ID: 1165657096

View in Genome Browser
Species Human (GRCh38)
Location 19:37543559-37543581
Sequence TAAGTGTTTCGCTGATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165657096_1165657102 4 Left 1165657096 19:37543559-37543581 CCACCTCATCAGCGAAACACTTA 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1165657102 19:37543586-37543608 AAACTAGGGAGGAGTGAGGATGG 0: 1
1: 0
2: 1
3: 61
4: 607
1165657096_1165657103 16 Left 1165657096 19:37543559-37543581 CCACCTCATCAGCGAAACACTTA 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1165657103 19:37543598-37543620 AGTGAGGATGGCAACTGTGTTGG 0: 1
1: 0
2: 2
3: 18
4: 207
1165657096_1165657099 -10 Left 1165657096 19:37543559-37543581 CCACCTCATCAGCGAAACACTTA 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1165657099 19:37543572-37543594 GAAACACTTATTTGAAACTAGGG 0: 1
1: 0
2: 2
3: 14
4: 278
1165657096_1165657100 -7 Left 1165657096 19:37543559-37543581 CCACCTCATCAGCGAAACACTTA 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1165657100 19:37543575-37543597 ACACTTATTTGAAACTAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1165657096_1165657101 0 Left 1165657096 19:37543559-37543581 CCACCTCATCAGCGAAACACTTA 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1165657101 19:37543582-37543604 TTTGAAACTAGGGAGGAGTGAGG 0: 1
1: 0
2: 1
3: 24
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165657096 Original CRISPR TAAGTGTTTCGCTGATGAGG TGG (reversed) Intronic
900507215 1:3035693-3035715 TAAGAGCTTCGCTGGTGAGGGGG - Intergenic
900911738 1:5601495-5601517 TAAGTGTGTCGTGGATAAGGAGG + Intergenic
902898424 1:19495788-19495810 AAACTGTTTCCCTGATGATGGGG + Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
917793883 1:178518783-178518805 TAAGTGTTTTGTTGGTGGGGAGG + Intronic
918444554 1:184604170-184604192 TAATTGTTTGGCAGATGTGGTGG + Intronic
920116926 1:203628083-203628105 TGAGTGTTTGGCAGATGGGGTGG + Intronic
921358631 1:214309502-214309524 TTTGTGTTTTGCTGCTGAGGGGG + Intronic
921476089 1:215612106-215612128 TAAGAGTTTCACTGATGCTGTGG + Intronic
922311212 1:224392850-224392872 TAAGTGATTCTCTGTGGAGGAGG - Intronic
1063569897 10:7205791-7205813 TAAGTGGTTCCCAGTTGAGGGGG - Intronic
1065539040 10:26742359-26742381 TAAGTGTCTAGATGATGTGGGGG - Intronic
1076639588 10:131905117-131905139 TAAGTGTCCTGCTGATGAGCAGG + Intronic
1078902843 11:15657478-15657500 TAAATGTTTGCCTAATGAGGTGG - Intergenic
1079210541 11:18456707-18456729 TAAGAATTTCGCGGAAGAGGAGG + Exonic
1080380420 11:31765040-31765062 TTAGTGTTTTGCTGAGGAGTGGG - Intronic
1082015005 11:47478853-47478875 TAAGTGTTTCACTGCTGCAGAGG - Intronic
1086067246 11:82758928-82758950 TATGTGTTGCTCTGATGAAGAGG - Intergenic
1095631550 12:44382845-44382867 TAAGTGCTTGGGTCATGAGGAGG - Intronic
1097393796 12:59048605-59048627 TGAGTGTTCCACTGATGAGTTGG + Intergenic
1097852614 12:64427446-64427468 TAAGTACTTGGCTGATGAGCAGG - Intronic
1099358680 12:81670034-81670056 TAAGTGTTTGGCTTTTGAGAAGG + Intronic
1101491645 12:105215087-105215109 TAAGTGTTTCCCTGATTTGTGGG + Intronic
1105973639 13:25453947-25453969 TATGGGTTTCACTGATGAGTGGG + Intronic
1106740731 13:32638392-32638414 AAAGCATTTTGCTGATGAGGTGG + Intronic
1106871579 13:34027531-34027553 TGAGTGTTTACCTCATGAGGAGG - Intergenic
1107853828 13:44595454-44595476 TAAGGATTTCACTGATGAGGAGG - Intergenic
1108187509 13:47902606-47902628 TAATTGTTTTGCTGAAGAGGAGG + Intergenic
1112708765 13:102102507-102102529 CAAGCTTTTCCCTGATGAGGAGG - Intronic
1115309870 14:31968316-31968338 GGAGTGTTTCACTGATGAGCTGG + Intergenic
1117675233 14:58148967-58148989 TTAGTGATTCTCTGATGAGGGGG + Intronic
1119497021 14:75088809-75088831 TCACTGTTTCTCTGATGAAGGGG - Intronic
1137439716 16:48487673-48487695 TTAGAGCTTCCCTGATGAGGTGG - Intergenic
1147468419 17:40632287-40632309 TAAGAATTTCACTGATGAGGCGG + Exonic
1148278691 17:46330116-46330138 CAAGTGCTTCCCTGATGAGCTGG - Intronic
1148300901 17:46547978-46548000 CAAGTGCTTCCCTGATGAGCTGG - Intronic
1148733270 17:49850825-49850847 TAATTGTTGTGATGATGAGGAGG + Intergenic
1150401602 17:64861285-64861307 CAAGTGCTTCCCTGATGAGCTGG + Intronic
1161942204 19:7412408-7412430 TAAGTGTCTCGGTGAGAAGGCGG - Intronic
1165657096 19:37543559-37543581 TAAGTGTTTCGCTGATGAGGTGG - Intronic
926185479 2:10687358-10687380 TAAGTGTTTCAAGGAGGAGGTGG - Intronic
928917332 2:36486591-36486613 TAAGTATTTCCCTGTTGAAGTGG + Intronic
944500671 2:200356471-200356493 TAAGTGTTTAGCTTAGAAGGAGG + Intronic
945473468 2:210254109-210254131 TAAGTGTGTCGCCAGTGAGGGGG + Intergenic
946069560 2:217021220-217021242 TATGTGTTTCTCTCTTGAGGTGG + Intergenic
1171326219 20:24295727-24295749 TAAGTATTTCCAGGATGAGGTGG - Intergenic
1178442346 21:32609020-32609042 TCAGTGTTTGGCTGATCATGTGG - Intronic
1182407431 22:30148358-30148380 TAAGTGTTTGCCTGGTGTGGGGG + Intronic
951666104 3:25125532-25125554 GAAATGTTTCTCTGAGGAGGAGG + Intergenic
955279823 3:57583670-57583692 TAAGTGTTTGGAAGATGGGGTGG - Intronic
955853367 3:63246000-63246022 TAAGTGTTTGGCTTATGAAAAGG + Intronic
955885599 3:63595091-63595113 TAAGTGTTTTGCAAATGAAGTGG + Intronic
962025105 3:131539603-131539625 TAAGTGTTTTGGGGAAGAGGAGG + Intronic
962094463 3:132279067-132279089 TAAGTGTTTCTTTCCTGAGGAGG + Intronic
965100022 3:164284499-164284521 TACCTGTTTCCCTGAAGAGGAGG - Intergenic
968882992 4:3310664-3310686 TGTGTGTGTCCCTGATGAGGTGG + Intronic
970451383 4:16169593-16169615 TCAGTGTTTCACAGAGGAGGAGG - Intronic
972087973 4:35243108-35243130 TAAGTGTTCAGCAGAAGAGGGGG - Intergenic
972814345 4:42627991-42628013 TAAGTGTTTTGCTGAAGAGTGGG - Intronic
982112129 4:152066385-152066407 TAAATGTTTGTCTGGTGAGGTGG - Intergenic
988793385 5:34629948-34629970 CAGGTATTTCTCTGATGAGGTGG - Intergenic
991192907 5:63896793-63896815 TCAGTGTGTCGGGGATGAGGGGG + Intergenic
999816861 5:155185555-155185577 TAAGTGATTCCCTGAAGAGTTGG - Intergenic
1006037044 6:31222065-31222087 TTAGTTGTTCCCTGATGAGGTGG + Intergenic
1011164399 6:84430187-84430209 TAAGGATTTCACTGATGAGGCGG + Intergenic
1011436967 6:87348636-87348658 TAAGATTTTCTCTGATTAGGAGG - Intronic
1011976746 6:93310799-93310821 TAATATTTTTGCTGATGAGGGGG + Intronic
1013869064 6:114735045-114735067 TAAGTTTTTTCCTGTTGAGGCGG + Intergenic
1025104572 7:56160674-56160696 GAAGTGTTTGGCTTATGGGGCGG - Intergenic
1027409499 7:77900130-77900152 TAAGTTTTGAGGTGATGAGGTGG + Intronic
1028741600 7:94281907-94281929 CATGTGGTTTGCTGATGAGGAGG + Intergenic
1032961603 7:137041719-137041741 TAGGTGTTTAGATCATGAGGAGG - Intergenic
1034403103 7:150879380-150879402 TAAGTGTTTTGCTGGGGAGCAGG - Intergenic
1035420836 7:158728143-158728165 CAACTGTTTCTCAGATGAGGAGG + Intergenic
1036089010 8:5644869-5644891 TTGGTGCTTGGCTGATGAGGAGG - Intergenic
1039601968 8:38846867-38846889 TAAGTGAGTCACTGCTGAGGAGG - Intronic
1041343356 8:56869529-56869551 TAAGTGTGTGGCTGATGAAGTGG + Intergenic
1043638473 8:82417275-82417297 TAAGTGTTTCTTTGATGGAGAGG - Intergenic
1047602425 8:126439246-126439268 TAAATGTGTTGCTGATCAGGAGG + Intergenic
1050594889 9:7195347-7195369 TAAGTGTTAAGCTCATGAGATGG + Intergenic
1059571896 9:115446576-115446598 TAAATGTTTCTCTGGTGAGTTGG + Intergenic
1195336282 X:103858076-103858098 TAACAGTTTTGATGATGAGGTGG + Intergenic
1196210408 X:112989716-112989738 TAAATATTTTGCTGATGAGAAGG - Intergenic
1196689691 X:118545955-118545977 TAAATGTTTCGCTAATTAGATGG + Intronic
1196989187 X:121309085-121309107 TAATAGTTTCTCTGCTGAGGAGG + Intergenic
1197108832 X:122748055-122748077 TAAGTGTTTCCAAGATTAGGAGG - Intergenic
1197273915 X:124455791-124455813 GAAGTGTTGCTCTTATGAGGAGG + Intronic