ID: 1165655950

View in Genome Browser
Species Human (GRCh38)
Location 19:37532384-37532406
Sequence TGGGCTTCACCCAAGAGGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 6, 2: 14, 3: 69, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165655946_1165655950 2 Left 1165655946 19:37532359-37532381 CCTGTGTCATTCAAAGATGTGGT 0: 1
1: 7
2: 0
3: 7
4: 158
Right 1165655950 19:37532384-37532406 TGGGCTTCACCCAAGAGGAGTGG 0: 1
1: 6
2: 14
3: 69
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165655950 Original CRISPR TGGGCTTCACCCAAGAGGAG TGG Exonic
900761904 1:4478265-4478287 TGAGCTTCAGCCAAGCAGAGGGG + Intergenic
901863381 1:12088803-12088825 TGAGCTTTACCCAAGGGCAGCGG - Intronic
902607125 1:17574957-17574979 GGGGCTTCGGCCCAGAGGAGGGG - Intronic
902692267 1:18117342-18117364 TGGGCTTGACCCAAGAGTGAAGG + Intronic
904768392 1:32867889-32867911 TGGGCTTGGCCCTAGAGGAGTGG - Intronic
905750316 1:40456973-40456995 TGGACTTCACTCAGGAGGAGTGG + Exonic
905753721 1:40489116-40489138 TTGACTTCACCCAGGAAGAGTGG + Exonic
905761666 1:40563562-40563584 TGGACTTCACCAAAGAGGAATGG + Intergenic
906901566 1:49842193-49842215 TGGACTTCAGCCAGGAGGAGTGG + Intronic
907313037 1:53550780-53550802 GGTGCTTCATCCAAGACGAGGGG + Intronic
912559369 1:110538988-110539010 TTGGCTTCTCCCAGGAGGTGGGG + Intergenic
913043446 1:115052516-115052538 TGGGCTTCACCCTTAAGGAAAGG - Intronic
915289010 1:154870397-154870419 TAGGCTCCTCCCCAGAGGAGGGG + Intergenic
915748518 1:158183098-158183120 TGTGCTTCACCCGACAGGACAGG - Exonic
915755669 1:158257006-158257028 TGTGCTTCACCCGACAGGACAGG - Exonic
915762503 1:158329406-158329428 TGTGCTTCACCCGACAGGACAGG + Exonic
917477171 1:175378807-175378829 TGGGCTTATCCTAAGAGCAGTGG + Intronic
918332246 1:183471910-183471932 GGGGCTGCAGCGAAGAGGAGAGG + Intergenic
919092814 1:192994624-192994646 TGAACTTCACCCAGGAGGAGTGG - Intergenic
920051896 1:203169245-203169267 CGAGCTTCACCCAAGGTGAGGGG - Exonic
922692588 1:227706637-227706659 TGGGCTTCACCTGGGAAGAGTGG - Intergenic
924036821 1:239946120-239946142 TGGCATTCACCCCAGAGAAGAGG + Intergenic
924041917 1:239992319-239992341 TGGCATTCACCCCAGAGAAGAGG - Intergenic
924766748 1:247039487-247039509 TGGCCTTTACTCAGGAGGAGTGG - Exonic
924782120 1:247159763-247159785 TGAACTTCACCCAGGAGGAGTGG - Exonic
1063143395 10:3275303-3275325 TGGGCTTCACCCAATCTGTGGGG + Intergenic
1065691728 10:28340889-28340911 TGAACTTCACCCAGGAGGAGTGG - Intergenic
1065786381 10:29219725-29219747 TGTGCAGCACCCAGGAGGAGGGG + Intergenic
1066157613 10:32695460-32695482 TAGGCTTCACCTAAGGGTAGAGG + Intronic
1066533475 10:36365408-36365430 TAGGCATCACCTATGAGGAGTGG + Intergenic
1066670929 10:37838061-37838083 TGGACTTCACTCAGGAAGAGTGG - Exonic
1066675566 10:37883641-37883663 TGGGCTTCACCCAGGAGGAGTGG + Intergenic
1066689998 10:38016917-38016939 TGGGCTTCACCCAGGAGGAGTGG + Exonic
1066699766 10:38114783-38114805 TGGGCTTCACTCAAGAGGAGTGG + Exonic
1066991953 10:42523688-42523710 TGGGCTTCACTCAAGAGGAGTGG - Intergenic
1067002713 10:42632371-42632393 TGGGCTTCACCCAGGAGGAGTGG - Exonic
1067121495 10:43475749-43475771 TGGGCTTCACCCAGGAGGAGTGG + Exonic
1067123577 10:43496044-43496066 TGGACTTCACCCAGGAGGAGTGG + Intergenic
1073203194 10:101752987-101753009 TTGGCATCCCACAAGAGGAGAGG + Intergenic
1073428268 10:103469559-103469581 TGGGGTTCACACATGTGGAGAGG - Intergenic
1073735068 10:106336216-106336238 GCGGCTTCACCGAGGAGGAGCGG + Intergenic
1075115977 10:119627502-119627524 TGGGCTCTACCCGAGAGCAGTGG + Intergenic
1079719201 11:23789320-23789342 TGGATTTCACCCAGGAAGAGTGG + Intergenic
1080194033 11:29586844-29586866 TAGTTTTCACTCAAGAGGAGGGG - Intergenic
1084167591 11:67383116-67383138 TGTGCTTCACCCAGCAGGGGAGG - Intronic
1084418502 11:69048770-69048792 TGAGCTCCACCCTAGAGGGGCGG + Intergenic
1084437995 11:69155327-69155349 TCGGCTTCTCCGGAGAGGAGAGG - Intergenic
1084548351 11:69825713-69825735 TGGGCTTCACCCCAGAGATGAGG - Intergenic
1084699716 11:70778535-70778557 GGGCCTTGACCCAAGAGGACTGG + Intronic
1084838058 11:71819721-71819743 TTGACTTCACCCAGGAAGAGTGG - Intergenic
1085346752 11:75773152-75773174 AGGGCTTCCTCCAAGAGGAATGG - Intronic
1088832288 11:113547641-113547663 TGGGATTCAGCCAACAGGTGAGG - Intergenic
1088916244 11:114230055-114230077 TGGGCTTCAACCGAGAGGGCGGG - Intronic
1089118963 11:116118465-116118487 TGGGCTTCTTTCAGGAGGAGGGG - Intergenic
1090232356 11:125117352-125117374 TGGACCTCACCCAATATGAGGGG + Intergenic
1091670601 12:2449561-2449583 TGGGCTTCAGGCAAGAAGAAAGG + Intronic
1091950303 12:4587289-4587311 TGGGCTTTAACCGAGAGGACGGG - Intronic
1092400647 12:8174354-8174376 TTGACTTCACCCAGGAAGAGTGG + Exonic
1092861662 12:12724527-12724549 TGGGCTTCACAGGCGAGGAGCGG + Intergenic
1096023972 12:48345424-48345446 TGTGCTTCTCTCAGGAGGAGTGG - Exonic
1097031980 12:56096421-56096443 TGGCATTCACCTATGAGGAGCGG + Intronic
1098171415 12:67750957-67750979 TTGGCATCACCCAAGAGGAGTGG + Intergenic
1103140647 12:118545186-118545208 TGGGCTTCTGCCATGAGGTGGGG + Intergenic
1105050689 12:133047983-133048005 TGGACTTCACCCAAAAGGAGTGG + Exonic
1105054315 12:133083131-133083153 TAGACTTCTCCCAGGAGGAGTGG + Exonic
1105058041 12:133121748-133121770 TGGAGTTCACTCAGGAGGAGTGG - Exonic
1105061012 12:133151056-133151078 TGGACTTCACCAGGGAGGAGTGG + Exonic
1105622957 13:22087054-22087076 TCGGCTTCACTCAAGGGGAAAGG - Intergenic
1108412209 13:50161149-50161171 TGGGCTTCATCCAAGATAGGTGG + Intronic
1108511769 13:51162844-51162866 TGGGATCTACCCAAGAGGAGAGG - Intergenic
1108725312 13:53174593-53174615 TGATCTTAACCCAGGAGGAGGGG - Intergenic
1114754209 14:25240589-25240611 TGGGCTTGAGACAAGAGGAGAGG + Intergenic
1120931408 14:89852449-89852471 TGGGCTGCTCCCCAGGGGAGGGG - Intronic
1122695773 14:103551373-103551395 TGCACTTCAGCCATGAGGAGGGG - Intergenic
1202891876 14_KI270722v1_random:166707-166729 ATGGCCTCAACCAAGAGGAGGGG + Intergenic
1123981981 15:25612948-25612970 TGGCCTTCACCCACGTGGAGAGG - Intergenic
1126008183 15:44278549-44278571 TGGGGTGAACCCAGGAGGAGGGG + Intergenic
1126868691 15:52964122-52964144 TGGCAATCACCAAAGAGGAGAGG + Intergenic
1128918704 15:71591467-71591489 TGGGAGTCAGCCAAGAGGATCGG - Intronic
1130902996 15:88220943-88220965 TGGGCTTAACCCCAGAGTACAGG + Intronic
1133277905 16:4649077-4649099 TGCGCTTCTCCTATGAGGAGGGG - Intronic
1133575718 16:7087269-7087291 TGGGCTTGCCTCAAGAGGATCGG + Intronic
1134450577 16:14360890-14360912 GAGGCTTCACCCAAGAGCCGTGG + Intergenic
1137542027 16:49370226-49370248 TCAGCTTCACCCAACATGAGGGG - Intergenic
1139680477 16:68558026-68558048 TGGACTTCACCCAGGAAGAATGG + Exonic
1140464240 16:75166798-75166820 TGGACTTTACCCAGGAGGAATGG + Exonic
1141431089 16:83970444-83970466 TGAGGTTCAGCCAGGAGGAGGGG + Intronic
1141949378 16:87330846-87330868 CTGGCTTCCCCCAAAAGGAGTGG + Exonic
1142296058 16:89223185-89223207 TGGACTTCACCCAGGAGGAATGG + Exonic
1142570284 17:869109-869131 TGGGGTTCACCCAAGTCTAGAGG - Intronic
1144147657 17:12413934-12413956 TGGGCTTCTCCCCAAAGGAAAGG - Intergenic
1144490724 17:15706415-15706437 TGGACTTTACACCAGAGGAGTGG + Exonic
1144775104 17:17781422-17781444 TGTCCTTCCCCCAAGAGGTGGGG - Intronic
1144858627 17:18285444-18285466 TGGGCCTCACCCCAGACAAGCGG - Exonic
1146524689 17:33556211-33556233 TGGACTTCTGCCAAGGGGAGAGG + Intronic
1146550105 17:33773254-33773276 TGGGCTACACTCTAGAGGATGGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148508290 17:48146013-48146035 TGGGCCTCACCCCAGAGACGAGG - Intronic
1149652520 17:58284896-58284918 TGGGCTTCACCCTGGGGGTGGGG - Intergenic
1150550862 17:66208586-66208608 TGAGTTTCACCCAAGAAAAGAGG + Intergenic
1150623021 17:66822597-66822619 TGGGCATCTCCCAAAAGGTGAGG - Intergenic
1151553405 17:74834752-74834774 TGGGCTTCACCTGAGGGGTGAGG + Intronic
1153491072 18:5648477-5648499 TGGGCTCCAGCCAAGAGGCAAGG + Intergenic
1153778597 18:8475394-8475416 TGGGTTCCACTCAAGAGGTGTGG - Intergenic
1154024757 18:10696777-10696799 TATGCTTCAAGCAAGAGGAGAGG - Intronic
1155141759 18:23050408-23050430 TGGGCTGAACCCAAGGGGACTGG - Intergenic
1157513484 18:48295106-48295128 TGGGCTTCTCCCCTGTGGAGGGG - Intronic
1158352671 18:56578789-56578811 TGTGCTTCCCGCAGGAGGAGGGG + Intergenic
1158527486 18:58228271-58228293 TAGGCTTCTGCCAACAGGAGTGG + Intronic
1161173790 19:2827645-2827667 TGGACTTCTCCCAGGAGGAGTGG + Exonic
1161177102 19:2850615-2850637 TGGACTTCACCCTGGAGGAGTGG + Exonic
1161185419 19:2915550-2915572 TGGACTTCACCCTGGAGGAGTGG + Exonic
1161188532 19:2939357-2939379 TGAACTTCACCCCAGAAGAGTGG - Exonic
1161234648 19:3191864-3191886 TGGGTTTCTCCCAGGAGAAGGGG + Intronic
1161895501 19:7076409-7076431 TGGAGTTCACCCAGGAGGAGTGG + Exonic
1162174470 19:8821256-8821278 TGGAGTTCACCCAGGAGGAGTGG - Exonic
1162235062 19:9302454-9302476 TGGACTTTACCCAGGAGGAATGG - Exonic
1162239616 19:9339221-9339243 TGGACTTCACCCAGGAGGAGTGG + Exonic
1162243527 19:9378990-9379012 TGGACTTTTCCCAGGAGGAGTGG + Exonic
1162247968 19:9418581-9418603 TGGACTTCACCCCAGAAGAATGG - Exonic
1162253765 19:9470468-9470490 TGGAGTTCACCCAGGAAGAGTGG - Exonic
1162254147 19:9474275-9474297 TGGACTTCACCCAGGAGGAGTGG - Exonic
1162260977 19:9533916-9533938 TGGACTTCACCCAGGAGGAGTGG - Exonic
1162271216 19:9617121-9617143 TGGACTTCACCCCAGAGGAGTGG - Exonic
1162276315 19:9658085-9658107 TGGAGTTCACCCCAGAGGAGTGG - Exonic
1162280565 19:9693770-9693792 TGGAGTTCACCCCAGAGGAGTGG - Exonic
1162288883 19:9763358-9763380 TGGACTTTACCCAGGAGGAGTGG - Exonic
1162594215 19:11614555-11614577 TGAACTTCACCCTGGAGGAGTGG + Exonic
1162598495 19:11648386-11648408 TGAACTTTACCCAGGAGGAGTGG + Intergenic
1162602850 19:11682574-11682596 TGAACTTCACCCAGGAGGAGTGG + Intergenic
1162607880 19:11725277-11725299 TGAACTTCACACAAGAGGAGTGG - Exonic
1162616437 19:11804570-11804592 TGAACTTCACCCAGGAGGAGTGG + Exonic
1162619544 19:11830311-11830333 TGAACTTCACCCAGGAGGAGTGG + Exonic
1162623779 19:11866233-11866255 TGAACTTCACCCAGGAGGAGTGG + Exonic
1162628277 19:11903601-11903623 TGAACTTCACCCAGGAGGAGTGG + Exonic
1162633535 19:11947209-11947231 TGAACTTCACCCAGGAAGAGTGG + Exonic
1162637049 19:11977066-11977088 TGAACTTCACCCAGGAGGAGTGG + Exonic
1162640029 19:12001158-12001180 TGAGCTTCACCCAGGAGGAGTGG + Intergenic
1162642002 19:12018242-12018264 TGACCTTCACCCAAGAGGAGTGG - Exonic
1162645468 19:12046710-12046732 TGAACTTCACCCAGGAGGAGTGG - Exonic
1162649319 19:12074059-12074081 TGAACTTCACCCAGGAGGAGTGG + Exonic
1162653535 19:12110333-12110355 TGAACTTCACCCCAGACGAGTGG + Intronic
1162656573 19:12135845-12135867 TCAGCTTCACCCAGGAGGAGTGG - Exonic
1162658133 19:12147752-12147774 TGAACTTCACCCAGGAGGAGTGG - Exonic
1162663093 19:12185813-12185835 TGAACTTCACCCAGGAGGAGTGG + Exonic
1162665498 19:12207360-12207382 TGAACTTCACCCAGGAGGAGTGG + Intergenic
1162670169 19:12250318-12250340 TGAACTTCACCCAGGAGGAATGG - Intronic
1162673191 19:12276032-12276054 TGAACTTCACCCATGAGGAGTGG - Exonic
1162678827 19:12322661-12322683 TGAACTTCACCCAGGAGGAATGG - Exonic
1162682106 19:12353064-12353086 TGAACTTCACCCAGGAAGAGTGG - Exonic
1162685851 19:12383637-12383659 TGAACTTCACCCAGGAAGAGTGG - Exonic
1162686790 19:12393373-12393395 TGAACTTCACCCGAGAAGAGTGG - Exonic
1162691142 19:12433147-12433169 TGAACTTCACCCGAGAAGAGTGG - Exonic
1162694880 19:12466800-12466822 TGAACTTCACCCAGGAGGAGTGG - Exonic
1162709711 19:12583506-12583528 TGAACTTCACCCTGGAGGAGTGG - Exonic
1162714794 19:12623728-12623750 TGAGCTTCAGCCAGGAGGAGTGG + Exonic
1163723607 19:18910184-18910206 TGGGCGGCAGCCAAGGGGAGAGG - Intronic
1163853127 19:19677892-19677914 TGAACTTCACCCAGGAGGAGTGG + Exonic
1163857312 19:19714437-19714459 TGAACTTCACCCTGGAGGAGTGG - Exonic
1164675491 19:30097791-30097813 GGGGCTTCAGCCCAGATGAGGGG + Intergenic
1165553634 19:36609955-36609977 TGGACTTCACCCAGGAGGAGTGG + Exonic
1165564448 19:36712414-36712436 TGGACTTCACTCAGGAGGAGTGG + Exonic
1165636808 19:37347218-37347240 TGTACTTCACCCAGGAGGAGTGG + Exonic
1165644816 19:37426328-37426350 TCGACTTCACTCAGGAGGAGTGG - Exonic
1165649773 19:37475909-37475931 TAGACTTCTCCCAAGAGGAATGG + Exonic
1165655950 19:37532384-37532406 TGGGCTTCACCCAAGAGGAGTGG + Exonic
1166018944 19:40007302-40007324 TAGACCTCTCCCAAGAGGAGTGG + Exonic
1166689719 19:44815102-44815124 TGGGCTTCTCCCAAGGGTACTGG - Intronic
1167230879 19:48282399-48282421 TGAACTTCACCAAAGAGGAGTGG + Exonic
1167548383 19:50142891-50142913 TGGACTTCACCCTGGAGGAGTGG - Intergenic
1167815639 19:51878465-51878487 TGGGCTTCACCAGGGAGGAGTGG - Exonic
1167817533 19:51896928-51896950 TGGACTTCACCTGGGAGGAGTGG - Exonic
1167828970 19:52002231-52002253 TGGACTTCACCTGGGAGGAGTGG - Exonic
1168460095 19:56547536-56547558 TAGATTTCTCCCAAGAGGAGTGG + Exonic
1168467347 19:56613840-56613862 TGGACTTCACCCAGGAGGAGTGG + Intronic
1168532180 19:57138548-57138570 TGAACTTCACCCAGGGGGAGTGG - Exonic
1168545129 19:57243951-57243973 TGACTTTCACCCAGGAGGAGTGG + Exonic
1168554104 19:57323710-57323732 TGACATTCACCCAGGAGGAGTGG + Exonic
1168571632 19:57475736-57475758 TGTACTTCTCCCAGGAGGAGTGG - Exonic
1168578668 19:57535172-57535194 TGTACTTCTCCCAGGAGGAGTGG + Exonic
1168634909 19:57988671-57988693 TGGACTTCACCCAAGAAGAGTGG - Exonic
1168646394 19:58061608-58061630 TGGGCTTCAGCCAGGAGGAGTGG + Exonic
1168666986 19:58211588-58211610 TGGACTTCAGCCGGGAGGAGTGG + Exonic
1168671794 19:58246329-58246351 TGGCATTCACACAGGAGGAGTGG + Exonic
1168676970 19:58285745-58285767 TGGACTTTACCCAGGAGGAATGG + Exonic
1168700603 19:58437123-58437145 TATACTTCTCCCAAGAGGAGTGG - Exonic
1168703228 19:58453724-58453746 TGTACTTCTCCCAGGAGGAGTGG + Exonic
1168705700 19:58469208-58469230 TGTACTTCTCCCAGGAGGAGTGG + Exonic
928911828 2:36429754-36429776 GAGGCTTCACCCAAGACCAGGGG + Intronic
929111629 2:38409807-38409829 TGGGCTTCCTCCAAGTGGAATGG + Intergenic
931991828 2:67797849-67797871 TGGGCTTCATCCAAGTGGCAAGG + Intergenic
932050781 2:68395835-68395857 TGGGCTTCCCTCAGGAGGGGAGG - Exonic
935130090 2:100255156-100255178 AGGGCTTCACCGAAGGGGAGAGG - Intergenic
935406837 2:102718544-102718566 TGGGCAACCCCCGAGAGGAGAGG + Exonic
936715824 2:115186786-115186808 TGGGCTTTACCCTAGAAGATGGG + Intronic
938124912 2:128664570-128664592 GTGGCTTCAGCCTAGAGGAGCGG - Intergenic
942057250 2:172196039-172196061 TTGGCCTCACCCAGAAGGAGGGG - Intergenic
942849546 2:180467792-180467814 TGGTCTTCTGCCAAGAGTAGAGG - Intergenic
945032650 2:205680233-205680255 AGGCCTTCACTCAAGGGGAGTGG + Intergenic
946134848 2:217637175-217637197 TGGGCTTGCCCCCAGATGAGGGG + Intronic
948536528 2:238651316-238651338 GGGGCATCACCCCAGAGGTGAGG - Intergenic
948536547 2:238651382-238651404 GGGGCTTCACCCCAGATGTGAGG - Intergenic
1168849272 20:965453-965475 TGGGCTCCGCCCAAGGGCAGTGG + Intronic
1170555051 20:17508327-17508349 TAAGCTTCACCCAAAAGGGGTGG + Intronic
1170657770 20:18305709-18305731 TGGATTTCACCCAGGATGAGTGG + Exonic
1171493136 20:25536242-25536264 TGGGCTCCATCCAAGACGAGAGG + Intronic
1172589236 20:36105839-36105861 GGGGCTGCACCCCAGGGGAGGGG + Intronic
1173838044 20:46138590-46138612 TGGGTCTCAGCCAAGGGGAGTGG - Intergenic
1173890444 20:46504690-46504712 TGAACTTCACCCAAGAGGAATGG - Exonic
1173998721 20:47358887-47358909 TGGGCCTCACCAAAAGGGAGGGG + Intergenic
1174393697 20:50233500-50233522 TCGGCTTCAACCAAGAGGGAGGG - Intergenic
1175612347 20:60362187-60362209 TGCGCTTGACCCAGGAGGACTGG - Intergenic
1178609270 21:34066874-34066896 GGGGCTTTAACCAAGAGGAGGGG - Intergenic
1179647795 21:42785819-42785841 TGGGCTTCACGAAGGAGCAGAGG + Intergenic
1180017373 21:45096190-45096212 TGCGCCTAGCCCAAGAGGAGAGG + Intronic
1181078820 22:20400660-20400682 TGGACTTCACCCAGGAGGAGTGG + Exonic
1181428205 22:22857524-22857546 TGGACTTTACCCAAGAGGATGGG - Intronic
1181658526 22:24321801-24321823 TGGGCTTTTCCCTAGAGCAGAGG + Exonic
1181737378 22:24892426-24892448 TGGGATTCAGCAAAGAGGTGGGG - Intronic
1184724945 22:46338605-46338627 AAGGCTTCACCGGAGAGGAGGGG + Intronic
1185038461 22:48491358-48491380 GTGGCATCACCCCAGAGGAGAGG + Intronic
949956595 3:9274383-9274405 TGGGCTTCACCCATCATGGGAGG + Intronic
951647212 3:24906138-24906160 TGGGTTTCACAAATGAGGAGGGG + Intergenic
953469138 3:43152042-43152064 TGGGCTTTACCCAAGAATAGGGG + Intergenic
953572466 3:44082139-44082161 TGGGCCTAGCCCAAGGGGAGAGG - Intergenic
954633823 3:52060905-52060927 TGGGTATCCCCCAATAGGAGTGG - Intergenic
956670195 3:71681818-71681840 TGGGCTAAACTCAAGAAGAGGGG + Exonic
961109136 3:124268819-124268841 TGGACTACAACCATGAGGAGTGG + Exonic
963899504 3:150720489-150720511 TTGGCATCATCCAGGAGGAGGGG + Intergenic
964768637 3:160202069-160202091 TGGGCTGCATGCAAGAGGAAGGG - Intergenic
969490625 4:7497453-7497475 TGGGCTGCTCCTAGGAGGAGGGG - Intronic
969779473 4:9387225-9387247 TTGACTTCACCCAGGAAGAGTGG - Exonic
970904121 4:21195198-21195220 TGGGCATCACCCAGGAGGCCAGG + Intronic
971317628 4:25580667-25580689 TGGGCTACAGCCATCAGGAGAGG + Intergenic
971494272 4:27247425-27247447 TGGGTTCCAGCCAAGAGGAAGGG + Intergenic
973678041 4:53286288-53286310 TGAGCTTCAGCCTAGTGGAGCGG + Intronic
975693883 4:76992868-76992890 TGGGTTTGTCCCAAGAAGAGTGG + Intronic
977818787 4:101447390-101447412 TGGGCTTCAACTTAGAGGTGGGG + Intronic
978282366 4:107034364-107034386 TTGGCTTCCCACAAAAGGAGCGG + Intronic
981911568 4:149987436-149987458 TGGCTTCCATCCAAGAGGAGGGG + Intergenic
982777863 4:159460522-159460544 TGGATTTCATCCAAGAGGACTGG - Intergenic
984635352 4:182104338-182104360 TGGGATTTACCAAAGAAGAGTGG - Intergenic
985766460 5:1782189-1782211 TGTGCTTCACACATGAGGAGGGG - Intergenic
986077294 5:4351109-4351131 TGGGCTCATCCCAAAAGGAGTGG + Intergenic
991253759 5:64592727-64592749 TGGGCATCACAGAGGAGGAGGGG - Intronic
994672883 5:102783856-102783878 TGAACTTGATCCAAGAGGAGAGG - Intronic
995476465 5:112553248-112553270 GGGTCTGCATCCAAGAGGAGAGG + Intergenic
999308948 5:150539081-150539103 TAGGCTGCACCCAAGGGTAGGGG + Intronic
999353284 5:150898504-150898526 TGGATTTCACCCAGGAGGAGTGG - Exonic
999356818 5:150942626-150942648 TGGATTTCACCCAGGAGGAGTGG - Intergenic
999357698 5:150952410-150952432 TGGACTTCAAACAGGAGGAGTGG - Intergenic
1000654220 5:163856560-163856582 TGACCTTCACCCAACAGAAGTGG - Intergenic
1001402903 5:171456633-171456655 TGGGCTTCACCAAGAAGGGGCGG + Exonic
1001755003 5:174161501-174161523 TGGGCTTCTCCCAAGATGAAGGG + Intronic
1002402088 5:178996517-178996539 TGGGCTTCCACCAGGAGAAGTGG - Intergenic
1002994343 6:2268740-2268762 TGGGCTCCACCCAAGACCTGCGG - Intergenic
1003036174 6:2642214-2642236 TGGCCATCAACCAAGAGGGGAGG + Intergenic
1003668913 6:8137568-8137590 TGGGCTTCAGTAAAGAGCAGTGG + Intergenic
1003806976 6:9736659-9736681 AGGGCTTCACTCAACAGGAGTGG - Intronic
1005994242 6:30921979-30922001 TGGGCTGGCCCCAAGAGGTGAGG + Exonic
1007133949 6:39502873-39502895 TGGGCTTCACACAATAGTAGGGG + Intronic
1007472470 6:42099711-42099733 TGGGCTTCACAAGAGAGGTGGGG + Intergenic
1007767679 6:44170669-44170691 TGGTCCACACTCAAGAGGAGAGG + Intronic
1008922100 6:56852856-56852878 TGGGCTTCCCACAAAAGCAGTGG + Intronic
1009037459 6:58134754-58134776 TGGGATTCAGTGAAGAGGAGAGG + Intergenic
1009213250 6:60888375-60888397 TGGGATTCAGTGAAGAGGAGAGG + Intergenic
1009549820 6:65074839-65074861 TGTGCTTCACCAAAGATGATGGG + Intronic
1013994954 6:116297277-116297299 TGTTCTCCACCCAAGAGGAGAGG - Intronic
1014995274 6:128135329-128135351 AGGGCTGGACCCAAGAGCAGTGG + Intronic
1018910579 6:168098919-168098941 TGGGGTCCACCTATGAGGAGGGG + Intergenic
1019050112 6:169176396-169176418 TGGGCTTATTCCAAGGGGAGGGG + Intergenic
1019267642 7:127372-127394 GGGACTCCCCCCAAGAGGAGTGG + Intergenic
1019852417 7:3573107-3573129 TGGGCTTTATCCCAGAGCAGTGG + Intronic
1020047940 7:5057323-5057345 TGGATTTCACCCAGGAGGAGTGG + Exonic
1020057435 7:5127693-5127715 TGGGCTTCACCCGGAAAGAGTGG - Intergenic
1020170315 7:5839977-5839999 TGGGCTTCACCCGGAAAGAGTGG + Intergenic
1020287680 7:6697761-6697783 TGGACTTCACCCAGGAGGAATGG - Exonic
1020982056 7:15082845-15082867 TGGGATTCAACAGAGAGGAGAGG + Intergenic
1022355391 7:29609815-29609837 TGGGCTTAAGCCAATTGGAGTGG + Intergenic
1025073586 7:55923190-55923212 TGGACTTCACCAGAGAGGAGTGG + Exonic
1026728439 7:72890655-72890677 TGGATTTCACCCAGGAGGAGTGG + Exonic
1027115394 7:75475138-75475160 TGGATTTCACCCAGGAGGAGTGG - Exonic
1027120578 7:75516170-75516192 TGGATTTCACCCAGGAGGAGTGG - Intergenic
1027286520 7:76650832-76650854 TGGATTTCACCCAGGAGGAGTGG - Intergenic
1029288053 7:99479689-99479711 TGTACTTCACCAGAGAGGAGTGG + Exonic
1029722211 7:102375851-102375873 TGGATTTCACCCAGGAGGAGTGG + Exonic
1033272689 7:139946976-139946998 TGTGAGTCACCCAAAAGGAGAGG + Intronic
1034892778 7:154855426-154855448 TGTGCTCCTCCCCAGAGGAGGGG + Intronic
1035315902 7:157997522-157997544 TGGGCCTCACTCAAGAGGGAAGG + Intronic
1035403777 7:158586085-158586107 TGGGCTACATCCCAGAGGTGCGG + Intronic
1035517034 8:242915-242937 TAGACTTCACTCAAGAAGAGTGG + Exonic
1036276909 8:7361186-7361208 TTGACTTCACCCAGGAAGAGTGG - Exonic
1036344423 8:7949157-7949179 TTGACTTCACCCAGGAAGAGTGG + Exonic
1036839765 8:12109928-12109950 TTGACTTCACCCAGGAAGAGTGG + Exonic
1036861556 8:12356168-12356190 TTGACTTCACCCAGGAAGAGTGG + Intergenic
1037645346 8:20787759-20787781 TGGGCTTCACCCACAAGATGAGG + Intergenic
1037751407 8:21684719-21684741 TGGGCCTCAGCCCCGAGGAGGGG - Intergenic
1037767345 8:21780364-21780386 TAGGGTTCATCCCAGAGGAGAGG - Intronic
1038352096 8:26786092-26786114 TGGGCTTCATCTAAGAGTACTGG - Intronic
1040374465 8:46810500-46810522 TGGACTTCTCCCAAGGGTAGAGG - Intergenic
1042178411 8:66060229-66060251 TGACCTTGACACAAGAGGAGGGG - Intronic
1047217041 8:122884656-122884678 TGGTCTTCACCGAGGAGGAGGGG + Intronic
1047285795 8:123486240-123486262 AGGGCCTCAGCCTAGAGGAGGGG + Intergenic
1051523135 9:18012694-18012716 TGGGCTTCTCCCAGGAGATGGGG + Intergenic
1054580539 9:66908266-66908288 TGGAATTCACCCGGGAGGAGTGG + Exonic
1057350382 9:94292369-94292391 TGGCCTTCACCCAGAAGGAGTGG + Exonic
1057434565 9:95027942-95027964 TGAACTTCACCCACGACGAGAGG - Intronic
1057632218 9:96729133-96729155 TGGAATTCACCCAGGAGGAGTGG + Intergenic
1057635640 9:96763582-96763604 TAGAATTCACCCAGGAGGAGTGG - Exonic
1057642952 9:96844966-96844988 TGGAATTCAGCCAGGAGGAGTGG - Exonic
1058758157 9:108102987-108103009 TGGCCTTCAACCAAGAACAGAGG - Intergenic
1060179161 9:121520591-121520613 TGGTCTTCACTCCTGAGGAGGGG - Intergenic
1061399230 9:130359421-130359443 TAGCTTTCAGCCAAGAGGAGGGG - Intronic
1061597886 9:131644113-131644135 TGGGCTTCTCTCAGGAGCAGAGG - Intronic
1061953731 9:133950750-133950772 TGGGCTGCAGCAGAGAGGAGGGG - Intronic
1062319307 9:135982661-135982683 TGGCCATCAGCCAGGAGGAGCGG + Intergenic
1062550215 9:137082676-137082698 TGGTCTTCATCCAGGATGAGCGG - Exonic
1062678660 9:137763901-137763923 TGGGCAACACCCGGGAGGAGCGG + Intronic
1189976142 X:46462776-46462798 TGGACTTCACCCTGGAGGAGTGG + Exonic
1189982928 X:46528859-46528881 TGGACTTCACCCTGGAGGAGTGG - Exonic
1190087727 X:47410304-47410326 TGGATTTCACCCGACAGGAGTGG + Exonic
1190093052 X:47456348-47456370 TGGACTTCAGCAAGGAGGAGTGG - Exonic
1190155021 X:47983361-47983383 TGGATTTCACCCAGGAGGAGTGG - Exonic
1190164434 X:48060895-48060917 TGGACTTCACGCAGGAAGAGTGG - Exonic
1192430428 X:71107825-71107847 TGAGATTCCCCCAAAAGGAGGGG - Exonic
1193574433 X:83181969-83181991 TAGGATGCACTCAAGAGGAGTGG + Intergenic
1199496539 X:148458645-148458667 TGGACTTTTCCCAAGAGCAGAGG - Intergenic
1200148886 X:153941909-153941931 TGGGGGCCACCCAGGAGGAGGGG - Intronic
1201864353 Y:18633300-18633322 TGGGCTCCAGTCAAGAGGAAAGG + Intergenic
1201868969 Y:18687078-18687100 TGGGCTCCAGTCAAGAGGAAAGG - Intergenic