ID: 1165668660

View in Genome Browser
Species Human (GRCh38)
Location 19:37655792-37655814
Sequence AGGCGTCGCTGGGGGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 571}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165668660_1165668676 28 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668676 19:37655843-37655865 CCTCGAGTGCGCAAGCGCGCGGG No data
1165668660_1165668674 27 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668674 19:37655842-37655864 GCCTCGAGTGCGCAAGCGCGCGG No data
1165668660_1165668678 30 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668678 19:37655845-37655867 TCGAGTGCGCAAGCGCGCGGGGG No data
1165668660_1165668669 -8 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668669 19:37655807-37655829 CGACGCCTCACCGGAACCTTTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1165668660_1165668671 -1 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668671 19:37655814-37655836 TCACCGGAACCTTTGGAAATCGG 0: 1
1: 0
2: 0
3: 13
4: 102
1165668660_1165668677 29 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668677 19:37655844-37655866 CTCGAGTGCGCAAGCGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165668660 Original CRISPR AGGCGTCGCTGGGGGCGGGG CGG (reversed) Intronic