ID: 1165654322

View in Genome Browser
Species Human (GRCh38)
Location 19:37520161-37520183
Sequence CTGAAGATAAGCAGATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165654322_1165654330 23 Left 1165654322 19:37520161-37520183 CCATGGGATCTGCTTATCTTCAG 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1165654330 19:37520207-37520229 TTTGGATCCTGCCACCTTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 251
1165654322_1165654326 5 Left 1165654322 19:37520161-37520183 CCATGGGATCTGCTTATCTTCAG 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1165654326 19:37520189-37520211 CTGGGTGCCCTGCAGACCTTTGG 0: 1
1: 1
2: 4
3: 21
4: 254
1165654322_1165654332 28 Left 1165654322 19:37520161-37520183 CCATGGGATCTGCTTATCTTCAG 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1165654332 19:37520212-37520234 ATCCTGCCACCTTGCTGGACGGG 0: 1
1: 0
2: 0
3: 14
4: 155
1165654322_1165654331 27 Left 1165654322 19:37520161-37520183 CCATGGGATCTGCTTATCTTCAG 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1165654331 19:37520211-37520233 GATCCTGCCACCTTGCTGGACGG 0: 1
1: 0
2: 0
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165654322 Original CRISPR CTGAAGATAAGCAGATCCCA TGG (reversed) Intronic
902511189 1:16967830-16967852 CTGTAGAAATGCAGATTCCAAGG - Intronic
902519912 1:17010391-17010413 CTGATGAACAGCAGCTCCCATGG + Intronic
902534031 1:17108616-17108638 CGGAAGGTAAGCCGTTCCCAAGG + Intronic
903193638 1:21669696-21669718 CTGCAGACAAGCGGAGCCCATGG - Intergenic
904529652 1:31160019-31160041 AGGGAGATAAGCAGATCACATGG + Intergenic
905273276 1:36800982-36801004 CAGAGGAAAAGCAGATTCCATGG - Exonic
906818443 1:48903451-48903473 CAGTGGATAGGCAGATCCCAGGG - Intronic
906853731 1:49282050-49282072 CTGGAGATAGTCAGATGCCAGGG - Intronic
907678560 1:56541758-56541780 CTGAAGCTCAGCAAATCTCATGG + Intronic
912110766 1:106339685-106339707 CTTCAGGTAAGCAGATCCCTGGG - Intergenic
912186443 1:107282350-107282372 ATAAAGATTTGCAGATCCCAGGG - Intronic
912543519 1:110434498-110434520 CTGAAGGAAGGCAGATTCCATGG - Intergenic
912558199 1:110531351-110531373 GTGAGGATCAGCTGATCCCATGG + Intergenic
913234806 1:116770564-116770586 CAGAAGAAAGGCAGAGCCCAGGG - Intergenic
916665793 1:166966185-166966207 CAGAAAATAGGCAGATTCCAAGG - Intronic
917259586 1:173152836-173152858 ATTTAAATAAGCAGATCCCAAGG - Intergenic
919193748 1:194256910-194256932 CTGCAGAGAAGCAGAAACCATGG - Intergenic
919424341 1:197411064-197411086 CAGGAGAAAAGCAGATACCAGGG - Intronic
920518273 1:206602719-206602741 CTGAAGACAGGCAAATGCCAGGG + Intronic
921160691 1:212470285-212470307 CAGAAGATAGGGAGATCACATGG - Intergenic
921533217 1:216311197-216311219 CTGAAGATAGGCAGAGACAAAGG - Intronic
921847906 1:219903764-219903786 CTGAAGCTCAGTAGATCCAAGGG - Intronic
923992377 1:239453740-239453762 CTGTTGAGCAGCAGATCCCAAGG + Intronic
1062794045 10:329416-329438 CTCAAGGTAAGCAGCTCCCTTGG - Exonic
1062801574 10:385050-385072 CTGAGGAGAAGCAGCTCTCAGGG + Intronic
1066429853 10:35341144-35341166 CTGATGGCAGGCAGATCCCAAGG - Intronic
1068457576 10:57277621-57277643 AGGAAAATAAACAGATCCCAAGG + Intergenic
1068586956 10:58810397-58810419 GTGAAGAAAAGCAGATTACATGG - Intronic
1068884453 10:62084101-62084123 ATGAAGATCAACAGAGCCCATGG - Intronic
1069764965 10:70849016-70849038 CTAAAAATAAAAAGATCCCATGG - Intronic
1070130025 10:73649263-73649285 AGGGAGATAAGCAGGTCCCAGGG + Intronic
1070959934 10:80491560-80491582 CTGAAGAAATGAAGATACCAGGG - Intronic
1072604989 10:96973380-96973402 CTGAATATAAGGATATTCCAAGG - Intronic
1072715240 10:97747741-97747763 ATGGAGATAAGCTGATTCCAGGG - Intronic
1073771500 10:106739995-106740017 CTGGAGATAACCTGACCCCATGG + Intronic
1075905283 10:126075832-126075854 CTGATGGTGAGAAGATCCCATGG + Intronic
1077573099 11:3355868-3355890 CTGAAGATTGACAGAGCCCAGGG - Intronic
1078361242 11:10669563-10669585 CAGAAGATAAGAAAATGCCATGG + Intronic
1078453720 11:11458939-11458961 CAGAAGACAAGCAGGGCCCAGGG - Intronic
1079103816 11:17558094-17558116 CTGAGGGAAAGCGGATCCCAAGG - Intronic
1080855537 11:36108678-36108700 TGGCAGGTAAGCAGATCCCAAGG + Intronic
1081306512 11:41518495-41518517 CAGAAGAAAAGCAGATACAAAGG + Intergenic
1085149520 11:74238472-74238494 CTGAAGGTAAAAAAATCCCAAGG - Intronic
1086383457 11:86284088-86284110 CTGAGGAAAAGCAGCTTCCACGG + Intergenic
1086725708 11:90181010-90181032 CTGCAGATAACCATATTCCATGG - Intronic
1090169068 11:124582274-124582296 CAGAATCTAAGCAGATGCCAGGG + Intergenic
1091160101 11:133412107-133412129 CAGAATACAAGCAAATCCCAAGG + Intronic
1092451037 12:8602593-8602615 ATGAAGATGAGCAGATCCACAGG - Exonic
1094872215 12:34604818-34604840 CTGCACATGCGCAGATCCCAGGG + Intergenic
1096463373 12:51835085-51835107 CTCAAAATAAGCAGATCTCCAGG + Intergenic
1096817373 12:54210115-54210137 CTGAAGATGAACAACTCCCAGGG + Intergenic
1097203458 12:57299782-57299804 ATGCAGACAAGAAGATCCCAGGG - Intronic
1097899075 12:64856054-64856076 CAGAAGCCAAGCAGATGCCAGGG - Intronic
1097915787 12:65019114-65019136 CTGAAGGGGAGCAGAGCCCAGGG - Intergenic
1098942660 12:76555960-76555982 CTGAAGATAAGCAGTGTCTAAGG - Intronic
1100800397 12:98224606-98224628 CTGCAGAAAAGCAGATCACATGG - Intergenic
1101007306 12:100413471-100413493 CTTAATATATGCAGATCTCATGG - Intronic
1102342642 12:112135638-112135660 CTGAAGACAGGCAGATCACAAGG - Intronic
1102801252 12:115736389-115736411 CTGGAGTTGACCAGATCCCATGG - Intergenic
1106590464 13:31094112-31094134 CTGCAGATACCCAGATCCAAGGG - Intergenic
1109392125 13:61707055-61707077 TTGAGGATAATTAGATCCCAGGG + Intergenic
1112246591 13:97740712-97740734 AAGAAAATAAGCAGATCCAAAGG + Intergenic
1114837019 14:26214755-26214777 CTAAAGATAAGCAGATTTGAGGG + Intergenic
1119108658 14:71949202-71949224 CTGAACATATGCACACCCCATGG - Intronic
1119552028 14:75522004-75522026 CTGGAGATAAGACGATCCAAGGG - Intergenic
1121239487 14:92418428-92418450 CTCCAGAGAAGCAGAGCCCATGG + Intronic
1121399015 14:93655402-93655424 CTGAAGGTAAGCTGAGCCGAAGG + Exonic
1121942271 14:98082472-98082494 TGGAGGATAAGCAGATCCCTGGG + Intergenic
1123670323 15:22650163-22650185 TTGAAGATAAGGAGATCAAAAGG - Intergenic
1123772576 15:23543596-23543618 TTGAAAATAAGCAGACTCCAAGG - Intergenic
1123830942 15:24136570-24136592 CTGAAGGCTAGCAGACCCCATGG - Intergenic
1123836021 15:24193945-24193967 CTGAAGGCCAGCAGACCCCATGG - Intergenic
1124526297 15:30456585-30456607 TTGAAGATAAGGAGATCAAAAGG - Intergenic
1124772356 15:32551099-32551121 TTGAAGATAAGGAGATCAAAAGG + Intergenic
1127538618 15:59915229-59915251 CTGAAGAAGAGCAGACCCAAAGG - Intergenic
1129595773 15:76962963-76962985 TAGAACATAAGAAGATCCCAGGG + Intergenic
1130208474 15:81900764-81900786 CTGAAGATATTCAGCTCCCTGGG + Intergenic
1135195281 16:20389116-20389138 CTGTAGATAGGCAGAGGCCAAGG + Intronic
1135210244 16:20519809-20519831 TAGAAGATAAGCAGGACCCAGGG - Intergenic
1137311408 16:47263223-47263245 CTGAAGGGAATCAGATCTCAGGG + Intronic
1138036253 16:53609666-53609688 CTGGAGGGAAGCAGATGCCATGG + Intronic
1139779857 16:69341565-69341587 CTGCAGAAAAGTAGACCCCATGG + Exonic
1140335596 16:74102318-74102340 CTAAAGAAAAGCAGATTCTAAGG - Intergenic
1150957579 17:69877426-69877448 GTGAAGATAACCAAATCACAGGG - Intergenic
1151073016 17:71238329-71238351 CTGCAGAAAAGCAGAGCCAATGG - Intergenic
1151210684 17:72541680-72541702 CGGAAGCCAAGCAGATGCCAGGG + Intergenic
1152115567 17:78384911-78384933 CTGAAGACAAGCAAACACCAGGG - Intronic
1155165047 18:23225275-23225297 CTGAATAAAAGCAGATCTCAAGG - Intronic
1155187421 18:23399403-23399425 TTGAAGATAATCAGATAACAGGG - Intronic
1157099381 18:44715626-44715648 CTGAAGATAATCTGAGCCAATGG + Intronic
1157318291 18:46612266-46612288 CTGAAGATGAGCACACCTCAGGG - Intronic
1158484565 18:57854234-57854256 CTGAAGTTTAGAAGATACCATGG + Intergenic
1159876255 18:73814517-73814539 CTGAAGAAAATCAGTTCACATGG - Intergenic
1161425863 19:4202772-4202794 CTGAAGTATAGCAGAGCCCAGGG + Intronic
1165654322 19:37520161-37520183 CTGAAGATAAGCAGATCCCATGG - Intronic
925139740 2:1541897-1541919 TCGGAGATAAGCAGAGCCCAGGG + Intronic
927849096 2:26487736-26487758 CTGAGGATAAGCTCCTCCCAGGG - Intronic
929291626 2:40198658-40198680 CTGAAGATAATCAAATATCAAGG - Intronic
933298303 2:80515169-80515191 CTGAAAATGAGCAGTTTCCAAGG - Intronic
935067397 2:99661529-99661551 CTGAAACTAGGCATATCCCATGG + Intronic
935156127 2:100485114-100485136 CTGAATATAATCAGAGCCAATGG - Intergenic
937615459 2:123916788-123916810 GTCAACATAAGCAGATGCCATGG + Intergenic
940316586 2:152334089-152334111 CTGATAATACGCAGAGCCCAAGG + Intergenic
943778304 2:191792553-191792575 CTGAAAATATGCAGTTCCTATGG - Intergenic
946681406 2:222220947-222220969 CAAAAGAAAAGCAAATCCCATGG + Intronic
949060596 2:241954491-241954513 ATGAAGATCAGCAAATCCCAAGG - Intergenic
1174710170 20:52696022-52696044 CTGATGATAAGCAGAGCCTTTGG - Intergenic
1178923935 21:36759912-36759934 GGGAAGATAAGCAGAAACCAAGG + Intronic
1181558569 22:23686367-23686389 CTGAAGATAGGCTGAGCCCCAGG - Intergenic
1182131676 22:27857676-27857698 CTGAAGACAAGCATGGCCCAGGG + Intronic
1182956877 22:34434910-34434932 AGGAAGAGAAGCAGATCCCATGG - Intergenic
1184410063 22:44321248-44321270 CTGAGGCTAAGCAGAAGCCAAGG - Intergenic
949331659 3:2930178-2930200 CTGAAGAAAATCAGATACAAGGG - Intronic
950148217 3:10666800-10666822 CTGCAGAAAAGCAGGTCTCAGGG - Intronic
951014668 3:17717412-17717434 CTGCAAATAAACAGATCACAAGG + Intronic
954703920 3:52468405-52468427 CTGGAGCCAAGCAGGTCCCAGGG - Intronic
954918651 3:54170304-54170326 CTGAAGGTCAACAGAGCCCAGGG - Intronic
962107103 3:132401708-132401730 CTGCAGAAAAGTAGACCCCATGG + Intergenic
964293274 3:155205423-155205445 ATGAAGAGAGGCAGATTCCAAGG - Intergenic
966130490 3:176632935-176632957 CTGAAGAAAATAAAATCCCAGGG + Intergenic
968984564 4:3868153-3868175 CAGAAGCCAAGCAGATGCCAGGG - Intergenic
969108422 4:4825834-4825856 CTGCAGAGAAGCAGAACCAATGG + Intergenic
969363267 4:6678867-6678889 CTGAGCATGAGCAGAGCCCAGGG + Intergenic
970075583 4:12215949-12215971 TTGAAGAAGAGCAGATCCCGTGG + Intergenic
972101967 4:35431562-35431584 CTGAAGATATGCAGAAGCCTAGG + Intergenic
972830683 4:42810393-42810415 CTGAAGATCTGCAGAGTCCAGGG + Intergenic
976567726 4:86570888-86570910 CTTGAGATAAGCAGATGCCAGGG + Intronic
977015820 4:91692393-91692415 CAGAAGCCAAGCAGATTCCAAGG + Intergenic
977911446 4:102541812-102541834 CTGAGGAAAAGCACAGCCCATGG - Intronic
980244692 4:130224093-130224115 CTGAACAGATGCACATCCCAGGG - Intergenic
981835746 4:149051150-149051172 CTGAAGGTAAGCAGAGCTTAAGG - Intergenic
982188004 4:152821898-152821920 CTCAAGACAAGCAAATGCCAAGG + Intronic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
985566978 5:623966-623988 CTGAAGATAAGAAGGTCCCCAGG - Intronic
986056096 5:4138306-4138328 ATGAAGATATGCATGTCCCATGG - Intergenic
987158419 5:15114783-15114805 CTGCAGAGAAGCAAAGCCCAGGG + Intergenic
987779239 5:22411442-22411464 ATGAAGATCTGCAGATCTCATGG - Intronic
988907183 5:35801792-35801814 CTAGAGAGAAGCAGATCTCAAGG - Intronic
990341088 5:54823670-54823692 TTCAAGAAAAGCAGATCCCAGGG + Intergenic
991417689 5:66408736-66408758 CTGAGGAAAAGCAGGTGCCATGG - Intergenic
992762988 5:79968083-79968105 CTGAACAAAAGCAGAGGCCATGG - Intergenic
995678176 5:114686562-114686584 ATGCAGATAAGCAGATGGCATGG + Intergenic
998066269 5:139161585-139161607 CTTAAGATAATAAAATCCCAGGG - Intronic
999026536 5:148238860-148238882 CTGAAGAGAAACAGATACAAGGG + Intergenic
999960573 5:156751882-156751904 CTGTAGATATGCAGATCCTTAGG + Intronic
1003862117 6:10331916-10331938 GTGAAGGTAAGGAGATGCCACGG + Intergenic
1004163936 6:13239105-13239127 CTGAAGATGAGCGAATACCAGGG - Intronic
1004972890 6:20931569-20931591 CTAAAGATAATCACATGCCACGG - Intronic
1008812094 6:55515018-55515040 CTCAAGGTAGGCAGATCACAAGG + Intronic
1011002572 6:82607484-82607506 CTTAAGATAAGCTGTACCCAAGG + Intergenic
1014894220 6:126881947-126881969 TTGGAGATAAGCAGTTCCCTTGG - Intergenic
1018637541 6:165876967-165876989 CTGTATATAAGCAAATACCATGG + Intronic
1019378389 7:708392-708414 CTAAGGATAACCAGAACCCATGG + Intronic
1021187491 7:17582168-17582190 GTGAAGATCAGCAGTTCCAAGGG + Intergenic
1023137181 7:37064349-37064371 CAGAGGATATGCAGATCCCAGGG - Intronic
1024403501 7:48951188-48951210 CAGAAGTTGAGCAGATGCCACGG - Intergenic
1027887436 7:83927268-83927290 ATGGGGATAATCAGATCCCATGG + Intergenic
1028663590 7:93314000-93314022 CTGAAGATAAAAACATCCCAGGG - Intronic
1029014676 7:97303378-97303400 CTGAACATATGCATATCCTATGG - Intergenic
1029729732 7:102431542-102431564 ATGGACATAAGCAAATCCCAGGG - Intergenic
1031382413 7:121103116-121103138 CTAAAGAAAACCAGATCACAAGG - Intronic
1033554609 7:142477763-142477785 CTGACGAGGAGCAAATCCCAGGG + Intergenic
1033556882 7:142495852-142495874 CTGAGGAGGAGCAAATCCCAGGG + Intergenic
1033559229 7:142515301-142515323 CTGAAAAGCAGCAAATCCCAGGG + Intergenic
1039412931 8:37370713-37370735 CTGAAGGAAAAGAGATCCCAAGG + Intergenic
1040603551 8:48908221-48908243 CTGATGACAAGCACATGCCATGG - Intergenic
1045480638 8:102589188-102589210 CTGCAAATAGGCAGTTCCCAGGG - Intergenic
1049580213 8:143407620-143407642 CTCCAGATAAGCAGAGCCCGGGG + Intergenic
1050346067 9:4688928-4688950 CATAAGATAATCAGATTCCAAGG - Intronic
1050591704 9:7167293-7167315 CTGAAAATAACTACATCCCAAGG + Intergenic
1052380356 9:27764307-27764329 CTGACGAGGAGAAGATCCCATGG - Intergenic
1056758026 9:89394579-89394601 CTGAAGACAGGCAGGGCCCACGG + Intronic
1057010490 9:91597186-91597208 CTGAAGACAACCAGATCCAGTGG + Intronic
1057589632 9:96361170-96361192 CTGAAGATATGCATGCCCCAGGG + Intronic
1057973341 9:99578200-99578222 CTGATGACAAACAGAACCCAAGG - Intergenic
1062220170 9:135410735-135410757 CTGGAGAGCAGCAGGTCCCAAGG + Intergenic
1186302895 X:8219643-8219665 GTGAAGATCAGAAGAGCCCAGGG - Intergenic
1186872287 X:13784812-13784834 TTGCAGAAGAGCAGATCCCAGGG - Intronic
1186872293 X:13784844-13784866 CAGCAGAAGAGCAGATCCCAGGG - Intronic
1187116164 X:16353562-16353584 CTGCAGTTCAGCAGATGCCATGG + Intergenic
1189215299 X:39317987-39318009 GAGAAGATCAGCAGATCACATGG - Intergenic
1193047545 X:77068726-77068748 CTGGAGAAAAGCAGGTGCCATGG + Intergenic
1196717524 X:118825202-118825224 CTGAATATAAGAAGATGCCTAGG - Exonic
1198550889 X:137743737-137743759 CTGAGGATAATCAGATATCAAGG + Intergenic