ID: 1165648439

View in Genome Browser
Species Human (GRCh38)
Location 19:37465710-37465732
Sequence CAGAATAATTGGATAGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165648435_1165648439 7 Left 1165648435 19:37465680-37465702 CCAATAATACTGCAGATTATTGG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1165648439 19:37465710-37465732 CAGAATAATTGGATAGGTTCTGG 0: 1
1: 0
2: 2
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165648439 Original CRISPR CAGAATAATTGGATAGGTTC TGG Intronic
900800487 1:4734149-4734171 CAGAACAAGTGCATGGGTTCAGG - Intronic
902429145 1:16349204-16349226 CAGAATAATAGGAAAGGTTGGGG + Intronic
905558487 1:38907180-38907202 TAGCATAATTGGATATCTTCAGG + Intronic
910077456 1:83298154-83298176 AAGAATCATTGGATAGATTTAGG + Intergenic
912139378 1:106703301-106703323 CAGAAAAATGGAATAGTTTCTGG - Intergenic
915196270 1:154192324-154192346 CAGAATGAGTGGAAAGTTTCAGG - Intronic
916061519 1:161102019-161102041 AAGAATCATTGAATAGGATCGGG - Intronic
918738852 1:188102149-188102171 TAGAAGAATTAGATATGTTCAGG + Intergenic
920247505 1:204599669-204599691 CAGAATAATGGGGGAGGATCCGG - Intergenic
1063888502 10:10604475-10604497 CAGAATCATTGTATAGGCTATGG + Intergenic
1065087599 10:22195414-22195436 CAGAAAAATTGCATAGATGCTGG - Intergenic
1066565521 10:36718000-36718022 CATAATAATTGTATATGTTTTGG - Intergenic
1067347305 10:45445801-45445823 AAGAATAAATGGAAAGGTACTGG - Exonic
1068161415 10:53270099-53270121 CAGCATAATTGGACGGGTGCAGG + Intergenic
1068668234 10:59698248-59698270 CAGAATAATTAGATCCTTTCAGG + Intronic
1068743113 10:60497362-60497384 CAGAATAATTGTAGTTGTTCTGG + Intronic
1074747510 10:116549572-116549594 CAGGATCAATGGATAGGTTCTGG - Intronic
1075539307 10:123299118-123299140 CACAATAATTGCATAGGTTATGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079048260 11:17128611-17128633 AAAAATAATTGGGTAAGTTCGGG - Intronic
1079268381 11:18957891-18957913 CAGAATATTTGTGTAGGTTGTGG + Intergenic
1080198301 11:29637570-29637592 GGGCATAATTGGATAGATTCAGG - Intergenic
1087874268 11:103337158-103337180 CAAAATAAAGGGATAGGCTCTGG - Intronic
1087946553 11:104166637-104166659 CAGAATAATTGGTTGGGTTCAGG - Intergenic
1089788145 11:120922796-120922818 AGGAATAATTCCATAGGTTCTGG - Intronic
1094448943 12:30563456-30563478 CTGAAAAATTGGTTAGGGTCTGG + Intergenic
1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG + Intronic
1097358194 12:58626257-58626279 CAGAATTATGCTATAGGTTCTGG + Intronic
1098579416 12:72081233-72081255 CAAAGCAATTGGATAGGTGCTGG + Intronic
1098873725 12:75845262-75845284 CAGGACAATTGGATACATTCGGG - Intergenic
1099218916 12:79889001-79889023 CAGAATTATTTGCTAAGTTCTGG + Intronic
1101978378 12:109383078-109383100 CAGAAACATGGGAGAGGTTCTGG - Intronic
1102303785 12:111789990-111790012 CAGACTCATTGCAGAGGTTCTGG + Intronic
1106431343 13:29683385-29683407 CAGAATCATTGGGGAGCTTCTGG - Intergenic
1106635325 13:31522833-31522855 CAGAGTAGATGGATAAGTTCTGG - Intergenic
1108960447 13:56221401-56221423 CAGGATATTTAAATAGGTTCTGG + Intergenic
1110186198 13:72677990-72678012 CTGAATAATGAGATAGTTTCAGG + Intergenic
1112588696 13:100743993-100744015 AAGAAGAATTGGACAGATTCGGG + Intergenic
1115460898 14:33659461-33659483 TAGAATATTTGGTTGGGTTCTGG - Intronic
1117574540 14:57084900-57084922 CAGAGTCATTGGATAGGATTTGG - Intergenic
1118190106 14:63572495-63572517 CAGAATCTTTGGATAGGTAGTGG - Intergenic
1119096339 14:71835155-71835177 CAAATTAATAGGATAGGTTAAGG - Intergenic
1119953903 14:78774397-78774419 GGGAATAATTGGATAGTTTGAGG + Intronic
1120295808 14:82638861-82638883 CAGAATATTTGGAAAAGTTATGG + Intergenic
1120448895 14:84640442-84640464 CTGAATAAATGCATTGGTTCTGG + Intergenic
1120682399 14:87495870-87495892 CAGAATAAATGTATAAGTTCTGG + Intergenic
1126614535 15:50563577-50563599 AAGAAGAATTGGATAGTTTTAGG + Intronic
1130444416 15:83986569-83986591 CAAATTAATTGGGTAGGTTTTGG - Intronic
1130852050 15:87804309-87804331 CACAATAAATGGATAGGATTTGG - Intergenic
1130905429 15:88237120-88237142 CAGAAAAATAGGATGGGTTAAGG + Intronic
1131444169 15:92482118-92482140 CAGAATAAATGGAGAGGTCAGGG - Intronic
1133587801 16:7212525-7212547 CAGAATAATGGGATCAGTCCTGG + Intronic
1134486697 16:14664234-14664256 CAGAACAATTGCTTAGGGTCGGG + Intronic
1134486872 16:14665616-14665638 CAGAACAATTGCTTAGGGTCGGG + Intronic
1138094912 16:54204005-54204027 CAGAAAAATGGGATGGGTGCCGG + Intergenic
1155129247 18:22913976-22913998 CAGACTGGTTGGACAGGTTCTGG + Intronic
1158495982 18:57955583-57955605 CCCAATAATTGGATATCTTCTGG + Intergenic
1160341160 18:78090000-78090022 GAGAATAATAGGAAAGGATCAGG - Intergenic
1165648439 19:37465710-37465732 CAGAATAATTGGATAGGTTCTGG + Intronic
925666744 2:6264854-6264876 CTGAATGATTGCTTAGGTTCTGG + Intergenic
925813759 2:7727200-7727222 CAGAATAATTTGGTTAGTTCAGG + Intergenic
927451364 2:23212171-23212193 CACAATAATTGGCAATGTTCCGG - Intergenic
928993365 2:37259548-37259570 CAGAATCATTTAAAAGGTTCTGG + Intronic
932527784 2:72490201-72490223 CAGTAGAAGTGGATAGGTTTGGG + Intronic
932999327 2:76902364-76902386 AAGTATAATTGGATAGGGGCTGG - Intronic
935788192 2:106568010-106568032 CAGAATAATGGGAAAGCTGCTGG + Intergenic
939406685 2:141767405-141767427 TAAAGTTATTGGATAGGTTCAGG + Intronic
940313596 2:152304768-152304790 CAGAATAATTCCATAAGTTGAGG + Intergenic
942081249 2:172401410-172401432 CAGAAGAATAGGGTGGGTTCTGG + Intergenic
944471596 2:200059045-200059067 CAGAAGAAATGGATAAATTCTGG + Intergenic
945611250 2:212006190-212006212 AAGAATAATTAGAAAGATTCTGG - Intronic
945752055 2:213799793-213799815 CAGAATAAATATATGGGTTCCGG + Intronic
1169781668 20:9316581-9316603 CAGAAAAATAGGATATGTTAAGG + Intronic
1172222648 20:33284384-33284406 CTGAATAATTGCATAGCCTCTGG - Intronic
1173049301 20:39543677-39543699 CAGAGCAATTGGATAGGTGATGG - Intergenic
1173607394 20:44341288-44341310 CAGAATGGATGGAGAGGTTCTGG - Exonic
1177054404 21:16282811-16282833 CAGAACAATTCAATAGCTTCCGG + Intergenic
1181395456 22:22618187-22618209 CAGAAGACTTTGATAGGTTCTGG - Intergenic
1183162455 22:36123965-36123987 CAGAAGAAGTGAATAGGTTCAGG - Intergenic
956640969 3:71414856-71414878 CAGCAGAATTGCATAGCTTCAGG + Intronic
958830089 3:99076607-99076629 CAAAATAAGTAGATATGTTCTGG + Intergenic
958900507 3:99880485-99880507 CAGAATAATTGGAAGCCTTCTGG - Intronic
962861598 3:139407980-139408002 CAGAAGAAATGGATAAATTCTGG + Intergenic
963423184 3:145088285-145088307 CAGGATAAATGAATAAGTTCTGG + Intergenic
965194063 3:165572312-165572334 CATAATAATAGAATAGCTTCGGG + Intergenic
965245832 3:166266986-166267008 CAGGTTAATTGGATTGGCTCTGG + Intergenic
966052008 3:175629794-175629816 AAGAACAATTGCATATGTTCGGG - Intronic
967338323 3:188369259-188369281 CAGAAGCATTTGATAGGTTGGGG + Intronic
969049579 4:4363278-4363300 CAGAATAATTGTGTAAGTTAGGG - Intronic
969286484 4:6205555-6205577 CATAATAACTGCATAGGTTTGGG + Intergenic
972918965 4:43914487-43914509 TAGAATAAATGGATAAATTCTGG + Intergenic
975049148 4:69838460-69838482 CAGAAGACTTGAAAAGGTTCTGG - Intronic
975544026 4:75543704-75543726 CAGAAGAACTGGATAGGTACTGG + Intronic
976634644 4:87275733-87275755 CAGAATTAGTGGAGAGGGTCTGG - Intergenic
977149475 4:93491672-93491694 CAGAATAATTAGATATGTCAGGG + Intronic
979030956 4:115646332-115646354 CAGAAAAACTGGATAAGTTTAGG - Intergenic
979843616 4:125478973-125478995 AAGAATAGTTAGATATGTTCAGG - Intronic
980328096 4:131374756-131374778 GATAATAACTGGATAGTTTCTGG - Intergenic
980541613 4:134202684-134202706 CAGGTTAATTTCATAGGTTCTGG - Intergenic
984149876 4:176114728-176114750 TAGAGTCATGGGATAGGTTCTGG + Intronic
985383467 4:189420240-189420262 CATATCAATTGGATAGCTTCAGG - Intergenic
989705394 5:44323749-44323771 CAGGATAATGGGATAATTTCTGG - Intronic
990230013 5:53702927-53702949 TAGAAGAATTGGATAAATTCCGG - Intergenic
994311760 5:98280837-98280859 CAGAGTAATTTGATAAGTTAGGG - Intergenic
994990999 5:106997025-106997047 TAGAATAAATGGATAAATTCTGG - Intergenic
997968695 5:138382483-138382505 CAGAATTACTCGATTGGTTCAGG - Intronic
1002653469 5:180722807-180722829 CATAATAATTGTATATATTCAGG + Intergenic
1002653483 5:180722907-180722929 CATAATAATTGTATATATTCAGG + Intergenic
1005614788 6:27561893-27561915 CAGAATAATTGGAGAGCTTCCGG - Intergenic
1006739740 6:36299166-36299188 CAAAATAATTGAATAGGATCTGG - Intronic
1008014713 6:46505321-46505343 CAGAAGAATGGGATAGGCACAGG - Intergenic
1008794320 6:55282801-55282823 AAAAATCATTGGATAGATTCTGG - Intergenic
1010180787 6:73084738-73084760 CAGAATAAGTGGGGAGATTCTGG - Intronic
1010242108 6:73625805-73625827 CAGACCAATTGAATAGGTTGTGG + Intronic
1010651204 6:78456957-78456979 TAAAATAATTGGATTGTTTCAGG - Intergenic
1011206006 6:84898789-84898811 CAGAATAAGTGAATAAGTTCTGG - Intergenic
1011673731 6:89710366-89710388 GAGGATAAATGGATAGTTTCAGG + Intronic
1014800714 6:125775332-125775354 CAAAATAATTGGACAAGTCCAGG + Intergenic
1017105618 6:150884919-150884941 CAGATTTATAGGATTGGTTCTGG + Intronic
1017598100 6:156051356-156051378 GTGAATAATTGGAAATGTTCAGG - Intergenic
1023952338 7:44856660-44856682 AAGAAAAATTGGGCAGGTTCTGG - Intergenic
1024708075 7:51983377-51983399 AATAATAATTGGATATCTTCTGG + Intergenic
1026382379 7:69812542-69812564 CAGAATAATAGGACATGTTTAGG - Intronic
1027295231 7:76763358-76763380 AAGAATCATTGGATAGATTTAGG + Intergenic
1032948353 7:136877990-136878012 CAGAATAATTTGATTGGTAGAGG + Intronic
1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG + Intronic
1037873029 8:22517603-22517625 CAGAAGAAATGGATAGAGTCTGG - Intronic
1038984839 8:32797279-32797301 CAGAATAATTGGAGAGAATTTGG + Intergenic
1039760427 8:40568751-40568773 CAGAATTAGTAGATAGGTTCAGG + Intronic
1044828857 8:96225456-96225478 CAGAGTGTTTGGATAGATTCTGG - Intergenic
1045965918 8:108024312-108024334 GAGAGTAATTGGATAAGTTGTGG + Intronic
1046056869 8:109088611-109088633 CAGAATATTTGGAGAATTTCTGG + Intronic
1047340431 8:123975552-123975574 CAGAAAAATTGGATAAGCTTAGG - Intronic
1047557541 8:125948989-125949011 CAGTATATTTGTATAGGTTTAGG + Intergenic
1047790027 8:128193794-128193816 CAGAATCATTGAATAGCATCGGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1050648519 9:7748801-7748823 CAGAATAAATGAAGAGGCTCAGG - Intergenic
1050963046 9:11762242-11762264 CAGAATAATTGAAAAGGATGTGG + Intergenic
1053258421 9:36639560-36639582 CAAAATAATTGGCTAGCTTTTGG + Intronic
1053387106 9:37701445-37701467 CAGCATGATTGGATATGTTGGGG + Intronic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1056944927 9:90986281-90986303 GAGAATATTTGGACAGGTTGAGG - Intergenic
1203561676 Un_KI270744v1:63534-63556 AAGAATAATTTGATACGGTCAGG - Intergenic
1188264673 X:28057365-28057387 AAAATTAAGTGGATAGGTTCTGG + Intergenic
1194247309 X:91531770-91531792 CAGAAGAAATGGACAGATTCTGG - Intergenic
1197564228 X:128061795-128061817 CAGAAGAAATGGATAAATTCTGG + Intergenic
1198822058 X:140659031-140659053 CAGAAAAATTAAATAGGTCCAGG - Intergenic
1200566331 Y:4773307-4773329 CAGAAGAAATGGACAGATTCTGG - Intergenic