ID: 1165657872

View in Genome Browser
Species Human (GRCh38)
Location 19:37549688-37549710
Sequence GATGAAGGAGTGCCCGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165657872_1165657874 -3 Left 1165657872 19:37549688-37549710 CCTGAGGCGGGCACTCCTTCATC No data
Right 1165657874 19:37549708-37549730 ATCCTCTTCAGATTTCATTCTGG No data
1165657872_1165657876 5 Left 1165657872 19:37549688-37549710 CCTGAGGCGGGCACTCCTTCATC No data
Right 1165657876 19:37549716-37549738 CAGATTTCATTCTGGATTAAAGG No data
1165657872_1165657877 23 Left 1165657872 19:37549688-37549710 CCTGAGGCGGGCACTCCTTCATC No data
Right 1165657877 19:37549734-37549756 AAAGGATGTGTGCAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165657872 Original CRISPR GATGAAGGAGTGCCCGCCTC AGG (reversed) Intergenic
No off target data available for this crispr