ID: 1165660042

View in Genome Browser
Species Human (GRCh38)
Location 19:37570105-37570127
Sequence GTCTTTTAGGGGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 664}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165660042_1165660054 14 Left 1165660042 19:37570105-37570127 CCACCCACCCTCCCCTAAAAGAC 0: 1
1: 0
2: 2
3: 57
4: 664
Right 1165660054 19:37570142-37570164 CCTTTAATGCCTGACATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 110
1165660042_1165660055 15 Left 1165660042 19:37570105-37570127 CCACCCACCCTCCCCTAAAAGAC 0: 1
1: 0
2: 2
3: 57
4: 664
Right 1165660055 19:37570143-37570165 CTTTAATGCCTGACATCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165660042 Original CRISPR GTCTTTTAGGGGAGGGTGGG TGG (reversed) Intronic
900568508 1:3347098-3347120 GTCTTTCCGGGGAGGGTGGAGGG + Intronic
902944424 1:19824460-19824482 GGCTTTGAGTGGAGGGTGGGAGG + Intergenic
903128437 1:21263042-21263064 GCCTTGAAGGGGAGGGCGGGAGG + Intronic
903237514 1:21959799-21959821 TTCTTTAAGTGGAGGCTGGGAGG - Intergenic
904049854 1:27632661-27632683 GTGTTTTAGAGGCTGGTGGGTGG - Intronic
904210356 1:28883218-28883240 GTCATTTAGGGGTGGGTAAGGGG - Intergenic
904226851 1:29028223-29028245 GTCCCTTAGGGTAGGGTAGGAGG + Intronic
904497262 1:30893899-30893921 GTTTTTTAGTGCAGGGTGCGGGG + Intronic
905027184 1:34859020-34859042 ACCTTTTGGGGGAGAGTGGGTGG - Intronic
905370213 1:37479043-37479065 GTCTTTAATGGGAGTGGGGGAGG - Intronic
905452116 1:38063603-38063625 TTCTTGGAGGGGTGGGTGGGTGG + Intergenic
906447325 1:45913644-45913666 GTCTTTTGTGGGGGGATGGGAGG + Intronic
906799318 1:48722118-48722140 GTTTATTTGGGGTGGGTGGGTGG + Intronic
907700518 1:56782758-56782780 GTTTCTTAGGGGAGGGTCTGTGG - Intronic
908073790 1:60491948-60491970 CTCTTTTAGGGCAGGGATGGTGG - Intergenic
908655964 1:66389206-66389228 GTGGTTTAAGGGAGGGTTGGGGG + Intergenic
908844304 1:68309257-68309279 TTCTTTCAGGGGAGGAAGGGAGG + Intergenic
908976882 1:69909447-69909469 GTCTTTTAGGGCAGGCCTGGGGG + Intronic
909066125 1:70938096-70938118 GTGTTTTGGTGGGGGGTGGGAGG + Intronic
910480004 1:87648422-87648444 GTATTTTAGGGGGTAGTGGGAGG - Intergenic
910822707 1:91368563-91368585 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
910931507 1:92446955-92446977 GACTTTCAGTGGTGGGTGGGCGG + Intergenic
911792255 1:102032158-102032180 GTCTTTTAAGGCAGGGTGTTTGG - Intergenic
912276908 1:108268548-108268570 TTCTTGTAGGGGTGGGTGGGAGG + Intergenic
912291321 1:108425808-108425830 TTCTTGTAGGGGTGGGTGGGAGG - Intronic
912299265 1:108497203-108497225 GCCTGTTGGGGGTGGGTGGGAGG + Intergenic
912490133 1:110058166-110058188 GTGTCTTAGGGGTGTGTGGGAGG + Intronic
912490337 1:110059299-110059321 GTGTTTACTGGGAGGGTGGGAGG + Intronic
913352055 1:117872679-117872701 GCCTGTTGGGGGAGGGTGGGGGG + Intronic
915463473 1:156082672-156082694 TTTTTTAAGGGGAGGGTGCGGGG + Intronic
915934640 1:160083529-160083551 GGCTTTTTGGGGAGGGGGGCAGG - Intronic
916020220 1:160785009-160785031 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
916157438 1:161867320-161867342 GTCTATTTAGGGAGGGAGGGAGG + Intronic
916187224 1:162145247-162145269 GTATGTGAGGGGTGGGTGGGGGG + Intronic
916695749 1:167234442-167234464 GTATTTTAGGGTAGGTTTGGTGG + Intronic
917453428 1:175166063-175166085 TTCTTGTAGGGGGAGGTGGGAGG + Intronic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
918548224 1:185709382-185709404 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
919206168 1:194423667-194423689 GGCTTCTTGGGTAGGGTGGGGGG + Intergenic
919842832 1:201622099-201622121 CTCTTTTAGACGAGGGTGGCAGG + Intergenic
920001346 1:202801864-202801886 GTCTCTTTGGGGTGAGTGGGTGG - Intronic
920223932 1:204424509-204424531 GCATTTTGGGGGTGGGTGGGTGG - Exonic
920355227 1:205367063-205367085 GTTTTTTTGGGGAGGGGGCGAGG + Intergenic
920440651 1:205978539-205978561 GTGTTTGAGGGGTGGATGGGTGG + Exonic
920552577 1:206875834-206875856 GTTTTTTGGGGGAGGGGGGAGGG - Intergenic
920616727 1:207499970-207499992 GTCTTTGCGGAGAGGGTGAGAGG - Intronic
920633225 1:207673007-207673029 GTCTTTGCAGGGAGGGTGAGAGG - Intronic
921023869 1:211259810-211259832 GGCTCTGAGGGGAGGGAGGGCGG - Intronic
921081122 1:211739037-211739059 TACTGTTAGGGGAGAGTGGGAGG - Intergenic
921602745 1:217123745-217123767 GCCTGTTAGGGGAGAGTAGGGGG + Intronic
921737098 1:218641131-218641153 GTCTTTTTTGGGAGGTGGGGAGG + Intergenic
921935666 1:220794155-220794177 TGCTTTTATAGGAGGGTGGGAGG - Intronic
922197297 1:223370717-223370739 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
922504958 1:226121214-226121236 GTATTTTAAAGGAAGGTGGGAGG - Intergenic
922878265 1:228958380-228958402 GTCTTTTATGGGAGGCCGTGAGG - Intergenic
923298058 1:232614018-232614040 GTCTTTGTGGGAAGAGTGGGAGG - Intergenic
924005509 1:239606271-239606293 TTTTTTTTGGGGAGGGTGCGGGG + Intronic
924078286 1:240363940-240363962 GTGCTTTAGGGGAAAGTGGGGGG + Intronic
924204699 1:241699572-241699594 GGATTGTAGGGGTGGGTGGGGGG + Intronic
1063251039 10:4275035-4275057 GTCTGTTGGGGGATGGGGGGAGG + Intergenic
1063464137 10:6232238-6232260 GTTTTTTTGCGGGGGGTGGGTGG + Intronic
1063475618 10:6326275-6326297 GTCTGTCAGGGGAGTGTGGGTGG + Intergenic
1063862872 10:10331079-10331101 GCCTTTTTGTGGGGGGTGGGGGG + Intergenic
1063874694 10:10461835-10461857 CTTTTTTTGGGGATGGTGGGAGG - Intergenic
1064019352 10:11796778-11796800 GTCTTTTTGGGGAAGGGGGAAGG + Intergenic
1064328598 10:14373434-14373456 ATATTTTAGGTCAGGGTGGGTGG + Intronic
1064958680 10:20939399-20939421 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1065248147 10:23780677-23780699 TTCTTTTTTGGGAGGGTGGGGGG + Intronic
1065406446 10:25371345-25371367 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
1065747996 10:28859306-28859328 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
1066086960 10:31980481-31980503 GTCTACTTGGGGAGGGAGGGTGG - Intergenic
1066192646 10:33070033-33070055 GGCTATGAGGGCAGGGTGGGAGG - Intergenic
1066228738 10:33411288-33411310 ACCTGTCAGGGGAGGGTGGGGGG - Intergenic
1066254533 10:33665470-33665492 ATCATTTGGGGGTGGGTGGGGGG + Intergenic
1067390529 10:45858887-45858909 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1067555253 10:47264985-47265007 GTCTGTTTGGGCAGGGTAGGAGG + Intergenic
1068004177 10:51373592-51373614 GACTGTCAGGGGAGGGTAGGGGG - Intronic
1068567376 10:58591000-58591022 GCCTTTGAGGGAAGGGAGGGGGG - Intronic
1068725729 10:60300504-60300526 GTATTTAAATGGAGGGTGGGCGG + Intronic
1068784172 10:60952060-60952082 TTCTTTTTTGGGGGGGTGGGGGG - Intronic
1069110468 10:64440548-64440570 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1069337738 10:67372941-67372963 GTCTTTTAGGGCAGGCCTGGTGG - Intronic
1069827008 10:71260560-71260582 GTCATCTGGGGGAGGCTGGGGGG + Intronic
1069836830 10:71314550-71314572 TCCTTTTGGGGGAGGGTGCGGGG - Intergenic
1070134522 10:73680585-73680607 TTTTTTTTGGGGGGGGTGGGTGG + Intronic
1070332266 10:75426654-75426676 GTATTTTAATTGAGGGTGGGAGG + Intergenic
1070455496 10:76610462-76610484 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1072405612 10:95149327-95149349 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1073059015 10:100722377-100722399 GCCTTTTTGGGGAAAGTGGGGGG + Intergenic
1073345778 10:102781862-102781884 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
1073594886 10:104789804-104789826 GTTCTTTATGTGAGGGTGGGTGG - Intronic
1073742098 10:106419140-106419162 GTCTTGTGGGGAAGGGTGGGAGG + Intergenic
1074079752 10:110158147-110158169 GTCTCTCTGGAGAGGGTGGGTGG + Intergenic
1074387962 10:113032140-113032162 GACTTTTGGGAGAGGGTGGAAGG + Intronic
1074556542 10:114496491-114496513 GCCTGTTGGGGGAGGGTGGCGGG + Intronic
1075067015 10:119295795-119295817 GACTTGTGGGGAAGGGTGGGGGG + Intronic
1075490959 10:122868748-122868770 GTCTTTTAGGGCAGGCCTGGTGG - Intronic
1075824190 10:125340167-125340189 GACTTGGAGGGAAGGGTGGGAGG + Intergenic
1076097134 10:127740565-127740587 GCATTTTGGGGGAGGGTGGGAGG + Exonic
1076291814 10:129351298-129351320 GACTCTGAGGGAAGGGTGGGAGG - Intergenic
1077558126 11:3236942-3236964 TTTTTTTAGAGCAGGGTGGGGGG + Intergenic
1078534046 11:12159213-12159235 TTCTTCTAGGGGAGGAGGGGTGG + Intronic
1078896735 11:15603511-15603533 TTCTTGCAGGGGAGGGAGGGAGG + Intergenic
1079437524 11:20472850-20472872 GGCTTTTTTTGGAGGGTGGGGGG + Intronic
1079502347 11:21115667-21115689 TTCTAATAGGGGAGGGAGGGCGG - Intronic
1079634474 11:22718504-22718526 GACTTTGGGGGAAGGGTGGGAGG + Intronic
1081374179 11:42339688-42339710 GTTTTTAAGGGCAGGATGGGGGG - Intergenic
1081402165 11:42655994-42656016 GCCTGTTGGGCGAGGGTGGGAGG + Intergenic
1081468748 11:43350267-43350289 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1082782327 11:57297609-57297631 GTCCTTTAGGGGTGGGAGGAGGG - Intergenic
1083080531 11:60087704-60087726 GTTTTTTTGGTGGGGGTGGGGGG - Intergenic
1083360508 11:62104214-62104236 GACTTTCAGGGGAGGGAGAGGGG - Intergenic
1084174876 11:67417889-67417911 GTCTTTTTGGGGAGGGGGTGAGG - Intronic
1085134682 11:74075360-74075382 ATATTTTGGGGGGGGGTGGGGGG + Intronic
1085492250 11:76931642-76931664 CTCTTTTAGGGCAGGGCTGGTGG + Intronic
1085495582 11:76965773-76965795 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
1086301161 11:85427591-85427613 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
1086417170 11:86599913-86599935 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1086440878 11:86828671-86828693 CTCTTTTAGGGCAGGCTTGGTGG + Intronic
1086486644 11:87310469-87310491 GGCTTCTAGAGGAGGGAGGGAGG + Intronic
1086661800 11:89428184-89428206 CTCTTTTAGGGGAGGCCTGGTGG - Intronic
1087612758 11:100453682-100453704 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089911083 11:122101410-122101432 GTCTTGAAGGTGGGGGTGGGGGG - Intergenic
1090225855 11:125071841-125071863 GGCTTGTGGGGGAGGGGGGGTGG + Intronic
1091052481 11:132385366-132385388 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1091062915 11:132480834-132480856 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
1091518809 12:1214533-1214555 CTCTTTGAGGGGAGGCCGGGAGG - Intronic
1093113997 12:15187133-15187155 ATCTTTGAGGAGATGGTGGGAGG + Intronic
1093118076 12:15235241-15235263 GACTTGGAGGGAAGGGTGGGAGG - Intronic
1093215889 12:16360983-16361005 GTCTTTTGGGGGCGGGGAGGGGG - Intronic
1093332268 12:17857369-17857391 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1093624448 12:21328602-21328624 GTATTGTAGGGCAGGGTGGTGGG - Intronic
1094062297 12:26327156-26327178 ATCTTCTAGGGGAGAGTGGCAGG - Intergenic
1094564185 12:31584830-31584852 TTTTTTTCGGGGAGGGTGGGTGG - Intronic
1094779556 12:33774815-33774837 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1094792667 12:33932384-33932406 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1094858567 12:34432951-34432973 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095553530 12:43472801-43472823 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1095661636 12:44743266-44743288 GTCTTTTAGGGCAGGCCTGGTGG - Intronic
1096793045 12:54056992-54057014 GTTTGTTAGGAGAAGGTGGGAGG + Intergenic
1096802975 12:54123768-54123790 GAGTTGTGGGGGAGGGTGGGTGG - Intergenic
1096844980 12:54401491-54401513 GTGGTTTAGAGGAGGGTGGAAGG + Intronic
1096989049 12:55783566-55783588 ATGATTTAGGGGAGGCTGGGGGG + Intronic
1097272618 12:57786620-57786642 GTATTTTAGAGGAGGTTTGGGGG + Intronic
1097342203 12:58451768-58451790 GACTTGTAGGGAAGAGTGGGAGG - Intergenic
1098091594 12:66907852-66907874 TTATTTGAGGGGAGGGTGGCTGG + Intergenic
1099239417 12:80120999-80121021 GTTATTTAGGGTAGGGTGTGTGG + Intergenic
1099538334 12:83872911-83872933 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1099730949 12:86501488-86501510 GCCTGTTGAGGGAGGGTGGGCGG - Intronic
1100200675 12:92294774-92294796 GGCTTCTGGGGTAGGGTGGGAGG - Intergenic
1100742296 12:97607400-97607422 CTCTTTTAGGGCAGGCCGGGAGG + Intergenic
1100795645 12:98179190-98179212 GTCTTTTGGGGGAGAATTGGTGG - Intergenic
1100973607 12:100098217-100098239 CTTTTTTTGGGGAGGGTGCGGGG - Intronic
1102451987 12:113048950-113048972 TTCATTTGGGGAAGGGTGGGGGG - Intergenic
1102648414 12:114418839-114418861 GCCTGTCAGGAGAGGGTGGGGGG + Intergenic
1102933247 12:116878357-116878379 TTCTTTTAGGGTAGGGAAGGTGG + Intronic
1102955167 12:117054315-117054337 GACTTTAAGGTGAGGGTGTGAGG - Intronic
1104390115 12:128384812-128384834 ATCTTTGAAGGGAGGGTTGGTGG - Intronic
1105682352 13:22742312-22742334 GACTGTGAGGGTAGGGTGGGTGG + Intergenic
1105852054 13:24343801-24343823 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1105985732 13:25564860-25564882 GACTTTGGGGGAAGGGTGGGAGG - Intronic
1106077156 13:26470503-26470525 TACTTTTAGGGGAGGGAAGGAGG - Intergenic
1106437302 13:29734635-29734657 GTTTTTTTGGTGAGGGAGGGTGG - Intergenic
1106899622 13:34341384-34341406 TTCTCTTAGGGGTGGGTGGGGGG - Intergenic
1107445083 13:40463348-40463370 GACTTGTGGGGAAGGGTGGGAGG - Intergenic
1108058382 13:46507982-46508004 GGGTTTAAGGGGAGGGTAGGTGG - Intergenic
1108114304 13:47110537-47110559 GTCTTTTAATGCAGGGTGGCTGG - Intergenic
1108557532 13:51609609-51609631 GGTTTTTTGGGGAGGGCGGGGGG - Intronic
1109405836 13:61898855-61898877 TTCTTTTGAGGGAGGGAGGGAGG - Intergenic
1110038232 13:70716756-70716778 GTCTTCTAGAGTAGGGAGGGGGG + Intergenic
1110115944 13:71816900-71816922 GTCTTTTAGTGGGTGGAGGGTGG + Intronic
1110577491 13:77075667-77075689 TTCTTTTTGGGGGGGGTGAGGGG + Intronic
1111702911 13:91713318-91713340 GTATTTTAAAGGGGGGTGGGGGG - Intronic
1112985698 13:105446633-105446655 CTTTTTTAGGGGTGTGTGGGGGG + Intergenic
1113263580 13:108592513-108592535 GTTGTATAGGGGATGGTGGGTGG + Intergenic
1113370815 13:109723810-109723832 GTCTTTTTTGGGAGGCTGGGGGG - Intergenic
1113908563 13:113831361-113831383 GTCCTACAGGGAAGGGTGGGCGG + Intronic
1114003629 14:18288014-18288036 CTCTTTTAGGGCAGGGCTGGTGG + Intergenic
1115730191 14:36260188-36260210 GCCTGTTGGGGGTGGGTGGGGGG + Intergenic
1115917362 14:38330924-38330946 GCCTGTTAGGGCAGGGTGGCGGG + Intergenic
1115970359 14:38938729-38938751 GACTTGGAGGGAAGGGTGGGAGG + Intergenic
1116767186 14:49086998-49087020 TTCTTTTGGGAGAGGGTAGGTGG - Intergenic
1116995394 14:51318630-51318652 GTCTTTTTGGGGTGGTTTGGGGG + Intergenic
1117051543 14:51865324-51865346 ATCTTGGAGGTGAGGGTGGGAGG - Intronic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117771324 14:59137003-59137025 GTCTATTAGGGGAGGTGGGGAGG + Intergenic
1117952041 14:61092414-61092436 GTCTTTGGGTGGGGGGTGGGGGG - Intergenic
1118103219 14:62628997-62629019 GTCTTTTGGTGGGGGGAGGGGGG - Intergenic
1118162803 14:63307860-63307882 GTCTTTGGGGGAAGAGTGGGAGG + Intergenic
1119355046 14:73999484-73999506 GTTTTTTTTGGGGGGGTGGGGGG - Intronic
1119477963 14:74942055-74942077 GTCTCTTAGGGGGGGCAGGGTGG + Exonic
1119710397 14:76818014-76818036 GTCTTTTGGAGGATGGTGGCGGG - Intronic
1120830928 14:88996705-88996727 GTCATTTAGGTGAGAGGGGGTGG - Intergenic
1120875725 14:89373458-89373480 GTCTTTTTGGGGTGGGGGTGGGG + Intronic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1121174978 14:91884308-91884330 GGCTTCTAGGGGAGGCGGGGAGG - Intronic
1121175321 14:91886776-91886798 GTCTTATCGGGTAGGGTTGGGGG - Intronic
1121774808 14:96583662-96583684 GTGTGTTGGGGGAGGGCGGGTGG + Intergenic
1123025237 14:105420827-105420849 GTCTTTCACAGGAAGGTGGGGGG + Intronic
1123138021 14:106048427-106048449 GTCTCGTAAGTGAGGGTGGGAGG + Intergenic
1123809840 15:23912645-23912667 TTTTTTTAGGTGGGGGTGGGTGG + Intergenic
1123956810 15:25344980-25345002 TTTTTGTAGGGGAGGTTGGGAGG - Intronic
1124620167 15:31269319-31269341 GTCTCTTAGTGATGGGTGGGGGG + Intergenic
1124814318 15:32973570-32973592 GTTTTTTTGGGGGGGGTGAGGGG - Intronic
1124835482 15:33192865-33192887 GTCTCTTAGGAGAAGGTGTGAGG - Intronic
1125867026 15:43061799-43061821 TACTTTGAGGGAAGGGTGGGTGG + Intronic
1126871682 15:52996177-52996199 ATCATTTAGGGTTGGGTGGGGGG - Intergenic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127546747 15:59999913-59999935 GGGTTTTGGGGGCGGGTGGGGGG - Intergenic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127999983 15:64181917-64181939 GTCATAAAGAGGAGGGTGGGAGG + Intronic
1129827062 15:78641051-78641073 TTCTTTTCGGGGAAGGAGGGAGG - Intronic
1130240052 15:82179682-82179704 TTCTTTCAGTGGAGGGAGGGAGG - Intronic
1130456355 15:84113871-84113893 ATCTTTGGGGTGAGGGTGGGAGG - Intergenic
1130806725 15:87331572-87331594 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1130818443 15:87465553-87465575 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1130822705 15:87511717-87511739 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1131226844 15:90631226-90631248 CTCTTTTGGGCGAGGGTGAGAGG + Intronic
1131584379 15:93677228-93677250 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1132482882 16:175428-175450 GACTTCTGGGGAAGGGTGGGAGG - Intergenic
1132568979 16:635842-635864 ATTTCTTAGGGGAGGCTGGGGGG + Intronic
1133511392 16:6461095-6461117 GCCTGTTGGGAGAGGGTGGGGGG + Intronic
1133577485 16:7107636-7107658 GTTGTTTTGGGGAGGGTGGAAGG - Intronic
1133972822 16:10579839-10579861 GTCTTTTAGGTGAAGATGTGGGG - Intronic
1134123218 16:11599117-11599139 GCCTTTTATGGGGGGGTGGGGGG + Intronic
1134164416 16:11918533-11918555 TTTTCTTAGGGGTGGGTGGGTGG - Intergenic
1134507611 16:14820942-14820964 GCCCCTTAGGGGAGGGTGGGAGG + Intronic
1134535778 16:15025757-15025779 GTACTGTAGGGGAGTGTGGGTGG - Intronic
1134695309 16:16219704-16219726 GCCCCTTAGGGGAGGGTGGGAGG + Intronic
1134976523 16:18574982-18575004 GCCCCTTAGGGGAGGGTGGGAGG - Intergenic
1135169502 16:20170824-20170846 GTTTTTAAGTGGAGGGTAGGAGG + Intergenic
1135598993 16:23765579-23765601 GTCTTTTGGAGGGTGGTGGGTGG - Intergenic
1135648526 16:24185435-24185457 GTATGACAGGGGAGGGTGGGAGG - Intronic
1137423243 16:48354072-48354094 TTTTTTTTGGGGGGGGTGGGGGG + Exonic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138427499 16:56945868-56945890 ATTTTTTAGGGGTGGGGGGGGGG - Intergenic
1138600597 16:58051814-58051836 GTAAGATAGGGGAGGGTGGGAGG - Intergenic
1138790632 16:59899744-59899766 GTCTTTATGGGGAGGGGGGAGGG + Intergenic
1139842426 16:69892343-69892365 GCCTGTCAGGGGTGGGTGGGGGG - Intronic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1141297709 16:82785118-82785140 GTCTTTCAGGGGAGAGACGGGGG + Intronic
1141682807 16:85554150-85554172 GCGTTTAAGGAGAGGGTGGGGGG + Intergenic
1141742195 16:85901096-85901118 TTGTTTTCGGGGAGTGTGGGGGG + Intronic
1143289732 17:5819827-5819849 GGGTTTTAGTTGAGGGTGGGTGG + Intronic
1143304910 17:5938798-5938820 ATCTTTTAAAGGAGGGAGGGAGG + Intronic
1143664958 17:8352204-8352226 GTGTTTTTGGAGATGGTGGGGGG + Intergenic
1143784069 17:9243881-9243903 TTTTTTTGGGGGGGGGTGGGGGG + Exonic
1144121394 17:12157328-12157350 ATCTATCAGGGGAGGGAGGGGGG - Intergenic
1145291202 17:21547607-21547629 TTCTTCTAGGGGAGGGGGCGGGG + Intronic
1146375230 17:32289287-32289309 GTTGTTTTGGGGTGGGTGGGGGG - Intronic
1146912646 17:36658323-36658345 TTCTCTCAGGAGAGGGTGGGCGG + Intergenic
1146990279 17:37264510-37264532 GTCTTTTATAGGGGGGAGGGTGG + Intronic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147498921 17:40943456-40943478 GCCTTTCAGGGGAGGGCGGGTGG - Intergenic
1147846469 17:43407359-43407381 ATCCTTTGGAGGAGGGTGGGGGG + Intergenic
1148379863 17:47188690-47188712 GTCTTGTATGAGAGGGTGGAGGG - Intronic
1148389345 17:47259332-47259354 CTTTTTTTTGGGAGGGTGGGTGG + Intronic
1148615924 17:48999181-48999203 CTCTTTTCGGGGGGGGTGGGGGG + Intronic
1148789745 17:50166513-50166535 GTATTTTAGGGGAGGAAGGTGGG + Intronic
1149512786 17:57256708-57256730 GTTTTTTGGGGGTGGGGGGGCGG + Exonic
1149567759 17:57651995-57652017 GTCTTTGTGTGGAGGGCGGGGGG + Intronic
1149571987 17:57678578-57678600 CTCTTCCAGGGGAGGGAGGGAGG - Intronic
1150466359 17:65396039-65396061 CTCTTTGAGGGGAGGGTTAGTGG + Intergenic
1151026357 17:70682132-70682154 TTCTTTTTTGGCAGGGTGGGGGG - Intergenic
1151085699 17:71378132-71378154 GTCTTTTAGGAGAGTGCGAGGGG + Intergenic
1151376057 17:73689886-73689908 GTCATTTAGGGGAGGGTGTTAGG + Intergenic
1151585359 17:75005167-75005189 GCATTTTATGGGAGGGAGGGAGG - Exonic
1152188891 17:78876180-78876202 ATATTTTAGGGGAGGGCAGGGGG - Intronic
1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152784137 17:82239293-82239315 GACTTTAATGGGAGGGTGGGTGG + Exonic
1152787402 17:82255857-82255879 GTCTTCTAGGGCAGGGGGGCAGG + Intronic
1153724649 18:7942533-7942555 GGCCTTTAGGGGAGGATGGAGGG + Intronic
1155889282 18:31246644-31246666 GGGTTGTCGGGGAGGGTGGGAGG - Intergenic
1156158649 18:34332932-34332954 CTCTTTTAGGGCAGGCTGGGTGG - Intergenic
1156505038 18:37585108-37585130 GTGTGTGAGGGCAGGGTGGGAGG + Intergenic
1156553638 18:38043752-38043774 TTTTTTTGGGGGGGGGTGGGTGG - Intergenic
1156843243 18:41633570-41633592 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1157208033 18:45717218-45717240 CTCTTTGAGGAGATGGTGGGGGG - Intergenic
1157215103 18:45775890-45775912 TTCTTGAAGGGGAGGGAGGGAGG + Intergenic
1157865036 18:51175431-51175453 GTAATTTAGGGGAGGGAGGAGGG - Exonic
1157907413 18:51581738-51581760 GTCTTTCAGAGGATGGAGGGTGG - Intergenic
1158032268 18:52980085-52980107 GCCTTACAGGGGAGGTTGGGAGG + Intronic
1158263985 18:55639743-55639765 TACTGTTAGGGAAGGGTGGGAGG - Intronic
1158858396 18:61567482-61567504 GGCCTGTTGGGGAGGGTGGGAGG - Intergenic
1159632903 18:70769312-70769334 GGCTTTTGGGGGAGGGTGGATGG + Intergenic
1159960019 18:74548013-74548035 GTCTTTTCGGCGGGGGTAGGCGG - Intronic
1160517303 18:79485603-79485625 GACTTTTAGGGAGGGCTGGGTGG + Intronic
1161638700 19:5406046-5406068 GTCTTTTAGGCCACGGTGGAGGG - Intergenic
1162140076 19:8580437-8580459 GTCTGCTATGGGAGGGGGGGGGG - Exonic
1162530160 19:11231292-11231314 GTCAGCTAGGGAAGGGTGGGTGG - Intronic
1162646144 19:12051940-12051962 GTCTTTTGGGGAAGGGGGCGGGG + Intronic
1163124519 19:15237818-15237840 GGCTTGTGGGGGAGGGTCGGGGG + Exonic
1163401160 19:17093677-17093699 GTTTTTTTGCGGGGGGTGGGGGG + Intronic
1163571602 19:18085339-18085361 GGCTCTCAGGGGTGGGTGGGTGG - Intronic
1164284518 19:23801237-23801259 TTTTTTTAGGGGAGGGTTGGGGG + Intronic
1164901536 19:31930245-31930267 GTAAGTCAGGGGAGGGTGGGGGG + Intergenic
1165380921 19:35479551-35479573 TGCTTTTAGAGGAGGGAGGGGGG - Intergenic
1165573111 19:36791968-36791990 GGCTTTGAGGGGCAGGTGGGCGG - Intergenic
1165632435 19:37312976-37312998 GGCTTTGAGGGGCAGGTGGGCGG - Intronic
1165660042 19:37570105-37570127 GTCTTTTAGGGGAGGGTGGGTGG - Intronic
1165980446 19:39718119-39718141 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1166429924 19:42716119-42716141 GTCTTTTAGGGCAGGTCTGGTGG - Intronic
1166433606 19:42748122-42748144 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
1166436709 19:42773263-42773285 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
1166440521 19:42810370-42810392 GTCTTTTAGGGCAGGCCTGGTGG - Intronic
1166613788 19:44224944-44224966 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
1167351388 19:48977099-48977121 TTCTTTTGGGGGTGGGTGGGGGG + Intronic
1167529833 19:50008407-50008429 TGCCTTTAGGGGATGGTGGGTGG - Intronic
1167636656 19:50659560-50659582 GTCTTCCAAGGGGGGGTGGGAGG - Intronic
925241341 2:2332431-2332453 TTCTTTTGGGACAGGGTGGGGGG + Intergenic
925343557 2:3153545-3153567 GACTTGCAGGGAAGGGTGGGAGG + Intergenic
925470904 2:4159641-4159663 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
926402202 2:12508995-12509017 GCCTGTTGGGGAAGGGTGGGTGG - Intergenic
926411697 2:12609801-12609823 TTCTTTTTTGGGGGGGTGGGGGG - Intergenic
926772900 2:16393885-16393907 ATCTTCTTGGGGAGGGTTGGGGG + Intergenic
927035910 2:19176227-19176249 GGTGTTTATGGGAGGGTGGGTGG - Intergenic
927132584 2:20073061-20073083 CTCTTTTACGTGAGGGTGGCAGG - Intergenic
927284075 2:21337879-21337901 CTCTTTTAGGGCAGGCTTGGAGG - Intergenic
927525747 2:23738514-23738536 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
927895167 2:26776785-26776807 GTCTCTCAGGGCAGGGAGGGTGG + Intronic
928890176 2:36195710-36195732 GTCTCCCAGGTGAGGGTGGGAGG + Intergenic
928957844 2:36889611-36889633 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
929250527 2:39749755-39749777 GTCTGTCAGGGGGAGGTGGGAGG - Intronic
929300770 2:40301583-40301605 GACTTGGAGGGAAGGGTGGGAGG + Intronic
929318555 2:40511973-40511995 GTATTTTAGGCTAGGGTAGGTGG - Intronic
929817935 2:45250589-45250611 GCCTTTTAAAAGAGGGTGGGAGG + Intergenic
930446113 2:51474406-51474428 GACTTGGAGGGAAGGGTGGGAGG + Intergenic
931201618 2:60103178-60103200 TTTTTTTGGGGGGGGGTGGGGGG + Intergenic
932934515 2:76086572-76086594 TTTTTTTGGGGGGGGGTGGGGGG - Intergenic
933610378 2:84428225-84428247 GCATTTGTGGGGAGGGTGGGAGG - Intronic
933723441 2:85412544-85412566 GTAGTTTGGTGGAGGGTGGGAGG + Intronic
934021567 2:87960047-87960069 TTCTTTTTGGGGGGGCTGGGGGG + Intergenic
935811940 2:106807006-106807028 GTTTTTTGGGGGAGGGGTGGTGG + Intronic
936467857 2:112769474-112769496 TTCTTTTCTGGGAGGGTTGGGGG - Intergenic
936957967 2:118042082-118042104 GACTTGGAGGGGAGGTTGGGAGG - Intergenic
937426785 2:121806603-121806625 GTCCTTTATGAGAGGGAGGGAGG + Intergenic
937556582 2:123165499-123165521 TTTTTTTCGGGGGGGGTGGGGGG + Intergenic
938372997 2:130785499-130785521 GTCATTTTTGGGTGGGTGGGTGG - Intergenic
938704668 2:133912309-133912331 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
939096730 2:137840866-137840888 GTCTTGTGGGGGAGGGTGGGAGG + Intergenic
939258788 2:139780123-139780145 GTCTTTTGGAGGATGGAGGGTGG - Intergenic
940347893 2:152646337-152646359 CTCTTTTCTGGGGGGGTGGGCGG - Intronic
941534549 2:166706907-166706929 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
942444567 2:176069547-176069569 GCGGTTTAGGGCAGGGTGGGAGG - Intergenic
942818523 2:180081778-180081800 GTCTTTTGGGGGAAGATGGATGG - Intergenic
943059044 2:183018537-183018559 GTGTTTTAGGGGTGGGGTGGTGG - Intronic
943509630 2:188808518-188808540 GCCTGTTGGGGGAGGGTTGGGGG + Intergenic
944304529 2:198164500-198164522 GTTTTTTTGGCGGGGGTGGGAGG - Intronic
944330741 2:198463313-198463335 GTCTTTTAAGGGAAAATGGGTGG - Intronic
944889469 2:204102377-204102399 CTATTTTAGGGGAGGAAGGGTGG + Intergenic
945691412 2:213041332-213041354 CTTTTTTTGGGGGGGGTGGGAGG + Intronic
946158470 2:217821999-217822021 GTGTTCCAGGGGAGGTTGGGGGG - Intronic
946549310 2:220783136-220783158 TTCTGTTAGGGGAGGGTTGTTGG + Intergenic
947806943 2:232975649-232975671 GTCTTTGTGGGGAGGGAGGTGGG - Intronic
948178686 2:235963073-235963095 GTCTCTTAGAGGAAGGTGGGTGG + Intronic
1168901583 20:1369490-1369512 GGGTTTAAGGGGAGGGTGGGTGG + Exonic
1169041957 20:2502777-2502799 GTCTTTTAGGGCAGGCCTGGTGG - Intronic
1169152660 20:3302505-3302527 GTATTTTAGGGGATGGGGAGGGG - Intronic
1169157144 20:3341339-3341361 TTCTTGCAGTGGAGGGTGGGAGG - Intronic
1169516907 20:6326855-6326877 GACTTTTGGGGAAGAGTGGGGGG - Intergenic
1169703943 20:8481110-8481132 TTCTTTTTTGGGAGGGTGGGGGG - Intronic
1169801300 20:9515046-9515068 TTCTTTTAGGGGAGGAGGGAGGG + Intronic
1170049593 20:12127877-12127899 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1170090463 20:12584335-12584357 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1170097634 20:12664100-12664122 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1170573044 20:17643085-17643107 GTCTTGTAGGGGAGGTAGAGAGG + Exonic
1170658426 20:18313422-18313444 TTCTTATAAGGGTGGGTGGGAGG + Intronic
1171466509 20:25331770-25331792 GTCTTTTAGGGCAGGCCTGGTGG - Intronic
1171996417 20:31735250-31735272 TTTTTTTAGTGGAGGGTTGGGGG + Intergenic
1172601689 20:36188270-36188292 GTGTTTTCGGGGTGGGTGGTAGG + Intronic
1173536333 20:43816289-43816311 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1173623155 20:44451744-44451766 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
1173983756 20:47245055-47245077 GCTTTTTTGGGGAGGGGGGGCGG - Intronic
1175157497 20:56981421-56981443 GTATTTTAGGGAAGGGAAGGAGG - Intergenic
1175771427 20:61627061-61627083 GTGTTTTGGAGGAGGGTGGGTGG + Intronic
1176267577 20:64218630-64218652 GTCCCCTAGAGGAGGGTGGGTGG + Intronic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1176669635 21:9720904-9720926 TTTTTTTGGGGGGGGGTGGGAGG + Intergenic
1177170585 21:17651300-17651322 GTCTTCTAGGGGGTGCTGGGAGG + Intergenic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1177914200 21:27067983-27068005 CTATTTGAGGGGAGGGTGGGGGG + Intergenic
1177935571 21:27341087-27341109 GTATTTAAGGGGAGGAAGGGAGG + Intergenic
1178899939 21:36590915-36590937 GACTTGAGGGGGAGGGTGGGAGG - Intergenic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1180181755 21:46121306-46121328 GTCCTTCAGGGCAGGATGGGGGG - Intronic
1180794062 22:18593295-18593317 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181227677 22:21402025-21402047 GGCTTTATGGGGAGGGTGGATGG - Intergenic
1181250974 22:21532814-21532836 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181366713 22:22381946-22381968 GGCCATTAGGGGAGGGAGGGAGG - Intergenic
1181385146 22:22539487-22539509 GCCTTTTACGGGAGGGTAGGAGG - Intergenic
1181756593 22:25028801-25028823 GTCTTCTCGGGAGGGGTGGGTGG - Exonic
1182712839 22:32333300-32333322 GTCTTTTAGAGGATGGGGAGAGG + Intergenic
1182836745 22:33348274-33348296 TTTTTTTGGGGGGGGGTGGGTGG - Intronic
1182908473 22:33959056-33959078 TTCTTTTGGGGGGGGTTGGGGGG + Intergenic
1184074761 22:42169288-42169310 TTCCTTTAGGAAAGGGTGGGAGG - Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
949101436 3:150516-150538 GTCTGTTGGGGGCGGGTGGGTGG - Intergenic
950042818 3:9931138-9931160 GTCTTCTAGGGGTGGGGCGGGGG - Intronic
950667555 3:14506391-14506413 GTCTTGTAGGCTGGGGTGGGAGG + Intronic
950998239 3:17528048-17528070 GTTTTTTAGGGGGGGCTGGGAGG + Intronic
951463450 3:22976488-22976510 GACTTTGGGGGAAGGGTGGGAGG + Intergenic
952280665 3:31920143-31920165 GTGGTTTAGGGGAGGAAGGGAGG + Intronic
952291762 3:32023571-32023593 TTCTTTTAGGGGCTTGTGGGTGG - Intronic
952709313 3:36413851-36413873 CTCTTTTAGGGCAGGGCTGGTGG + Intronic
953555576 3:43944188-43944210 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
954645590 3:52129678-52129700 GTCTTTCAAGGGAGGGAGGGAGG - Intronic
955282272 3:57604610-57604632 TTTTTTTTGGGGGGGGTGGGTGG + Intergenic
955427638 3:58808529-58808551 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
955496735 3:59541323-59541345 GTATATTGGGGGAGGGTGGTGGG + Intergenic
955762473 3:62302432-62302454 ATTTTTTTGGGGGGGGTGGGAGG - Intergenic
955890729 3:63647145-63647167 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
957065493 3:75518727-75518749 GTTTTTTTGGGGGGGGCGGGGGG - Intergenic
957086415 3:75682987-75683009 GGCTTTTATGGGAGGTTGGTAGG + Intergenic
957433052 3:80138668-80138690 GTCTTTTATGGGAACGTGGATGG + Intergenic
957763936 3:84596375-84596397 GACTTTGGGGGAAGGGTGGGAGG - Intergenic
957806497 3:85154904-85154926 CTCTTTTAGGGCAGGCCGGGTGG - Intronic
957815472 3:85291753-85291775 CTCTTTTAGGGCAGGCCGGGTGG - Intronic
958037526 3:88187925-88187947 GCCTTTTGGGGGTGGGTGGAGGG + Intergenic
958652298 3:96952857-96952879 GTCTGTCTGTGGAGGGTGGGAGG + Intronic
958721841 3:97853160-97853182 GACTTTGGGGGGAGGGTGGGAGG - Intronic
958878135 3:99638551-99638573 GGCTTTTATGGGCAGGTGGGAGG - Exonic
959326739 3:104946321-104946343 GTCTTTTAAGGGAACGTGGATGG - Intergenic
959504881 3:107146045-107146067 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
959522475 3:107335668-107335690 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
959553967 3:107696374-107696396 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
959835639 3:110915615-110915637 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
960187664 3:114663353-114663375 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
960324298 3:116276515-116276537 GACTTGCAGGGAAGGGTGGGAGG + Intronic
960546082 3:118916071-118916093 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
960857162 3:122113961-122113983 GTCTTTTAGGCCAGGGGTGGTGG + Intronic
960899975 3:122544521-122544543 TTCTTTTAGTGGAGTTTGGGTGG - Intronic
960907975 3:122620721-122620743 GCCTGGGAGGGGAGGGTGGGAGG + Intronic
960954649 3:123023630-123023652 GGGTTTTGGGGGAGGGTGAGAGG - Intronic
961482580 3:127193507-127193529 GGCTTTTAGGGGAGGGGCTGGGG - Intronic
961558739 3:127714402-127714424 CTCCTTTAGGGGAGCGAGGGTGG - Intronic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961852665 3:129837263-129837285 GTCAGTTAGTGGAGGGTGAGGGG - Intronic
962304689 3:134275353-134275375 GTCTTTTATGGGAACATGGGTGG + Intergenic
962627729 3:137243402-137243424 GTGTTTTAGGGGAGGGGGTGCGG - Intergenic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963820156 3:149882268-149882290 GTGCTTTCGTGGAGGGTGGGTGG + Intronic
964416185 3:156450857-156450879 TTTTTTTGGGGGGGGGTGGGTGG - Intronic
965183131 3:165430214-165430236 GTCTTGGAGGGAAGAGTGGGAGG - Intergenic
965382388 3:168005947-168005969 GTGTTTCCGGGGAGGGTAGGTGG + Intergenic
965653272 3:170955742-170955764 GTCTGTTGGAGGAGGGTGGTGGG - Intergenic
967323784 3:188219060-188219082 GGCTTTTAGGGGCGGGGTGGGGG + Intronic
967483803 3:190006609-190006631 AGCTTTTAGGGCAGAGTGGGTGG + Intronic
967864588 3:194179807-194179829 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
968775761 4:2538670-2538692 GTCGGGTAGGGGAGGGCGGGGGG + Intronic
969165159 4:5302753-5302775 GGCTTTGAGGGAAGGGTGGGAGG - Intronic
969194399 4:5548997-5549019 GTCTATTCAGGGAGGGAGGGAGG - Intronic
970286858 4:14527412-14527434 GCCTGTTTGGGGAGGGTGGCAGG + Intergenic
970391824 4:15619814-15619836 TACTTTTTTGGGAGGGTGGGGGG - Intronic
970724475 4:19027890-19027912 GACTACTAGGGGAGGGAGGGAGG + Intergenic
971677955 4:29659330-29659352 GTGCTTTTGGGGAGGGTGGGAGG - Intergenic
972620904 4:40747648-40747670 GTATTTGAGGGGAGGGTCAGAGG - Intergenic
972951099 4:44323494-44323516 TTTTTTTGGGGGGGGGTGGGTGG - Intronic
972998448 4:44913528-44913550 CACTTTTAGGGGAGGCTGGCAGG - Intergenic
973679336 4:53299913-53299935 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
974097476 4:57380257-57380279 GTCTTAGGGGGAAGGGTGGGAGG + Intergenic
974133299 4:57783482-57783504 GTCTTGAGGGGAAGGGTGGGAGG - Intergenic
974673002 4:65056342-65056364 GTCTTTTAGGGCAGGCCTGGCGG + Intergenic
974830143 4:67178863-67178885 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
976180087 4:82390767-82390789 GTCTTTTAGTGCAGGGTGCTTGG - Intergenic
976574591 4:86655418-86655440 CTCTTTTAGGGCAGGCTTGGTGG + Intronic
976612827 4:87047382-87047404 CTTTTTGAGGGGAGGGAGGGAGG - Exonic
976682353 4:87771035-87771057 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
978607169 4:110493527-110493549 GTCTTCTATGGAAGGGTTGGAGG - Intronic
978738436 4:112110583-112110605 CTCTTGTTGGGGAAGGTGGGAGG + Intergenic
978917390 4:114144060-114144082 CTCTATTAGGGCAGTGTGGGAGG + Intergenic
978954143 4:114594905-114594927 GTCTTTTAATGTAGGGTGGCTGG - Intergenic
979116676 4:116832889-116832911 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
979381596 4:120012798-120012820 GACTTTTGGGGAAGAGTGGGAGG - Intergenic
979878340 4:125922625-125922647 GTCTTTTATGGGAACGTGGATGG - Intergenic
980781595 4:137498093-137498115 CTCTTTTAGGGGAGGTCTGGTGG - Intergenic
982767721 4:159367432-159367454 TTTTTTTAGGGCAGGGTGGGTGG - Intergenic
983532183 4:168822270-168822292 TTCTTTTTGGGGAGGGGGTGGGG + Intronic
983546531 4:168970636-168970658 GCCTTGCAGGGAAGGGTGGGAGG - Intronic
983941551 4:173538511-173538533 GTCTGGGAGGTGAGGGTGGGAGG - Intergenic
983963999 4:173787858-173787880 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
983981372 4:174001371-174001393 GTCTGGTAGTGGAGGGTGAGTGG - Intergenic
984438472 4:179734646-179734668 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
984711524 4:182889393-182889415 GTCTTTGAGGGGAGGTTGACAGG - Intergenic
985161227 4:187047010-187047032 GGGTTTTTGGGGAGGGAGGGAGG + Intergenic
985618724 5:940758-940780 GCCTGTCTGGGGAGGGTGGGTGG - Intergenic
985904842 5:2825525-2825547 GGCATTTTGGGGAGGATGGGAGG - Intergenic
986846019 5:11754421-11754443 GTTTTTTGGGGGAGGGGGCGGGG + Intronic
988174811 5:27708468-27708490 GACATTTTGGGGAGGGTGTGAGG + Intergenic
989056559 5:37371273-37371295 GTTATTTAGGGAAGGGAGGGAGG + Intergenic
989269936 5:39521111-39521133 GTCTATTAGAGGATAGTGGGTGG - Intergenic
989533312 5:42533828-42533850 GACTTTGGGGGAAGGGTGGGAGG - Intronic
989942704 5:50172969-50172991 CTCTTTTAGGGCAGGGCTGGTGG + Intergenic
989972637 5:50543025-50543047 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
990906654 5:60810789-60810811 TTCTTGTAGGGTAGGGTGGAAGG + Intronic
992024361 5:72655980-72656002 TTCTTGGAGGGGAGGGAGGGAGG - Intergenic
992576653 5:78120156-78120178 CTCTTTTAGGGCAGGCCGGGTGG - Intronic
993308187 5:86295827-86295849 GTCTTCTAGGGAGGAGTGGGAGG - Intergenic
993562442 5:89427661-89427683 GCCTTTTAAGGGAGTGAGGGTGG - Intergenic
993927851 5:93893343-93893365 GCATTTTGGGGGAGGGTAGGGGG - Intronic
993978108 5:94507449-94507471 GTTTTTTTGGGGGGGGCGGGGGG - Intronic
994230394 5:97305147-97305169 GTCTTGTAGGGCAGGGCTGGTGG + Intergenic
994729847 5:103479002-103479024 GTTTTTTGGGGGCAGGTGGGGGG - Intergenic
994806155 5:104450556-104450578 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
994910425 5:105898457-105898479 GTTTTATTGGGGAGGATGGGAGG + Intergenic
995134459 5:108665974-108665996 GACTTTGGGGGGAAGGTGGGAGG - Intergenic
995464085 5:112432912-112432934 GTCTTTTAGTGCAGGGTGTTTGG + Intergenic
995663916 5:114519694-114519716 CTCTACTGGGGGAGGGTGGGTGG - Intergenic
996002896 5:118384920-118384942 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
996394445 5:122999040-122999062 GTCTTTTAGAAGAGGGGGAGGGG + Intronic
997152795 5:131517110-131517132 GTCTATTAGGGCAGGGAGAGAGG + Intronic
997155296 5:131549866-131549888 GCATTTTGGTGGAGGGTGGGAGG - Intronic
997345145 5:133184898-133184920 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
997578468 5:135002139-135002161 CTCTTTTAGGGGAGGCCTGGTGG + Intronic
997579530 5:135008581-135008603 GTCTTTCTGGGAAGGTTGGGAGG + Intronic
997677901 5:135727953-135727975 GTCTTTTAAGGGAACGTGGCTGG + Intergenic
997795552 5:136806387-136806409 GACATATAGGGGAGGGGGGGAGG + Intergenic
998048362 5:139009639-139009661 CTCTTTTAGGGGAGGTCTGGTGG + Intronic
998289756 5:140902712-140902734 GACTTGGAGGGAAGGGTGGGAGG - Intronic
998311096 5:141133126-141133148 GGGTTCTAGGGGAGGGAGGGAGG + Intronic
998856899 5:146402462-146402484 GTCTTTTTTGGGGGGGAGGGGGG - Intergenic
1000173055 5:158722866-158722888 GTCTTTAAGGGGAGGATGTTGGG + Intronic
1001267866 5:170288149-170288171 GCCTACTTGGGGAGGGTGGGTGG - Intronic
1001275197 5:170345550-170345572 GTCTTTTAGGGAAGGAGGTGGGG + Intergenic
1001292352 5:170472579-170472601 GACTTGGGGGGGAGGGTGGGAGG - Intronic
1001376203 5:171261076-171261098 TTTTTTTTGGGGGGGGTGGGGGG - Intronic
1001713010 5:173793106-173793128 GTCTTGTGGGTGGGGGTGGGTGG + Intergenic
1001737480 5:174018563-174018585 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1002078647 5:176724904-176724926 GCCTTTGTGGTGAGGGTGGGTGG + Intergenic
1002466748 5:179412211-179412233 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002466807 5:179412347-179412369 GTCATTGGGGGGAGGGTGGAAGG - Intergenic
1002466898 5:179412554-179412576 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002467038 5:179412876-179412898 GTCATTGGGGGGAGGGTGGAAGG - Intergenic
1003633404 6:7809102-7809124 TTTTTTTGGGGGGGGGTGGGGGG - Intronic
1005221956 6:23597274-23597296 GCCTGTTGGGGGCGGGTGGGGGG - Intergenic
1005327809 6:24720015-24720037 TTTTTTGGGGGGAGGGTGGGTGG - Exonic
1005341193 6:24845340-24845362 ATCTTTTAGGGGAGGGATGAAGG + Intronic
1005379498 6:25218580-25218602 GTCTTCGCGGGGCGGGTGGGGGG - Intergenic
1005760980 6:28968006-28968028 GACTTTGGGGGAAGGGTGGGAGG + Intergenic
1006044118 6:31280008-31280030 GGCCTTTTGGGGAGTGTGGGGGG + Intronic
1007367955 6:41407716-41407738 ACCTTTTAGGGGAGGGAGGGAGG + Intergenic
1008087614 6:47261095-47261117 GTCTTTTAGGGAGGTTTGGGGGG - Intronic
1010134921 6:72540424-72540446 GTCTTGTGGGGGTGGGGGGGTGG - Intergenic
1010703013 6:79075571-79075593 ATTTTTGGGGGGAGGGTGGGGGG - Intronic
1010957180 6:82103127-82103149 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1010966795 6:82219569-82219591 GTTTTTGAGGGGTGGGAGGGTGG - Intronic
1011184660 6:84660961-84660983 ATTTTTGAGAGGAGGGTGGGAGG + Intergenic
1011244620 6:85308994-85309016 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1011358355 6:86496283-86496305 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1012457763 6:99426053-99426075 GACTTTTAGGGAACCGTGGGGGG + Intergenic
1012576484 6:100807293-100807315 TTTTTTGAGGGGAGGGAGGGTGG - Intronic
1013999998 6:116354431-116354453 TTATTTTAAGGGAGAGTGGGTGG + Intronic
1014989283 6:128053672-128053694 GTCTTCATGGGGACGGTGGGTGG - Intronic
1015000663 6:128210443-128210465 GTATTTTTGGGGAGGGGGGGTGG + Intronic
1015191569 6:130477467-130477489 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1015238375 6:130995886-130995908 GAATTTTAGGGGACAGTGGGAGG - Intronic
1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG + Intergenic
1016529353 6:145040532-145040554 ATCTTTGGGGGGGGGGTGGGGGG + Intergenic
1016584094 6:145663979-145664001 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1016648531 6:146437856-146437878 GTCTTTTTGATGAGGGTGTGAGG + Intergenic
1017267691 6:152469082-152469104 CTTTTTTGGGGGAGTGTGGGGGG + Intronic
1017471280 6:154739162-154739184 TTTTTGTAGGGAAGGGTGGGGGG + Intronic
1017901083 6:158718949-158718971 GTCCTTTAGGCGAGGGTGTGAGG + Intronic
1018205869 6:161436454-161436476 CTTTTTTGGGGGGGGGTGGGCGG + Intronic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1018583671 6:165332936-165332958 CTTTTTTTGGGGGGGGTGGGGGG - Exonic
1019888787 7:3928623-3928645 TTTTTTTTGGGGGGGGTGGGTGG + Intronic
1020356135 7:7277822-7277844 CTCTTCTGGGGTAGGGTGGGAGG - Intergenic
1020808758 7:12825287-12825309 GTCTACTAGAGGAGGGAGGGTGG + Intergenic
1021594403 7:22299779-22299801 GTCTTTAAGGTGGGGGAGGGTGG - Intronic
1021802893 7:24325578-24325600 CTTTTTTGGGGGTGGGTGGGTGG - Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1023673287 7:42602813-42602835 CTCTTTTTGGGGAGGGTTGGGGG - Intergenic
1024128559 7:46326159-46326181 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
1024249316 7:47494481-47494503 GTCTTTCAGGGGAGGTGGAGTGG - Intronic
1024406055 7:48981936-48981958 TTCATTTGGGGGAGGGTGGGGGG + Intergenic
1024610443 7:51059637-51059659 GTCAGGTAGGGGTGGGTGGGAGG + Intronic
1024725719 7:52191756-52191778 GTTTCTTAGGGCTGGGTGGGAGG + Intergenic
1026218122 7:68367688-68367710 CTCTTCTAGGGAAGGGAGGGAGG - Intergenic
1026577838 7:71588885-71588907 GTAATTTGGGGGAGGGAGGGTGG - Intronic
1027493475 7:78859416-78859438 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
1027496135 7:78889693-78889715 GTCTTTTAGGGCAGGCCTGGTGG - Intronic
1027519548 7:79188276-79188298 GTCTGTTGGGGGAGGCGGGGTGG - Intronic
1027690354 7:81337443-81337465 TTCTTTTTGGGGGGGATGGGGGG + Intergenic
1028253684 7:88565948-88565970 GTCTTTGGGGGGGGGGGGGGGGG + Intergenic
1029148525 7:98464029-98464051 GTCTCCTTGGGGAGGGTTGGAGG + Intergenic
1029493552 7:100885105-100885127 GACATTGACGGGAGGGTGGGTGG + Intronic
1030884508 7:114922044-114922066 GACTTTTTGGGCGGGGTGGGGGG + Intergenic
1031993203 7:128211125-128211147 GGCCTTTCGGGGAGGGAGGGAGG + Intergenic
1032073819 7:128826698-128826720 TGCTTTTGGGGCAGGGTGGGTGG + Intergenic
1032595837 7:133238997-133239019 TTTTTTTGGGGGGGGGTGGGGGG - Intergenic
1033157745 7:138971301-138971323 GTCTATTGGTGGAGGGTGGGAGG - Intronic
1033433515 7:141311140-141311162 GCCTGTTGGGGGATGGTGGGAGG + Intronic
1033856085 7:145562732-145562754 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1033917849 7:146349645-146349667 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
1033960542 7:146907615-146907637 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1034231392 7:149531450-149531472 CTTTTTTTGGGGGGGGTGGGGGG - Intergenic
1034286094 7:149883981-149884003 GGTTTTTAGTGGAGGGAGGGAGG + Intergenic
1034686491 7:152975883-152975905 GTCTTGTAGGGGAGTGTGGTTGG + Intergenic
1035886042 8:3293003-3293025 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
1035921294 8:3678999-3679021 GTCTTTTAGGGGAGGTCTGGTGG - Intronic
1035973788 8:4284372-4284394 CTCTTTTTGGGGAGGGTGGGTGG - Intronic
1037748215 8:21663016-21663038 GCTTGGTAGGGGAGGGTGGGGGG - Intergenic
1037824288 8:22151742-22151764 GTGTTGTGGGGCAGGGTGGGGGG + Intronic
1038056179 8:23860043-23860065 ATCTTCCAGGGGAGTGTGGGAGG + Intergenic
1038511393 8:28139185-28139207 GTCCTCTAGGGGTGGGTTGGGGG + Intronic
1038576038 8:28703614-28703636 GTCTTCTGGAGGAGGGTGGGAGG + Intronic
1038839455 8:31168511-31168533 GTATTTTGGGGGGGGTTGGGTGG + Intronic
1039016960 8:33160446-33160468 GACTTTTAGGGGGAGGTAGGAGG - Intergenic
1039023226 8:33229905-33229927 GTTTTTTATGGAAGGGTGCGAGG + Intergenic
1039207681 8:35175659-35175681 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1039238776 8:35532223-35532245 GTCTTTTAGGGCAGGCCTGGTGG + Intronic
1039300003 8:36199435-36199457 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1040398306 8:47020554-47020576 GTCTTTTAGGGCAGGACTGGTGG - Intergenic
1040592290 8:48804870-48804892 GCCTTGTAGGGGAGGGTGGAGGG - Intergenic
1041193408 8:55375878-55375900 GCCTGTTAGGGGAGGGTGTGGGG - Intronic
1041595622 8:59647480-59647502 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1041905661 8:63031075-63031097 TTCTTTTAGGGCAGGTTGAGAGG - Intronic
1042115650 8:65428305-65428327 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1042161862 8:65904859-65904881 CTCTTCTAGGGCAGTGTGGGAGG + Intergenic
1042695353 8:71548365-71548387 GTCCTGAAGGGGAGGATGGGTGG + Intronic
1042774160 8:72411155-72411177 GCCTGTTAGGGGAGGGCAGGTGG + Intergenic
1043056312 8:75444243-75444265 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1043296385 8:78668164-78668186 ATCTCTTAGGGGAGGGAGAGGGG - Intronic
1043937143 8:86155154-86155176 GTCCTTCACGGGGGGGTGGGGGG + Intergenic
1044183168 8:89220141-89220163 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1044195893 8:89375867-89375889 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1044279009 8:90335126-90335148 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1044430368 8:92101629-92101651 GCCTTTTGGGGGAGAGGGGGAGG + Intronic
1044726114 8:95195523-95195545 GCCAATTAGGGGAGGGTGAGGGG + Intergenic
1045308637 8:100981313-100981335 ATTTTGTGGGGGAGGGTGGGTGG - Intergenic
1045728159 8:105200453-105200475 GCCTGTCAGGAGAGGGTGGGTGG - Intronic
1047837588 8:128711248-128711270 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1047838119 8:128716184-128716206 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1047841848 8:128761808-128761830 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1048114174 8:131502342-131502364 GTTTTTTTGGGGGGGATGGGGGG - Intergenic
1048209844 8:132445660-132445682 GTTTTTTTGGGGTGGGTGGGTGG - Intronic
1049272537 8:141703543-141703565 GGCTTTTTGGGGAGAGGGGGTGG + Intergenic
1049556460 8:143284825-143284847 ATCTTTGAGGGCAGGGAGGGTGG - Intergenic
1050015215 9:1225699-1225721 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1050021452 9:1288546-1288568 GTCTTACAGGGGAGGGGTGGGGG - Intergenic
1050250361 9:3737179-3737201 GTCTTTTAGCAGAGGGTGGATGG + Intergenic
1050387952 9:5110825-5110847 GTTTGTTCGGGGAAGGTGGGGGG + Intronic
1051514913 9:17919485-17919507 GTTGTTTAGGCTAGGGTGGGAGG - Intergenic
1051669442 9:19495085-19495107 GTCATTAAGGGGAGGGTGTTAGG - Intergenic
1051759288 9:20443182-20443204 GTTTTTTATGGGATGGTGGTAGG - Intronic
1051918463 9:22235434-22235456 GTCTTTTGGAGGATGGAGGGTGG + Intergenic
1052062906 9:23983061-23983083 GTGTTTTAGGGGCAAGTGGGTGG + Intergenic
1052377073 9:27729565-27729587 GTCTTCTGGGGGGGGGTCGGTGG + Intergenic
1052594587 9:30541272-30541294 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1053739531 9:41124828-41124850 GTCGTTGCGGGGGGGGTGGGGGG + Intergenic
1053792510 9:41696851-41696873 GAGTTGTGGGGGAGGGTGGGTGG - Intergenic
1054152661 9:61617969-61617991 GAGTTGTGGGGGAGGGTGGGTGG + Intergenic
1054180923 9:61908872-61908894 GAGTTGTGGGGGAGGGTGGGTGG - Intergenic
1054656668 9:67672270-67672292 GAGTTGTGGGGGAGGGTGGGTGG + Intergenic
1055860643 9:80745843-80745865 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1055899599 9:81219111-81219133 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1056104350 9:83332398-83332420 GTTCTTTGGGGGATGGTGGGGGG - Intronic
1056295009 9:85183998-85184020 GTCTTTTATGGGAACATGGGTGG - Intergenic
1056880444 9:90386868-90386890 GCCCTTTAAGGGAGTGTGGGTGG - Intergenic
1057158175 9:92863258-92863280 GCCTGTTGGGGAAGGGTGGGGGG + Intronic
1058091380 9:100809624-100809646 GTCTGTCAGGGGAGGGCAGGGGG - Intergenic
1058224145 9:102339170-102339192 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1059284627 9:113161983-113162005 GAGATTTGGGGGAGGGTGGGTGG - Intronic
1059368894 9:113808959-113808981 GTCTTTTAGATTAGGATGGGTGG + Intergenic
1060027476 9:120185291-120185313 GTCTTTGAAGGGAGAGTTGGGGG - Intergenic
1060071673 9:120555129-120555151 TTTTTTTGGGGGGGGGTGGGGGG + Intronic
1061237106 9:129349586-129349608 CTTCTTCAGGGGAGGGTGGGTGG + Intergenic
1062088419 9:134661017-134661039 TTCTTTTAGGGGAGGATGGAAGG + Intronic
1062325644 9:136011219-136011241 CCCTTCTTGGGGAGGGTGGGAGG - Exonic
1062326320 9:136014221-136014243 GGCTCGTTGGGGAGGGTGGGGGG - Intronic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1185795725 X:2962631-2962653 GCCTTTTCGGGGATGCTGGGAGG + Intronic
1186061872 X:5717836-5717858 ATTTTTTGGGGGAGGGGGGGTGG - Intergenic
1186080864 X:5930401-5930423 TTGCTTTAGGGGAGGGTGTGAGG - Intronic
1187605723 X:20880558-20880580 GCCTATTGGGGGAGAGTGGGGGG + Intergenic
1187838206 X:23457728-23457750 CTCTTTTATGGCAGGGTTGGTGG + Intergenic
1188632485 X:32382669-32382691 GTGTTGTAGGGGTGTGTGGGGGG + Intronic
1188669536 X:32866718-32866740 TTTTTTTGGGGGGGGGTGGGGGG + Intronic
1188891458 X:35615890-35615912 GTCTTTTATGGGTGGGTAGTAGG - Intergenic
1189152756 X:38725046-38725068 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1189182602 X:39018093-39018115 GGGGTTTGGGGGAGGGTGGGTGG - Intergenic
1189523126 X:41791303-41791325 GACTTTGGGGGAAGGGTGGGAGG - Intronic
1189745415 X:44163319-44163341 GTCTTTAAGAAGTGGGTGGGTGG - Intronic
1190262258 X:48804903-48804925 GTATTCTAGGCGGGGGTGGGGGG + Intronic
1190396503 X:49990400-49990422 GACTTGTGGGGAAGGGTGGGAGG - Intronic
1190720926 X:53146932-53146954 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1191125800 X:56952916-56952938 GTCTTTTAGGGGAGGCCTGGTGG + Intergenic
1191625364 X:63265253-63265275 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1191635299 X:63369374-63369396 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1191647155 X:63494054-63494076 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1191649504 X:63521078-63521100 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1191681096 X:63840592-63840614 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1191687057 X:63902850-63902872 GTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1191699049 X:64020023-64020045 GGCCTGTTGGGGAGGGTGGGGGG + Intergenic
1192071421 X:67944486-67944508 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1192136353 X:68604210-68604232 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1192155003 X:68738201-68738223 TTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1192772728 X:74209102-74209124 GTTTTTTGGGGGAGGGGTGGTGG - Intergenic
1192855161 X:75001010-75001032 TCCTTTCAGGGCAGGGTGGGTGG + Intergenic
1193004545 X:76601261-76601283 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1193009855 X:76664448-76664470 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1193033695 X:76926322-76926344 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1193059176 X:77186416-77186438 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1193824095 X:86201278-86201300 GTCTTCTTGAGGGGGGTGGGTGG + Intronic
1194156811 X:90400108-90400130 GTCTTTGCGGGGGGGGGGGGGGG + Intergenic
1194353421 X:92851316-92851338 GTAGTTGAGGGAAGGGTGGGAGG - Intergenic
1195322093 X:103728526-103728548 GTCTTGGAGGGGAGGGAGGAGGG + Exonic
1195401508 X:104465988-104466010 GACTTTGGGGGAAGGGTGGGAGG - Intergenic
1195421067 X:104676276-104676298 CTCTTTTAGGGCAGGGCTGGTGG + Intronic
1196474587 X:116068073-116068095 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
1196691748 X:118566470-118566492 ATCTTGTAGGAGAGGATGGGTGG + Intronic
1197098824 X:122627362-122627384 ATCTTTTAGGGAAGAGTTGGAGG - Intergenic
1197115202 X:122823828-122823850 GTCTGTTGGGGGTGGGTGGAAGG + Intergenic
1198808269 X:140509782-140509804 CTCTTTTTTGGGAGGGTGCGGGG + Intergenic
1199035336 X:143043492-143043514 TTTTTTTGGGGGTGGGTGGGGGG - Intergenic
1200380739 X:155834712-155834734 CTCTGTTAGGGCAGTGTGGGAGG + Intergenic
1200661779 Y:5968390-5968412 GTAGTTGAGGGAAGGGTGGGAGG - Intergenic
1200903490 Y:8457571-8457593 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
1201413443 Y:13723902-13723924 GTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1201991603 Y:20032902-20032924 TTCTTTTAGGGCAGGCTGGGTGG - Intergenic