ID: 1165665229

View in Genome Browser
Species Human (GRCh38)
Location 19:37622217-37622239
Sequence TGCCCCTCCGTGCTTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165665222_1165665229 15 Left 1165665222 19:37622179-37622201 CCCCAATAGCATGGTTGTAGCAC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1165665229 19:37622217-37622239 TGCCCCTCCGTGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 141
1165665224_1165665229 13 Left 1165665224 19:37622181-37622203 CCAATAGCATGGTTGTAGCACAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1165665229 19:37622217-37622239 TGCCCCTCCGTGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 141
1165665223_1165665229 14 Left 1165665223 19:37622180-37622202 CCCAATAGCATGGTTGTAGCACA 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1165665229 19:37622217-37622239 TGCCCCTCCGTGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165665229 Original CRISPR TGCCCCTCCGTGCTTTCCAT TGG Intronic
900301160 1:1978227-1978249 TGCCCCTCGGTGCTTTCAAAGGG - Intronic
902379679 1:16046833-16046855 TGGCCCTACCTGCTTTCCAGGGG + Intronic
909486224 1:76177576-76177598 TTCCCATCCGTGCCTTCCCTAGG + Intronic
915179416 1:154045067-154045089 TGCCCCTCCATGGTTCCCTTTGG - Intronic
923537309 1:234863156-234863178 CGCCGCTCAGTGCTTTCCCTTGG - Intergenic
1069636326 10:69927119-69927141 TGCTCCTCCTGGCTTTCCTTGGG + Intronic
1069653553 10:70070048-70070070 AGCCCCTCCTTGCTTCCCCTAGG + Intronic
1070059074 10:72964870-72964892 TGCTCTTTCGTGGTTTCCATTGG + Intergenic
1070145879 10:73772922-73772944 CGCCACTCCGCGCGTTCCATGGG - Exonic
1074837513 10:117312021-117312043 TTCCCATCAGTGCTTTACATTGG + Intronic
1075661905 10:124203212-124203234 TGCCACACAGTGCTCTCCATGGG - Intergenic
1076309128 10:129491087-129491109 TGCCCTCCAGTGCTCTCCATTGG + Intronic
1080783205 11:35449890-35449912 TGCTTTTCCTTGCTTTCCATGGG + Intronic
1086637527 11:89107179-89107201 GGCCCCTGCGATCTTTCCATTGG - Intergenic
1087071305 11:94083743-94083765 TACTACTCCATGCTTTCCATTGG - Intronic
1089329634 11:117680501-117680523 TGCACCTCCATGCCTTCCTTTGG - Intronic
1091155346 11:133366873-133366895 TGCTCCTCTGTGCCTTCTATTGG - Intronic
1091218658 11:133918365-133918387 TGCCCCTCCCTGCTTCCCTCTGG - Intronic
1092914623 12:13178845-13178867 TGCCCCACCATGTTTTCCAGTGG - Intergenic
1093738906 12:22658216-22658238 GGCCCCTCTGTTCTCTCCATTGG - Intronic
1096898154 12:54846142-54846164 TGGCCCTCTATGCTTGCCATAGG + Intronic
1098060583 12:66557144-66557166 TGCCCTTTTGTGGTTTCCATTGG - Intronic
1099311243 12:81027224-81027246 TGTCTCTCAGTGCTTTCCAGTGG + Intronic
1109735797 13:66482989-66483011 AGCCCCACCGTGCTTTGCTTTGG + Intronic
1111974959 13:94956660-94956682 AGCCCCTCAGTGCTGTCCTTGGG - Intergenic
1114645335 14:24252882-24252904 TTTCCCTCCGTGCTTTTCCTAGG + Intronic
1115149781 14:30270963-30270985 TGCCGCTCAGTGCTGTCCAGAGG + Intergenic
1116717814 14:48449573-48449595 TGCCCCTCCCTGTTTTGCCTAGG - Intergenic
1119783418 14:77294692-77294714 TGCTCCTCCTTGCCTTCCACCGG + Intronic
1120299057 14:82682095-82682117 TGCCCCTCTGTGGTTTCTTTGGG - Intergenic
1120324600 14:83008695-83008717 TGCTCCTCCTTGCCTTCCAGAGG + Intergenic
1121396106 14:93624752-93624774 TGCCCCTCCTTGCTGGGCATGGG + Intronic
1122628933 14:103098682-103098704 TGCCCCTTCATGCTTGGCATGGG - Intergenic
1123004810 14:105316029-105316051 GGCCTCTCCGTGCTTTCCTGTGG + Intronic
1123877998 15:24643558-24643580 TGCTCTTCCTTGGTTTCCATTGG - Intergenic
1124364233 15:29061028-29061050 TGCTCATCAGTGCTTTCCCTGGG + Intronic
1125355249 15:38810853-38810875 TGCCTCTCCGTCCTAACCATAGG - Intergenic
1133796860 16:9053234-9053256 TGCCTCTCCTTGCATTCCTTTGG + Intergenic
1139297872 16:65918844-65918866 TCCTCCTCCTTCCTTTCCATGGG + Intergenic
1141802945 16:86323424-86323446 AGCCCCTCAGTGCTATGCATGGG + Intergenic
1142306516 16:89289014-89289036 TTCCCCTCCGTGTTTTGCAAAGG - Intronic
1143104157 17:4520041-4520063 TGCCCCTCAGTGTCTTCCCTTGG - Intronic
1143417085 17:6758180-6758202 TGCTCCTCCATGGTTTCCTTGGG - Exonic
1152037503 17:77882502-77882524 TGCCTCTTGGTGCTCTCCATTGG - Intergenic
1155216831 18:23650487-23650509 TCCACTTCCATGCTTTCCATAGG - Intronic
1155465135 18:26126073-26126095 TACCCCACCGTGCTCTACATGGG + Intergenic
1155597589 18:27505492-27505514 TGCCCTTTTGTGGTTTCCATTGG - Intergenic
1156558044 18:38089583-38089605 TGCCCCTCTGTGTTCTCCAGCGG - Intergenic
1158275235 18:55759684-55759706 TGGGCCTCCGTGCTTGCCCTTGG - Intergenic
1158490650 18:57906807-57906829 TGCCCCTCGGGGATGTCCATGGG - Intergenic
1158781455 18:60657005-60657027 TGGCCCTCCCTGCGCTCCATTGG + Intergenic
1163048169 19:14660718-14660740 TTCCCATCCATGTTTTCCATGGG + Intronic
1163430168 19:17262696-17262718 TGCCCCTTCCTGCTTCCCAAGGG + Exonic
1165665229 19:37622217-37622239 TGCCCCTCCGTGCTTTCCATTGG + Intronic
1167062457 19:47158149-47158171 TTCCCCTCCCCGCTTTCCCTAGG + Intronic
1168131871 19:54326425-54326447 TGCCTCTCAGTTCTGTCCATGGG + Intergenic
927023660 2:19043355-19043377 TTCCCCTTCATGCTTTCTATAGG + Intergenic
930199040 2:48535147-48535169 TGAGCCTCGGTGCTTTCCCTGGG - Intronic
930396818 2:50832173-50832195 TGCCCATCCCTCTTTTCCATTGG - Intronic
933547702 2:83736261-83736283 TGCCCCTCTGTGTGTTCCAGAGG - Intergenic
933946209 2:87288347-87288369 TGCCCCTCCCTACTCTGCATGGG - Intergenic
934739807 2:96712023-96712045 TCCCCCTCTCTGCTTTCCAGCGG - Exonic
936334001 2:111573224-111573246 TGCCCCTCCCTACTCTGCATGGG + Intergenic
938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG + Intergenic
939000400 2:136727944-136727966 TGCCTCTCAGTGCTTCCCAGGGG + Intergenic
940408169 2:153329105-153329127 TGCTCCTGCTTGCCTTCCATGGG + Intergenic
940761010 2:157739355-157739377 TGCCCCTGCATGATTTCCAATGG + Intronic
943237383 2:185339484-185339506 TGCCACTACTGGCTTTCCATAGG + Intergenic
943539917 2:189199942-189199964 TCCCCTACTGTGCTTTCCATTGG - Intergenic
948301887 2:236913932-236913954 TGTCCCTCCAGGCTTCCCATTGG + Intergenic
948542586 2:238701238-238701260 TGTGCCTCAGTGCTGTCCATAGG + Intergenic
1169998617 20:11588098-11588120 TACCCATCAGTGCATTCCATTGG - Intergenic
1170143338 20:13147134-13147156 TGCTCCTGCGTGCATTCCACAGG + Intronic
1170749622 20:19133954-19133976 TGCCCCTCCTTGCTCTGCTTGGG - Intergenic
1170927095 20:20734648-20734670 TTCCTCTGCATGCTTTCCATAGG - Intergenic
1171418076 20:24997019-24997041 TGCTCCTCCCTGCTTCTCATGGG - Intergenic
1171992674 20:31708651-31708673 TGCCCCGCCCTGCCTTCCTTAGG + Intronic
1172065256 20:32215303-32215325 AGCCCCTCCAGGCTTACCATCGG + Exonic
1175586872 20:60148092-60148114 TGCTCTGCAGTGCTTTCCATGGG - Intergenic
1175764586 20:61583484-61583506 TGCCCCTGGATGCCTTCCATGGG - Intronic
1175852932 20:62103677-62103699 TGCCCCTCCGTGCCTGCTGTGGG + Intergenic
1176113147 20:63419548-63419570 TGCCCCTCCCTGCTTACTAGAGG - Intronic
1181772196 22:25133844-25133866 TGCCCCTCCTTGATTTTTATTGG + Intronic
1183256232 22:36764189-36764211 TGGCCCTCCGTTCATTCCTTTGG - Intronic
1184647295 22:45903268-45903290 TGCCCCTCCATGCCTTCCAAAGG - Intergenic
1184684068 22:46088100-46088122 CCCCCCACCGTGGTTTCCATGGG - Intronic
950525457 3:13520380-13520402 TTCCCCTCCTTGCCTTCCGTTGG + Intergenic
951619368 3:24584149-24584171 TGCCCCTCTGTCTTTCCCATGGG - Intergenic
951733913 3:25842071-25842093 GGGCCCTCTATGCTTTCCATTGG - Intergenic
953698911 3:45181094-45181116 TGCCACTCTGGGCTTTGCATTGG + Intergenic
956158045 3:66318474-66318496 TGCCTTTCCTTGCTCTCCATGGG + Intronic
961556104 3:127697640-127697662 AGCCCCTGCCTGCTTTCTATTGG - Intronic
961746338 3:129065706-129065728 TGCCCCTCAGGGCTAGCCATGGG - Intergenic
963562020 3:146876757-146876779 TGCTCCTCTCTGCTCTCCATGGG + Intergenic
963811567 3:149781976-149781998 TGCCACGCCGTGCTTTCCTATGG + Intronic
968704150 4:2070215-2070237 TGCCCCTGCCTGCGTTCCCTGGG - Intergenic
977002408 4:91519768-91519790 TGCTCCTCCCTGTCTTCCATGGG + Intronic
986205531 5:5621612-5621634 TGCCCCTTTGTGTGTTCCATAGG + Intergenic
993794639 5:92250738-92250760 TGCCACTCTGTGCTTTTAATTGG - Intergenic
994663541 5:102681760-102681782 TTCCACTCCATGCTTTCCATTGG - Intergenic
994903559 5:105806047-105806069 TGCCCCTCCTTGCTATCCCATGG - Intergenic
998697522 5:144657109-144657131 TGTTCTTCCGTGCTTCCCATGGG + Intergenic
999252016 5:150188417-150188439 TGGCCCTCTGTGCCTTCCAAAGG + Intergenic
1002786897 6:408379-408401 TGCCCCGCCCTCCTTCCCATTGG + Exonic
1007412896 6:41675052-41675074 TTCCCCTCAGTGTTTTTCATGGG - Intergenic
1009640376 6:66327954-66327976 TCCCCCTCAGTGTCTTCCATTGG + Intergenic
1011684651 6:89814742-89814764 TGCCGCTCCTTGCTGTCCAGCGG - Intronic
1011795224 6:90945808-90945830 AGCACCTGCATGCTTTCCATAGG + Intergenic
1012360474 6:98371673-98371695 TGCCCTACCTTGCTTTCCAAAGG - Intergenic
1018705784 6:166462251-166462273 TGCCCCACCGGGGGTTCCATGGG - Intronic
1019774995 7:2906996-2907018 TGCCCCTTCATGCTGTTCATCGG + Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1022358175 7:29635411-29635433 CGCCCCTCCCTGCTTTCCCCTGG + Intergenic
1027333378 7:77122563-77122585 CCCCCTTCCGTGCTTCCCATTGG - Intronic
1029782414 7:102748750-102748772 GCCCCTTCCGTGCTTCCCATTGG + Intergenic
1034164569 7:149015387-149015409 TGCCCCACAATGCTATCCATAGG - Intronic
1034936370 7:155203247-155203269 TCCCCCTCCCTGCTCTCCCTTGG + Intergenic
1035670477 8:1413130-1413152 TGCCCCTCTGTGTTTTCTACTGG + Intergenic
1037182668 8:16026020-16026042 TGCCCCTACCTGCTTTCCTTTGG - Intergenic
1039265044 8:35815449-35815471 TGCTCCTCCTTCCTCTCCATGGG - Intergenic
1041839730 8:62255391-62255413 TGCCTCTCCCTGGCTTCCATGGG - Intronic
1042903153 8:73747406-73747428 TGCCCCTCTGTGCTGTGCAGGGG + Intronic
1045562383 8:103277572-103277594 CTCCCATCAGTGCTTTCCATTGG + Intergenic
1045921245 8:107532062-107532084 TGCTCCTCAGTGCTTTTCATGGG + Intergenic
1047282869 8:123461028-123461050 TGTCAATCCCTGCTTTCCATAGG + Intronic
1047334057 8:123919478-123919500 TGCCCCTCAGTGCTTGCCCTGGG + Intronic
1047717061 8:127605324-127605346 TGCCCCTCTCAGATTTCCATAGG + Intergenic
1048280506 8:133102331-133102353 TGTCCCTCCGTGACTTCCCTGGG - Intronic
1050793820 9:9510672-9510694 TGCCATTCCTTTCTTTCCATTGG + Intronic
1050878542 9:10672274-10672296 TGCCACTCCGTGTTTTTAATTGG + Intergenic
1055017813 9:71637929-71637951 AGCCCCTTCTTGCTTTCCAAAGG - Intergenic
1056326686 9:85485872-85485894 TTCCCCTCCCTCCTTCCCATTGG + Intergenic
1056413444 9:86354424-86354446 TCCCTCTCCGTGTTTTCCTTCGG + Intronic
1056611282 9:88127546-88127568 GGCCCATCCGAGCTGTCCATAGG - Intergenic
1057220488 9:93255198-93255220 TACCCCTCCGTGCCTTTCCTGGG + Intronic
1057556558 9:96093004-96093026 TGCCCCTCCTTTTTTTCCACAGG + Intergenic
1059398700 9:114055051-114055073 TGCCCAACCGTGCGTCCCATGGG + Exonic
1059895084 9:118855675-118855697 TGTCCTTCCTTCCTTTCCATGGG - Intergenic
1061116636 9:128617582-128617604 TGCACCTCCCTGCTTTCAAGTGG - Intronic
1062321761 9:135993572-135993594 TGCCCCTCCGTTCCTTCCTCAGG - Intergenic
1188301979 X:28515708-28515730 TGCACCTCTGTGATTGCCATGGG - Intergenic
1188733798 X:33686364-33686386 TGCTCTTTTGTGCTTTCCATTGG + Intergenic
1193650602 X:84126169-84126191 TGCTCCTTTGTGGTTTCCATTGG - Intronic
1194169174 X:90560781-90560803 TTCCCCTCTGTGTTTTCAATTGG + Intergenic
1194595394 X:95850847-95850869 TGCCCATTTTTGCTTTCCATTGG - Intergenic
1195146881 X:102026972-102026994 TGCCCATGTGTGCTTTCCAGGGG + Intergenic
1197990312 X:132310509-132310531 TGCCTCTCTGTGCTATCTATGGG + Intergenic
1200515417 Y:4138566-4138588 TTCCCCTCTGTGTTTTCAATTGG + Intergenic