1051784076 9:20722568-20722590 TTCACTTATTCAGAAATATCTGG - Intronic
1051936009 9:22443410-22443432 TACACTAATCAAGAAATGTAAGG - Intergenic
1052675848 9:31622283-31622305 TTCAGTGCTACAGAAATGAAAGG - Intergenic
1053616900 9:39776843-39776865 TTCACTTCTCCAGTAAATAAGGG - Intergenic
1053875082 9:42536181-42536203 TTCACTTCTCCAGTAAATAAGGG - Intergenic
1053897554 9:42758431-42758453 TTCACTTCTCCAGTAAATAAGGG + Intergenic
1054236615 9:62565538-62565560 TTCACTTCTCCAGTAAATAAGGG + Intergenic
1054267268 9:62930595-62930617 TTCACTTCTCCAGTAAATAAGGG + Intergenic
1054550756 9:66600048-66600070 TTCACTTCTCCAGTAAATAAGGG + Intergenic
1054709480 9:68497176-68497198 TTCACTTCTCCAGCAGCATAAGG + Intronic
1054773810 9:69107564-69107586 TTAACTTTTCCAGAAAAATATGG + Intergenic
1055158416 9:73094454-73094476 TAAACTGCTCCAGAAATGTTGGG + Intergenic
1055254407 9:74350336-74350358 ATCACTTATCCATATATGTATGG + Intergenic
1055679247 9:78697764-78697786 TTAACTTCTCCAAAAAAGGAAGG - Intergenic
1055917401 9:81419348-81419370 TTCTATCCTCCAGAAATGTGAGG - Intergenic
1056932712 9:90892169-90892191 GTCATTTCTCCTTAAATGTATGG - Intronic
1057004754 9:91547363-91547385 TTCACTGGTCCAGAAATCAAGGG - Intergenic
1059605431 9:115829723-115829745 TTCACTCATACAGAAGTGTATGG - Intergenic
1060620267 9:125058741-125058763 TACAATTCTCCAGAGATGTCTGG - Intronic
1186434806 X:9533580-9533602 TTCACTTCTCCACAAAGAAAAGG - Intronic
1186756929 X:12681128-12681150 CTCACTTCTCCAGCATTGTTTGG - Intronic
1190796555 X:53750032-53750054 ATCACTTGGCCATAAATGTAAGG - Intergenic
1191693017 X:63960218-63960240 TTAACTTCTCTACAAATGAATGG - Intergenic
1192314028 X:70038208-70038230 TTCTATTCTCCAGACATGGAGGG + Exonic
1192639708 X:72850215-72850237 TTCATTCCTCCAGAAATATGTGG - Intergenic
1192642003 X:72870590-72870612 TTCATTCCTCCAGAAATATGTGG + Intergenic
1192886450 X:75339673-75339695 ATCAGTTGTCCACAAATGTAAGG + Intergenic
1194468180 X:94257885-94257907 TACAGGTCTCCAGAAAAGTAGGG - Intergenic
1195632300 X:107070260-107070282 TTCACATCTTCAGCCATGTATGG - Intronic
1195791905 X:108597440-108597462 CTCACTTTTCCAGGAATGAAGGG + Exonic
1196177630 X:112657624-112657646 GTCAATTGTCCATAAATGTAAGG - Intronic
1199877720 X:151948015-151948037 CTCACTTCTCCAGCCATGTCAGG + Intergenic
1200107456 X:153723147-153723169 TTCATTTCTCCTAAAAGGTATGG - Exonic