ID: 1165668660

View in Genome Browser
Species Human (GRCh38)
Location 19:37655792-37655814
Sequence AGGCGTCGCTGGGGGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 571}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165668660_1165668671 -1 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668671 19:37655814-37655836 TCACCGGAACCTTTGGAAATCGG 0: 1
1: 0
2: 0
3: 13
4: 102
1165668660_1165668677 29 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668677 19:37655844-37655866 CTCGAGTGCGCAAGCGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 16
1165668660_1165668669 -8 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668669 19:37655807-37655829 CGACGCCTCACCGGAACCTTTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1165668660_1165668676 28 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668676 19:37655843-37655865 CCTCGAGTGCGCAAGCGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1165668660_1165668674 27 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668674 19:37655842-37655864 GCCTCGAGTGCGCAAGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 32
1165668660_1165668678 30 Left 1165668660 19:37655792-37655814 CCGCCCCGCCCCCAGCGACGCCT 0: 1
1: 0
2: 2
3: 49
4: 571
Right 1165668678 19:37655845-37655867 TCGAGTGCGCAAGCGCGCGGGGG 0: 1
1: 0
2: 1
3: 3
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165668660 Original CRISPR AGGCGTCGCTGGGGGCGGGG CGG (reversed) Intronic
900145550 1:1157461-1157483 GGGCGGGGCTGCGGGCGGGGCGG - Intergenic
900192028 1:1355945-1355967 GGGAGTCACTGGGGGAGGGGCGG + Intronic
900314390 1:2049900-2049922 TGGATTCGCTGGGGGCGGAGTGG + Intergenic
900549101 1:3245053-3245075 CAGCATCGCAGGGGGCGGGGTGG + Intronic
900569630 1:3351894-3351916 AGGGAGAGCTGGGGGCGGGGAGG + Intronic
900618069 1:3574217-3574239 AGGCGTTGCTGGGGGCCAGCTGG - Intronic
900647116 1:3714009-3714031 TGGCATGGCTGGGGGAGGGGTGG - Intronic
901087464 1:6620141-6620163 AGGGGTCGCTGGGAGCCTGGGGG - Exonic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901323000 1:8350643-8350665 AGTGGTGGCGGGGGGCGGGGGGG - Intergenic
901667770 1:10836127-10836149 AGGGGCCACTGGGAGCGGGGAGG - Intergenic
902273473 1:15323279-15323301 AGCTGGGGCTGGGGGCGGGGAGG + Intronic
902776197 1:18676480-18676502 ATGAGTGGCTGGGGGAGGGGAGG + Intronic
903172784 1:21564078-21564100 AGGCGGCGCTGGGGGTGGCATGG - Exonic
903349989 1:22711413-22711435 GGCCGTGGCGGGGGGCGGGGGGG + Intronic
903360155 1:22772063-22772085 CGGGGTTGCTGGGGGTGGGGTGG - Intronic
903385658 1:22924552-22924574 AGGAGTGGAGGGGGGCGGGGCGG - Intergenic
903542536 1:24105089-24105111 AGGCCTCGCCTGGGGAGGGGCGG - Intronic
903744671 1:25578602-25578624 AAGGGTCGCTTGGGCCGGGGAGG - Intergenic
903777071 1:25800161-25800183 GGGCGGGGCCGGGGGCGGGGCGG - Exonic
904029984 1:27527891-27527913 GGGCGGCGCTGGGGCCGGCGAGG - Intergenic
904609057 1:31715212-31715234 AGGCGTGGCTGTCGGCGGGGTGG - Intergenic
904924552 1:34037297-34037319 TGCCGCCGGTGGGGGCGGGGAGG - Intronic
905741389 1:40374063-40374085 AGGGGTCTCTGGGGGCGAGGAGG + Exonic
906141014 1:43533474-43533496 GGTCCTCCCTGGGGGCGGGGAGG + Intronic
906325583 1:44843371-44843393 CGGCGCCGCAGGGGGCGGGGCGG + Intergenic
907038376 1:51236499-51236521 AGGCAGCGATGGGGGGGGGGGGG - Exonic
907080434 1:51617019-51617041 CGGGGCCGCAGGGGGCGGGGCGG - Intronic
907197488 1:52698357-52698379 AGCCGGCGGAGGGGGCGGGGCGG + Exonic
907425825 1:54378764-54378786 AGGAACCGCTGGGGGAGGGGAGG + Intronic
909391640 1:75127337-75127359 AGGAGGCTCTGGGGGCGGGGAGG - Intergenic
911150381 1:94592499-94592521 ATGTGGGGCTGGGGGCGGGGTGG - Intergenic
911211476 1:95142955-95142977 AGGCGGGGTTGGGGGCGTGGCGG + Intronic
912203086 1:107480567-107480589 AGGGGTGGGTGGGCGCGGGGAGG - Intronic
912429348 1:109620895-109620917 GGGCCTGGCGGGGGGCGGGGAGG - Exonic
912459989 1:109824079-109824101 AGGCTTCGCTCGGGGCCTGGAGG + Intergenic
914024433 1:143899482-143899504 AGGCATGGCGGGGGGTGGGGGGG + Intergenic
914043953 1:144076721-144076743 AGGCGGCGGGGGGGGAGGGGGGG - Intergenic
914662916 1:149807503-149807525 AGGCATGGCGGGGGGGGGGGGGG + Intronic
914834908 1:151198862-151198884 AGGCCCCGGAGGGGGCGGGGAGG + Exonic
915302845 1:154961502-154961524 GGGCGGCGCAGGGGGCGGTGCGG + Exonic
915491243 1:156251075-156251097 AGGGGCAGCTGGGGGCTGGGAGG + Intronic
915511201 1:156388019-156388041 AGGCTGCGCTGGGGTCAGGGTGG + Intergenic
915955493 1:160217084-160217106 TGGGGTTGCTGGGGGTGGGGGGG + Exonic
916051322 1:161038807-161038829 AGGCGTGGCAGGGAGTGGGGTGG - Intronic
916666629 1:166973610-166973632 AGGCATCGGGGGGGGGGGGGAGG - Intronic
917291579 1:173477186-173477208 GGGCGGGGCTGGGCGCGGGGCGG - Intergenic
919704191 1:200660515-200660537 GGGCATCGCTGTGGGCAGGGCGG + Intronic
920002054 1:202807426-202807448 AGCGCTGGCTGGGGGCGGGGAGG - Intronic
922196726 1:223365034-223365056 AGGCGCTCCCGGGGGCGGGGAGG + Intergenic
923399868 1:233606654-233606676 AGGCTGAGGTGGGGGCGGGGGGG + Intergenic
923631316 1:235650479-235650501 AGGCGTCCCTTGGTGCAGGGTGG - Intronic
924943251 1:248826706-248826728 AGGTGTCGCTTGGTGAGGGGAGG + Intergenic
1062932594 10:1362976-1362998 GGGCGGCGCTGGGGGCGCGGGGG - Intronic
1062976668 10:1688590-1688612 AGGCCAGGCGGGGGGCGGGGAGG - Intronic
1063194388 10:3727659-3727681 AGCCGGAGCTGGGGGCGGTGGGG + Intergenic
1063407872 10:5813676-5813698 AGGCGGCGCGCGGGCCGGGGTGG + Intronic
1065102129 10:22341088-22341110 AGGCGGCGCTGGGAGCAGGCCGG - Intergenic
1067110307 10:43395944-43395966 AGAAAGCGCTGGGGGCGGGGAGG + Intronic
1067226705 10:44381383-44381405 AGGGGTCTCTGGGGTGGGGGAGG - Intronic
1067711829 10:48656256-48656278 CGGCGCCTCTGGGGGGGGGGGGG + Intronic
1067837046 10:49648006-49648028 AGGGGACACTGGGGGCGGGAGGG + Intronic
1069456908 10:68560819-68560841 AGGCGGCGCTCGGCGCGGGCTGG + Intronic
1069698651 10:70405804-70405826 AGGCCGCTCTGGGGGCTGGGCGG + Intronic
1070256062 10:74813950-74813972 AGGCGGGGGTGGGGGCGGGGTGG - Intergenic
1070609970 10:77926535-77926557 AGGCGTCCGGCGGGGCGGGGCGG - Intergenic
1070785512 10:79160078-79160100 AGGCCTAGCTGTGGGCGGTGGGG + Intronic
1070906696 10:80079188-80079210 AGGCGTGGGGTGGGGCGGGGCGG + Intronic
1070950811 10:80429543-80429565 AGGAGAGGCTAGGGGCGGGGCGG - Intronic
1071544853 10:86521557-86521579 CGGCGGCGCTCGAGGCGGGGAGG - Exonic
1073082060 10:100866608-100866630 AGGGGACGCTGCGGGCGGGAGGG + Intergenic
1073094069 10:100969454-100969476 AGGCGGAGCCGGGGGTGGGGCGG - Intronic
1073137640 10:101228771-101228793 AGGCGGCGCCGGGGGAGGAGCGG - Exonic
1073178507 10:101570422-101570444 GGGCCTGGCTGGGGGCGGGGCGG - Intergenic
1074121538 10:110497573-110497595 AAGCGCCGTGGGGGGCGGGGCGG - Intergenic
1074137975 10:110644309-110644331 AGGAGACGCGAGGGGCGGGGAGG - Intergenic
1074241712 10:111645965-111645987 TGGAGTCGGTGGGGGAGGGGGGG + Intergenic
1075099608 10:119496883-119496905 AGGGGGCGGGGGGGGCGGGGTGG - Intergenic
1075975126 10:126687916-126687938 GTGCTTCCCTGGGGGCGGGGTGG - Intergenic
1076058232 10:127392740-127392762 ACCCGGCGCTGGGGGTGGGGAGG - Intronic
1076359451 10:129876893-129876915 AGGGGTAGCTGGGTGGGGGGGGG - Intronic
1076637038 10:131888523-131888545 AGGGGTTGTTGGGGGCAGGGAGG + Intergenic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1076828550 10:132982867-132982889 AGGCGGCGCTGGGAGCTGGAGGG - Intergenic
1076828562 10:132982905-132982927 AGGCGGCGCTGGGAGCTGGAGGG - Intergenic
1076828574 10:132982943-132982965 AGGCGGCGCTGGGAGCTGGATGG - Intergenic
1076828586 10:132982981-132983003 AGGCGGCGCTGGGAGCCGGACGG - Intergenic
1076828598 10:132983019-132983041 AGGCGGCGCTGGGAGCCGGACGG - Intergenic
1076828610 10:132983057-132983079 AGGCGGCGCTGGGAGCCGGACGG - Intergenic
1076828622 10:132983095-132983117 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076828635 10:132983133-132983155 AGGCGGCGCTGGGAGCCGGACGG - Intergenic
1076828647 10:132983171-132983193 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076828660 10:132983209-132983231 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076828673 10:132983247-132983269 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076828699 10:132983323-132983345 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1077008524 11:369991-370013 GGGCGGCGCGGGGGGCGCGGGGG + Intronic
1077010358 11:376733-376755 ACGCGGCGCTGGGGCCCGGGGGG - Exonic
1077076869 11:706023-706045 AGGCGGGGCAGGGGGCGGGGCGG + Intronic
1077079978 11:720928-720950 CGGGGTCGCAGGGGGCGGGGAGG + Intronic
1077115561 11:883095-883117 AGGTGTCACTGGGCGCGGGTGGG - Intronic
1077151969 11:1076708-1076730 AGGCGTAGGTGCGGGCGGGTGGG + Intergenic
1077213146 11:1382753-1382775 AGGTGTGGCTGTGGGCAGGGTGG + Intergenic
1077331625 11:1986568-1986590 GGGCATGGCGGGGGGCGGGGAGG - Intergenic
1077360347 11:2138000-2138022 CGGCGGAGCTGGGGGTGGGGTGG - Intronic
1077483213 11:2826288-2826310 AGCCGGGGTTGGGGGCGGGGAGG + Intronic
1077635889 11:3841066-3841088 GGGCGAGGCTGGGGGCGGGCCGG - Intergenic
1077637824 11:3855572-3855594 GGGCTTCGCTGGGGACCGGGCGG + Intronic
1078191287 11:9094059-9094081 AGAGGCTGCTGGGGGCGGGGGGG - Intronic
1079023494 11:16927075-16927097 AGGCGGGGGTGGGGGCAGGGAGG + Intronic
1079519875 11:21313996-21314018 GGGGGTCGCGGGGGGGGGGGGGG - Intronic
1081179110 11:39965833-39965855 AGGCAACATTGGGGGCGGGGGGG - Intergenic
1081659622 11:44880020-44880042 AGGCGACGCTGGGGGGAGGCTGG + Intronic
1081662091 11:44894456-44894478 AAGCATGCCTGGGGGCGGGGGGG + Intronic
1081774049 11:45665698-45665720 GGGCGGCGCGGGGGGCGGGAAGG - Intergenic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1082035583 11:47642658-47642680 AGGGGGCGCTGAGGTCGGGGCGG + Intergenic
1083048259 11:59755390-59755412 AGGCGCCGGTGGGGGCGGAGGGG + Exonic
1083225432 11:61281667-61281689 GGGCGTGGCTGGGCGCCGGGAGG + Intronic
1083329654 11:61891606-61891628 GGGCCTGGCCGGGGGCGGGGGGG - Intronic
1083599576 11:63938695-63938717 GCGCGCCGCTGGGGGCCGGGTGG - Intergenic
1083619343 11:64041342-64041364 AGGCGTCACGGGGGGTGGAGGGG - Intronic
1083880635 11:65546720-65546742 TGGCTCCGCTGGGGGCGGGGCGG - Intronic
1083881903 11:65553099-65553121 AGCCATCACTGGGGGTGGGGAGG - Intronic
1084031730 11:66485111-66485133 AGGTGTCGCTGGGGTCAGGGAGG + Intronic
1084065357 11:66700904-66700926 AAGAGTCGCTGGGGGAGGCGCGG - Exonic
1084070117 11:66728309-66728331 AGGCGGCGCGGGGGGCGCGCGGG + Intronic
1084174833 11:67417701-67417723 AGGCACCTCTGGGGGCAGGGAGG + Intronic
1084611675 11:70207030-70207052 AGGCATGGCTGGGGTGGGGGTGG + Exonic
1084702248 11:70795068-70795090 AGGAGTCGAGGAGGGCGGGGAGG - Intronic
1085031343 11:73272676-73272698 CGGGGTCAGTGGGGGCGGGGAGG + Intronic
1085034715 11:73292958-73292980 AGGGGTTGCGGGGGGTGGGGGGG + Intronic
1085041862 11:73331418-73331440 AGGCTACGCTGGGGCCAGGGAGG - Intronic
1086697676 11:89864118-89864140 CGGCGCGGCTGGGGGTGGGGAGG - Intergenic
1089359526 11:117876655-117876677 TGGCGGGGCTGGGGGCAGGGCGG + Exonic
1089622219 11:119728679-119728701 AGCCGTCGGCCGGGGCGGGGTGG + Exonic
1090358399 11:126156013-126156035 GAGCGTGGCTGTGGGCGGGGAGG - Intergenic
1090945493 11:131426081-131426103 AGGCATCACTGAGGGCTGGGGGG + Intronic
1091259517 11:134223762-134223784 GGGTGCCGGTGGGGGCGGGGTGG - Intronic
1091358703 11:134957766-134957788 AGGCTTAGCTGTGGGAGGGGCGG - Intergenic
1202814606 11_KI270721v1_random:41744-41766 GGGCATGGCGGGGGGCGGGGAGG - Intergenic
1091550056 12:1530288-1530310 AGGAGGCGCGGGAGGCGGGGCGG + Intronic
1091712736 12:2753238-2753260 ACGCGGCGCTGGCGGCGGGAGGG - Intergenic
1092254223 12:6917445-6917467 AGGTGTTGCTGGGGCAGGGGTGG + Intronic
1092370932 12:7916038-7916060 AGTGCTCGCTGGGGGCAGGGCGG + Intergenic
1092502713 12:9064718-9064740 AGGCGGAGCTGGGTCCGGGGCGG + Intergenic
1095038341 12:37418740-37418762 AGGGGTTGCCGGGGGGGGGGGGG - Intergenic
1095752670 12:45729257-45729279 AGGCGGGGCTGGGGGTGGGGAGG - Intergenic
1095949272 12:47773162-47773184 GGGCGGCGCTGGGGGCGGGCCGG + Intronic
1096113036 12:49040291-49040313 ACACTTCGCTGGGGGCTGGGGGG - Exonic
1096159859 12:49367403-49367425 AGGCGGCGGTGGGGGCGGGGCGG + Intronic
1096302032 12:50438209-50438231 AGGCAGGGCTGGGCGCGGGGTGG + Intronic
1096783370 12:54003514-54003536 GGGGGTCTCTGGGGGTGGGGTGG + Intronic
1096792587 12:54054245-54054267 TGGCGGGGCTGGGGACGGGGAGG - Exonic
1096798006 12:54090659-54090681 AGGCGTGGCGGGGAGGGGGGCGG + Intergenic
1096902517 12:54900019-54900041 AGGTGGCGGTGGGGGTGGGGTGG + Intergenic
1097191119 12:57220139-57220161 AGGAGTCGCAGGGCGTGGGGTGG + Intronic
1100565636 12:95790940-95790962 GGGCGTCGGTCGGGGCGCGGGGG - Intronic
1100729346 12:97446926-97446948 AGGCGTGGATGGGGGCATGGAGG - Intergenic
1101371962 12:104138341-104138363 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1101606075 12:106248203-106248225 GGGGGTGGCTGGGCGCGGGGCGG + Intronic
1102535344 12:113576771-113576793 AGGCGGGGCAGGGGGCGTGGTGG + Intergenic
1102933386 12:116879014-116879036 AGGGGAGGCTGCGGGCGGGGCGG - Intronic
1103038856 12:117678351-117678373 AAGGGTTGGTGGGGGCGGGGTGG - Intronic
1103188359 12:118980737-118980759 AGGAGTGGATGGGGGTGGGGTGG + Intergenic
1103209276 12:119154675-119154697 AGGTGGAGCTGGGGCCGGGGAGG + Intronic
1103556885 12:121771728-121771750 AGGCAGTGCTGGGGGCTGGGAGG - Intronic
1103758914 12:123233666-123233688 AGGCCGCGCTGGCGGTGGGGTGG + Intronic
1103938609 12:124489798-124489820 AGGAGTGGCTGGGGGCAGAGAGG + Intronic
1104289645 12:127455829-127455851 AGGCGGGGCTGGGGCTGGGGCGG + Intergenic
1104376194 12:128267113-128267135 GGGCGGGGCCGGGGGCGGGGCGG + Intergenic
1104423106 12:128653246-128653268 AGTGGTTGCTGGGGGCTGGGAGG + Intronic
1104685219 12:130780507-130780529 AGGAGTCGCTGGTGGAGGAGGGG - Intergenic
1104787297 12:131457862-131457884 TGGCGGCGGTGGGGGCCGGGGGG - Intergenic
1104882941 12:132084702-132084724 AGGGGTCGCAGGGGGAGGGGTGG - Intronic
1105745813 13:23375782-23375804 AGGCGCCTCTGCAGGCGGGGCGG - Intronic
1106235502 13:27857319-27857341 GAGCCTGGCTGGGGGCGGGGGGG + Intergenic
1108304179 13:49114408-49114430 AGGGGTGGTGGGGGGCGGGGAGG - Intronic
1111075940 13:83235616-83235638 AGGTTTTACTGGGGGCGGGGTGG + Intergenic
1112559357 13:100498660-100498682 AGGGGTTGCTGGGGGAGGTGGGG - Intronic
1113476270 13:110583730-110583752 AGGGGTCGGGGGCGGCGGGGTGG - Intergenic
1113541790 13:111115184-111115206 AGGCTGCGCAGGGCGCGGGGCGG + Intronic
1113583770 13:111448796-111448818 GGGCGTGGCTGGGGGCCAGGTGG + Intergenic
1113841585 13:113364217-113364239 AGGGGCGGCTGGGGGCGGGGAGG + Intergenic
1113885688 13:113657307-113657329 AGGGGTCGCAGGGGGAGGTGGGG + Intronic
1114502506 14:23181437-23181459 AGGAGTTGGTGGGGGTGGGGGGG + Intronic
1115320759 14:32077162-32077184 GGCCGCCGCTGGTGGCGGGGAGG + Intronic
1115545176 14:34459269-34459291 AGGCGGAGTTGGGGGTGGGGTGG - Intronic
1115761574 14:36582263-36582285 AGGCGGCGCAGGGGTCGGGCTGG + Exonic
1115770030 14:36658363-36658385 GGGCCTCGCTTGGGGGGGGGGGG + Intronic
1115850065 14:37583978-37584000 GGGCGTCGCAGCGGGCCGGGCGG + Intergenic
1116317644 14:43417869-43417891 AGGAGTGCCTGGGGGCAGGGAGG - Intergenic
1117722014 14:58637815-58637837 AGGCGGCTCTGGGGGCCGGGCGG + Intronic
1117803980 14:59470940-59470962 GGGGGTGGCTGGGGGCGGGGGGG + Intronic
1118614633 14:67566986-67567008 GGGCCTAGCTGGGGGCAGGGAGG - Intronic
1118871390 14:69745774-69745796 AGCAGTGGCTGGGGGTGGGGGGG + Intronic
1119003972 14:70907783-70907805 AGGCCGAGCTGGGGCCGGGGCGG + Exonic
1119357508 14:74019304-74019326 AGGCGCCGCGGCGCGCGGGGTGG - Exonic
1119932975 14:78566146-78566168 GGCCGGCGTTGGGGGCGGGGTGG - Intronic
1121547048 14:94770149-94770171 AGCGGACGCAGGGGGCGGGGAGG - Exonic
1122397223 14:101442008-101442030 AGGAGACGCAGGTGGCGGGGGGG - Intergenic
1122493050 14:102132981-102133003 AGCCGGCGGTGGGGGCGGGCTGG + Intronic
1122903179 14:104790351-104790373 AGGCCTGGCTGGGGGTGGGGAGG - Intronic
1123036590 14:105474347-105474369 AGGCGCCGCGCGCGGCGGGGTGG + Intronic
1123038713 14:105481729-105481751 TGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1125678458 15:41515148-41515170 AGGGGACGGTGGGGGTGGGGTGG + Intergenic
1126172382 15:45705140-45705162 TGCCGTAGCGGGGGGCGGGGGGG - Intergenic
1126425553 15:48523701-48523723 AAGGGTGGCTGGGGGGGGGGGGG + Intronic
1126562669 15:50060630-50060652 AGGTGGTGGTGGGGGCGGGGCGG - Intronic
1127165846 15:56244019-56244041 GCGCGCCGCTGGGGGCCGGGAGG + Intronic
1128999509 15:72320279-72320301 TGGGCTCGCCGGGGGCGGGGGGG + Exonic
1129161850 15:73752058-73752080 AGGCGGGGCTGGGGGAGGGAGGG - Intronic
1129260584 15:74365151-74365173 AGGGGTGGTTGGGGGCTGGGAGG - Intronic
1129334294 15:74843192-74843214 GGGCGGCGCTGGGGGCAGCGTGG - Exonic
1129412792 15:75359213-75359235 AGGCGGGGCTGGGGTTGGGGTGG - Intronic
1129919847 15:79310991-79311013 AGGCGTTGCGGGGGGGTGGGGGG + Intergenic
1130897567 15:88183015-88183037 AGGACTGGCGGGGGGCGGGGGGG - Intronic
1131067687 15:89444519-89444541 AGGGGTCAGTGGGGGTGGGGAGG + Intergenic
1131094752 15:89648261-89648283 AGGCGGCGCAGGGGGCCGGCGGG - Exonic
1131250729 15:90828358-90828380 GTGCGTGGATGGGGGCGGGGCGG + Intergenic
1131484440 15:92808669-92808691 GGGTGGCGCTGGGGGCGAGGGGG - Intronic
1131819911 15:96261941-96261963 GGGAGGGGCTGGGGGCGGGGTGG - Intergenic
1132182634 15:99770662-99770684 TGGCGGGGCGGGGGGCGGGGGGG - Intergenic
1132683450 16:1153023-1153045 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1132815958 16:1826697-1826719 AGGCCTCGGTGGGTGCGGCGGGG - Exonic
1132821211 16:1872163-1872185 CGGAGTCGCTGAGGACGGGGCGG - Exonic
1132934522 16:2473961-2473983 AGCCGCGGCTGGGGGCGCGGGGG + Exonic
1133032929 16:3020313-3020335 AGGCGGGGGCGGGGGCGGGGCGG + Exonic
1133197862 16:4183875-4183897 CGTGGGCGCTGGGGGCGGGGCGG - Intergenic
1133796264 16:9049005-9049027 AGAGATGGCTGGGGGCGGGGGGG - Intergenic
1133867529 16:9658084-9658106 AGGGGTAGCGGGGGGTGGGGTGG + Intergenic
1136428193 16:30183209-30183231 AGGGGGCGCGGGGGGCGCGGGGG - Intronic
1137300532 16:47144031-47144053 AGGCGCGGCGCGGGGCGGGGCGG - Intergenic
1137723890 16:50644374-50644396 AGGTCCCGCTGGGGGCGGGTGGG - Intergenic
1138398890 16:56730016-56730038 GGGCGGGGCCGGGGGCGGGGCGG - Intronic
1139008855 16:62607750-62607772 AGGGGTAGGTGGGGGTGGGGTGG - Intergenic
1139390566 16:66604646-66604668 AGGAGCGGGTGGGGGCGGGGCGG + Intronic
1139570141 16:67806554-67806576 TTGTGTCACTGGGGGCGGGGAGG + Exonic
1139914137 16:70417804-70417826 TGGCGTGGCTGGGGGGGCGGGGG + Intronic
1140027434 16:71303441-71303463 AGCTGTGGCTGGGGGCGGTGGGG - Intergenic
1140686140 16:77435194-77435216 AGGGGGCGAAGGGGGCGGGGAGG + Intergenic
1142003099 16:87675279-87675301 AGGCGTGGCTGAGGCCTGGGAGG - Intronic
1142026966 16:87819623-87819645 TGGCGGCGGTGGGGGGGGGGGGG + Intergenic
1142200159 16:88757307-88757329 GGGCGTTGCTGGCGGGGGGGTGG + Intronic
1142293104 16:89201672-89201694 AGGCTGCGCTCGGGACGGGGCGG + Intergenic
1142374482 16:89700185-89700207 AGGCCTCCCAGGGGGCGGGGCGG - Intronic
1142374900 16:89701727-89701749 CCGTGACGCTGGGGGCGGGGCGG + Intergenic
1142412854 16:89924934-89924956 AGGGGTCGCTGGGGGGAGGGAGG + Intronic
1142752679 17:1998128-1998150 CGGCGGCGGAGGGGGCGGGGAGG + Intronic
1142893282 17:2958830-2958852 AGGTGTCCCTGAGGGTGGGGAGG + Intronic
1143029724 17:3961192-3961214 ATGGGTGGCTGGGGACGGGGCGG + Intronic
1143223762 17:5282699-5282721 TGCCGTCGCTGGGGAGGGGGCGG + Intronic
1143390485 17:6556613-6556635 CGGCGGCGCGGGGGGTGGGGTGG - Intergenic
1143537393 17:7549366-7549388 AGGGGCCGCTGGGGGCCGCGTGG + Intronic
1144730508 17:17523304-17523326 AGTCATCGCTGGGGCTGGGGTGG - Intronic
1144779198 17:17799429-17799451 AGGGGTCAGTGGGGGCGGTGGGG + Intronic
1144780746 17:17807243-17807265 AGGCGGTGGGGGGGGCGGGGGGG + Intronic
1144784363 17:17823666-17823688 GGGCGGGGCTGGGGGCGGGGCGG - Intronic
1145205538 17:20983255-20983277 AGTCCTGGGTGGGGGCGGGGTGG + Intergenic
1145388276 17:22435190-22435212 AGGCGGGGCAGGGGGGGGGGTGG - Intergenic
1145934502 17:28706906-28706928 AGGGGTTGCGGGGGGGGGGGGGG + Intronic
1146256630 17:31394923-31394945 TGGGGTGGCGGGGGGCGGGGGGG + Intronic
1146276168 17:31517183-31517205 AGGCGGTGCGGGGGGGGGGGCGG + Intronic
1146322289 17:31856491-31856513 AGGCATCCATTGGGGCGGGGGGG + Intronic
1147673159 17:42188556-42188578 AGGCGGAGGTGGGGGCCGGGTGG + Intergenic
1147793037 17:43025174-43025196 CCGCCTGGCTGGGGGCGGGGCGG + Intergenic
1147864903 17:43545709-43545731 GGGCTGCGATGGGGGCGGGGAGG + Intronic
1147948153 17:44092145-44092167 AGGCCTGGCTGGGGGCTGGTGGG - Intronic
1150045808 17:61912358-61912380 AGGCCAAGGTGGGGGCGGGGGGG + Intronic
1150294053 17:63998553-63998575 AGGCGTGGCAGGGAGCAGGGAGG + Intronic
1150455630 17:65304584-65304606 AGCCTTCTCTGGGGGGGGGGGGG - Intergenic
1151209998 17:72537401-72537423 AGGCGGGGCTGGGGGTGGAGTGG - Intergenic
1151354986 17:73553084-73553106 AGGCTTCTGTGGGGGCTGGGAGG + Intronic
1151453556 17:74213497-74213519 AGGCGGGGCCGGGGGCGGGGCGG + Exonic
1151456524 17:74229462-74229484 AGGTGGGGCTGGGGGTGGGGAGG - Intronic
1151714664 17:75825237-75825259 AGGCGGCCCTGGGGCCAGGGAGG - Exonic
1151933381 17:77247140-77247162 AGGCGGCGCCCGGGGCGGGAGGG - Intergenic
1151969472 17:77450439-77450461 AGGGCTTGCTGGGGGCTGGGAGG - Intronic
1152109993 17:78352795-78352817 AGGCCGCGCTGGGCGCGTGGGGG - Intergenic
1152195512 17:78916059-78916081 AGGCCTCCCTCAGGGCGGGGTGG + Intronic
1152350403 17:79781046-79781068 AGGCTCTTCTGGGGGCGGGGGGG + Intronic
1152456791 17:80421512-80421534 AGGTCCCGGTGGGGGCGGGGTGG + Intronic
1152499484 17:80698296-80698318 AGGCCTGGGTGGGGGTGGGGCGG - Intronic
1152928891 17:83100097-83100119 AGGCTTGGCTGGTGTCGGGGCGG + Intergenic
1155091467 18:22515389-22515411 AGAGGTCCCTGGGGGTGGGGCGG - Intergenic
1156008572 18:32470950-32470972 AGGCCGAGCTGGGGGCGGAGCGG - Intergenic
1159670133 18:71212498-71212520 AGGGGCGGCGGGGGGCGGGGCGG + Intergenic
1160298453 18:77658120-77658142 AGGCGGCGCTGGGGGAAGGATGG + Intergenic
1160682389 19:417810-417832 AGGCCTGGCTGGGGGCTGGGTGG + Intronic
1160715772 19:575944-575966 ACGTGTCACTGGGGGTGGGGGGG - Intronic
1160797662 19:953349-953371 TGGCGCCGGTGGGGGAGGGGAGG - Intronic
1160856247 19:1219176-1219198 AGGGGTGGCTGAGGGCAGGGTGG + Intronic
1160865427 19:1253946-1253968 GGGCGCCGCTGGGGGCTGTGGGG - Intronic
1161502326 19:4623186-4623208 CGGGGACACTGGGGGCGGGGTGG + Intergenic
1162030740 19:7916307-7916329 AGGCGGCGGCGGGGGCGAGGTGG + Exonic
1162153814 19:8663486-8663508 AGGGGACGCTGGTGGTGGGGAGG + Intergenic
1162315637 19:9936564-9936586 AAGAGGAGCTGGGGGCGGGGCGG - Intergenic
1162402099 19:10452866-10452888 AGGTGGTGCTGGGGGTGGGGGGG - Intronic
1162404996 19:10468139-10468161 AGGCGGGGCTGGGGCCAGGGTGG + Exonic
1162741169 19:12774734-12774756 AGGGGTCTCTGGGGGCGAGAAGG + Exonic
1162791692 19:13066353-13066375 AGCCATTGTTGGGGGCGGGGGGG - Intronic
1162971448 19:14183508-14183530 AGGTGCTGCTGGGGCCGGGGAGG - Intronic
1163034781 19:14564338-14564360 GGGGCTCGGTGGGGGCGGGGCGG - Intronic
1163145925 19:15379374-15379396 CGGGGTCGCTGGGGGCCGGAAGG + Intronic
1163152817 19:15425021-15425043 AGGCCTCGGTGGCTGCGGGGCGG + Exonic
1163158723 19:15452565-15452587 AGGCGTGGTTTGGGGGGGGGGGG + Intronic
1163442430 19:17328693-17328715 AGGCGGCGCTGGTGGAGCGGCGG - Exonic
1163606933 19:18280860-18280882 GGGCGGCGCCGGGGGCGCGGGGG - Exonic
1163633811 19:18429455-18429477 GCGGGTCGCAGGGGGCGGGGGGG + Intronic
1163636198 19:18438180-18438202 AGGCGGGGAAGGGGGCGGGGCGG - Exonic
1163655667 19:18543524-18543546 GGCCGCGGCTGGGGGCGGGGAGG - Exonic
1163830441 19:19544921-19544943 CGGCGTCGCAGAAGGCGGGGAGG - Exonic
1165407789 19:35641692-35641714 AGCTGACGCTGGGGGCGGGTGGG + Intergenic
1165668660 19:37655792-37655814 AGGCGTCGCTGGGGGCGGGGCGG - Intronic
1166316974 19:41994549-41994571 AGGGTACGCTGGGGGAGGGGGGG + Intronic
1166383711 19:42369013-42369035 AGGCGGCGCTGGGGCCAGGCAGG + Intronic
1166746035 19:45142288-45142310 GGCCGTGGCTGGGGACGGGGAGG - Exonic
1166885683 19:45959667-45959689 ATGGGAGGCTGGGGGCGGGGTGG + Intronic
1166947284 19:46404895-46404917 AGAGTTCGCTGGGGGCGTGGGGG + Intergenic
1167148241 19:47695031-47695053 GGGCGTGGCTGGGGGCAGTGGGG - Exonic
1167216871 19:48170791-48170813 AGGTGCCGCAGCGGGCGGGGAGG + Intronic
1168026628 19:53648096-53648118 AGGTGTCGCCGGGCCCGGGGTGG - Intergenic
1168332571 19:55578828-55578850 TGGTGTCGCTTGGGGCGTGGCGG + Exonic
1168459085 19:56538857-56538879 GGGCGCGGCCGGGGGCGGGGCGG + Intergenic
1168721791 19:58558441-58558463 AGGCGACGCGGGCGGCGGCGGGG - Exonic
925068958 2:951157-951179 AGGGGTCGCGGGGAGCGAGGGGG - Intronic
926919149 2:17922666-17922688 AGTGGTTGCTGGGGGCTGGGGGG - Intronic
928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG + Intronic
929151224 2:38750908-38750930 AGCCGCCGCCGAGGGCGGGGGGG + Intronic
930046242 2:47175817-47175839 AGCGGCCGGTGGGGGCGGGGCGG - Intronic
930124351 2:47783895-47783917 GGGCGGGGCGGGGGGCGGGGTGG + Intronic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931464688 2:62475891-62475913 ATGTGTGGATGGGGGCGGGGAGG + Intergenic
932073744 2:68644582-68644604 AGGCTTTCCTGGGGGTGGGGAGG + Intronic
933197900 2:79413170-79413192 AGGGGTGGCTGGGGAGGGGGTGG + Intronic
933666684 2:84970734-84970756 AGGCGGGGCTAGGGGCGGCGTGG + Intergenic
933791784 2:85888952-85888974 GAGCGGCGCTGGGGGCGGGTGGG - Exonic
934473709 2:94578317-94578339 GGGCATCTCTGGGGGCAGGGTGG - Intergenic
936165390 2:110115756-110115778 GGGCGTAGCTGGTGGCGGGCGGG + Exonic
937045107 2:118846979-118847001 AGGCGCCGCGGGCGGCGAGGGGG + Exonic
937418588 2:121736965-121736987 AGGCGTGGCGAGGGGCGGGGAGG + Intergenic
938099191 2:128486614-128486636 CCGCGTGGCCGGGGGCGGGGTGG + Intergenic
938157458 2:128953299-128953321 ATGGGTGGCTGGGGGCGGGGAGG + Intergenic
938934379 2:136116290-136116312 AGGCGGCGTGGGGGGTGGGGTGG + Intronic
941029142 2:160492824-160492846 GGGCGTCCCTGGGGGGCGGGAGG + Intronic
941714398 2:168748816-168748838 TGGCGTGGTTGGGGGTGGGGGGG + Intronic
941904999 2:170712010-170712032 AACCGTGGCGGGGGGCGGGGAGG - Intergenic
942095619 2:172534388-172534410 AGGCCTGGGTGGGGGGGGGGGGG + Intergenic
942276759 2:174328690-174328712 AGATGACGCTGGGGGTGGGGAGG - Intergenic
943419704 2:187655171-187655193 AGGGATGGGTGGGGGCGGGGGGG - Intergenic
946690443 2:222305279-222305301 AGCAGCAGCTGGGGGCGGGGAGG - Intergenic
947625202 2:231614478-231614500 AGGGGAGGCTGGGGGCGGGGAGG - Intergenic
947821354 2:233073179-233073201 GGGTCTCGCTGGGGGAGGGGAGG + Intronic
948170567 2:235898475-235898497 AGGCGGGGGTGGGGGTGGGGGGG - Intronic
948473837 2:238203761-238203783 CGGGGCGGCTGGGGGCGGGGCGG + Intergenic
948598736 2:239096488-239096510 GGGTGTCCATGGGGGCGGGGCGG - Intronic
948645298 2:239400624-239400646 AGGCTGCGCGGGGCGCGGGGCGG + Exonic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1168965088 20:1894251-1894273 CGGGGGCGCGGGGGGCGGGGGGG - Exonic
1169913330 20:10664871-10664893 AGGTTTGGCTGGGGGTGGGGAGG - Intronic
1171122403 20:22578413-22578435 AGGACTGGCTGGGGGAGGGGCGG + Intergenic
1171412471 20:24956549-24956571 AAGCTTCGTTGGGGTCGGGGAGG - Intronic
1171473529 20:25390487-25390509 AGGCTTCGCGCGGAGCGGGGGGG - Intronic
1172064248 20:32207855-32207877 AGGGACCGCTGGGAGCGGGGCGG + Intergenic
1172274990 20:33674475-33674497 CGGCGTCCGCGGGGGCGGGGCGG - Intergenic
1172702540 20:36862358-36862380 AGGCGTTGCTGAGGTGGGGGTGG - Intronic
1172771333 20:37384291-37384313 AGGCCGCGCTGGGGCCGCGGTGG - Exonic
1172904475 20:38358658-38358680 GGGTGACGCTGGGGGCTGGGAGG - Intronic
1173812695 20:45965874-45965896 AGGCATCGCTGTGGGCTTGGAGG - Intronic
1174607006 20:51768393-51768415 AGGCGGCGCGGGGGGCGCGGCGG - Exonic
1175562279 20:59940340-59940362 CGGCGTCACGAGGGGCGGGGCGG - Intronic
1175916515 20:62428444-62428466 AGGCGGAGGTGGAGGCGGGGAGG - Intergenic
1176221088 20:63969684-63969706 GGGCGCGGCGGGGGGCGGGGGGG + Intronic
1177792281 21:25734604-25734626 GGGCGGCGCGGGGGGCAGGGAGG - Exonic
1178992148 21:37366045-37366067 AGGCCGTGGTGGGGGCGGGGAGG - Intronic
1179179800 21:39035721-39035743 TGGCGTCACTGGGGATGGGGAGG - Intergenic
1179487014 21:41716943-41716965 AGGTGTAGGTGGGGGCGGGAGGG - Intergenic
1180095878 21:45555196-45555218 GGGCGGCGCAGGGGGCGGTGGGG + Intergenic
1180095920 21:45555288-45555310 GGGCGGCGCAGGGGGCGGCGGGG + Intergenic
1180110082 21:45643470-45643492 GGGTGGGGCTGGGGGCGGGGCGG - Intergenic
1180794915 22:18598276-18598298 AGGCCAAGGTGGGGGCGGGGTGG + Intergenic
1181000883 22:19987266-19987288 GGGCGTGGCGGGGGCCGGGGTGG + Intronic
1181026612 22:20131127-20131149 CGACGGCGCTGTGGGCGGGGTGG - Intronic
1181226823 22:21397041-21397063 AGGCCAAGGTGGGGGCGGGGTGG - Intergenic
1181251826 22:21537812-21537834 AGGCCAAGGTGGGGGCGGGGTGG + Intergenic
1181449901 22:23012779-23012801 AGGCTTCCCTGGGGACTGGGAGG + Intergenic
1182125345 22:27811706-27811728 AGGAGTTGCCGGGGGCGGCGGGG - Intergenic
1182857190 22:33528124-33528146 AGAGGTCGGGGGGGGCGGGGCGG + Intronic
1183105942 22:35615263-35615285 TGGCCTCCCTGGGGGCAGGGTGG - Intronic
1183282084 22:36937504-36937526 GGGCCTGGCTGGGGGCTGGGGGG - Exonic
1183306605 22:37086250-37086272 AGGGGTCCCTGGGGCAGGGGAGG - Intronic
1183524823 22:38316961-38316983 AGGCGCGGCTGGGGACGAGGAGG - Intronic
1183586819 22:38757528-38757550 TGGCCTTGCTGGGGTCGGGGGGG + Intronic
1183605913 22:38866637-38866659 GGGCGTCGTAGGGGGCGGCGGGG + Exonic
1183642441 22:39100827-39100849 AGCCGGGGCGGGGGGCGGGGAGG - Intronic
1184121350 22:42452614-42452636 AGGCGGCGCTGGGGCCCGGGCGG - Intergenic
1184431292 22:44442712-44442734 AGGCATGGCTGGGGGAGGGCAGG - Intergenic
1184472138 22:44702145-44702167 CGGCGCCCCGGGGGGCGGGGCGG - Intronic
1184523324 22:45008194-45008216 AGGCGGCCATGGGGGCGGAGGGG - Intronic
1184709398 22:46239651-46239673 AGGGGGTGCTGGGGGCGGTGCGG - Exonic
1184741080 22:46429420-46429442 CGGCGTGGCTGTGGGCGTGGGGG + Intronic
1185055321 22:48576040-48576062 GGGCGGCGCGGGGGGGGGGGGGG - Intronic
1185281330 22:49971313-49971335 AGGCGGATCTGGGGGCCGGGGGG + Intergenic
1185289195 22:50015442-50015464 AGCGGTGGCGGGGGGCGGGGTGG - Intronic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
949480836 3:4493008-4493030 AGGTGTCACTGGGGCCGGGGAGG - Intergenic
950785180 3:15428156-15428178 GGGCGAGGTTGGGGGCGGGGAGG - Intronic
951225992 3:20122018-20122040 GGGTGCCGGTGGGGGCGGGGTGG + Intronic
953766336 3:45746572-45746594 AGGCGGAGCTGGGCCCGGGGTGG + Intergenic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954054758 3:48012655-48012677 GTGTGTGGCTGGGGGCGGGGTGG - Intronic
954223025 3:49166112-49166134 TGGGGTCGCTGGGCGCGGGGTGG + Intronic
954327045 3:49869424-49869446 AGGCGGCTCTGGGAACGGGGAGG + Intronic
954564314 3:51586010-51586032 TGGTGGCGGTGGGGGCGGGGTGG - Intronic
954581786 3:51706985-51707007 AGGAGGGGCTGGGGGCGGGCCGG + Intergenic
955228438 3:57079309-57079331 GGGCGGGGCCGGGGGCGGGGAGG + Intronic
955410133 3:58650126-58650148 AGGCGTCACTGCTGGCGTGGTGG - Intronic
955937291 3:64113650-64113672 AGTGGTGGCTGGGGGCTGGGTGG - Intronic
956084853 3:65597916-65597938 AGGCGGGGGTGGGGGGGGGGTGG + Intronic
956144674 3:66180698-66180720 ATCCTTCACTGGGGGCGGGGTGG + Intronic
956202275 3:66718990-66719012 AGGGGCCGCTGGGGGGAGGGGGG + Intergenic
956571644 3:70703284-70703306 AGAAGTCAGTGGGGGCGGGGGGG + Intergenic
959920509 3:111863078-111863100 ATGCTTCGATGGGGGAGGGGTGG + Intronic
961013395 3:123449803-123449825 GGGCGGCGCGGGGGGCGGGGAGG - Intergenic
961051049 3:123747391-123747413 AGGGGTGGCTGGGGGTAGGGAGG + Intronic
961539469 3:127590185-127590207 GGGAGTCGCTCGGGGCGCGGGGG - Intronic
961743385 3:129047363-129047385 AGGCTTCCCTGCGGGCGGGGAGG - Intergenic
961858231 3:129893612-129893634 AGGCGGCGCGGGGGGAGGGTCGG - Intergenic
962108475 3:132417570-132417592 AGGAGGCGGAGGGGGCGGGGAGG + Exonic
962678211 3:137771423-137771445 AGGCGGCGAGGGGGGAGGGGAGG + Intergenic
964876188 3:161371658-161371680 AGGAGTCGCTGGGAGCAGTGCGG - Exonic
965558950 3:170043917-170043939 AGGGGTTGCTGGGGGCTGAGGGG - Intronic
965784279 3:172319617-172319639 AGGCGTCCCTGGGGGAAGAGTGG + Intronic
966182289 3:177197848-177197870 CCGCGGCGGTGGGGGCGGGGCGG - Intergenic
966602890 3:181793327-181793349 AGGCGTCTCTCAGGGAGGGGTGG - Intergenic
966784235 3:183608965-183608987 AGGCGGCGGGGGGGGGGGGGGGG + Intergenic
966837437 3:184059912-184059934 AGGCATGGGTGGGGGCTGGGTGG - Exonic
966840551 3:184083836-184083858 AGGCATGGGTGGGGGCTGGGTGG - Intergenic
966851726 3:184168948-184168970 AGGCCTGGCTGGGAACGGGGTGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968511444 4:997561-997583 GGGTGTCGCTGGGGCCGCGGCGG - Intronic
968977563 4:3829954-3829976 AGGTGTGGCTGGAGGTGGGGTGG + Intergenic
969559845 4:7939897-7939919 CGGCTCCGCTGGGGGCGGGACGG - Exonic
969716827 4:8871867-8871889 CGGCCTCACTGGGGGCGGGGAGG + Intergenic
970193099 4:13533503-13533525 AGGCGTGGGTGGGGGGCGGGTGG - Intergenic
970394756 4:15655023-15655045 AGGCCTCGCAGCGGGCGGGCAGG + Intronic
970480857 4:16472401-16472423 AGGCCTCTAGGGGGGCGGGGGGG + Intergenic
975585054 4:75940848-75940870 CGGCGCTGCTGGGGGCGAGGCGG + Exonic
976775246 4:88699257-88699279 AGGCGGGGCTGGGGGTGGGTGGG - Intronic
977231027 4:94451833-94451855 AGGCGTGGCCGGGAGCGGAGGGG + Intergenic
977719018 4:100217149-100217171 TGGCGGCACTGGGGGCGGGGAGG - Intergenic
978577003 4:110198075-110198097 AGGAGACGCTGGGGGGGGGGGGG - Intronic
978619042 4:110621565-110621587 GTGCGGCGCTGGGGGAGGGGAGG - Intronic
979822582 4:125192182-125192204 AGGAGCCCATGGGGGCGGGGAGG - Intergenic
981042129 4:140233176-140233198 AGGTGCCGGTGGGGGTGGGGGGG - Intergenic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
985548619 5:522230-522252 AGACGTCCTTGAGGGCGGGGAGG - Intronic
985595179 5:784755-784777 GGGCGGGGCTGGGGGCGGGGCGG - Intergenic
985761720 5:1752324-1752346 TGCAGACGCTGGGGGCGGGGGGG + Intergenic
986347154 5:6846140-6846162 AGGCCTCGGGGGTGGCGGGGAGG - Intergenic
987132482 5:14872053-14872075 CGGCGGCGCTGAGGGCGCGGCGG + Intergenic
987132953 5:14875704-14875726 AGGGGTCGGTGGGGGGTGGGGGG - Intergenic
988525865 5:31986644-31986666 AGCCTTTGCGGGGGGCGGGGGGG + Intronic
989061484 5:37415485-37415507 AGGGGCGGCTGGGGGTGGGGGGG + Intronic
989261558 5:39424698-39424720 AAGGGTAGCGGGGGGCGGGGGGG + Intronic
991470664 5:66965572-66965594 AGGGATTGGTGGGGGCGGGGGGG + Intronic
992104096 5:73436367-73436389 TGGCCTCGCTGGGGGCCGGGCGG - Intergenic
992444349 5:76820222-76820244 AGGCCTCGCTGTGGCCGTGGGGG + Intronic
992527997 5:77630224-77630246 GGGCGGTGCTGGGGGCGGAGCGG + Exonic
992528030 5:77630380-77630402 AGACGTTGCTGGGGCCGGGGAGG + Exonic
992796078 5:80256095-80256117 AGGCGGGGCCGGCGGCGGGGCGG - Intergenic
992939918 5:81751432-81751454 GGGCGGCGCGGGGGGAGGGGTGG - Intronic
997015578 5:129930496-129930518 AGGCATCACTGGCGGGGGGGGGG + Intronic
997582468 5:135026480-135026502 TGGAGCCGCTGGGGGAGGGGTGG + Intergenic
997634900 5:135398281-135398303 GAGCCTCGCTGGGGGTGGGGTGG - Intronic
998366881 5:141637615-141637637 AGGCGGCGAAGGGGGAGGGGAGG + Exonic
998583514 5:143403855-143403877 AGGCGCCGTCGGGGCCGGGGTGG - Intronic
999991182 5:157051618-157051640 AGGAATCGCTTGGGGCCGGGAGG - Intronic
1001529947 5:172454590-172454612 CGGCGGCGCGGGGGGCGGTGCGG - Intergenic
1001959839 5:175873065-175873087 ATGCTGCGCTGGGGGAGGGGAGG - Intronic
1001992145 5:176126350-176126372 AGGCAGCGTTGGGGGTGGGGAGG + Intronic
1002224729 5:177711815-177711837 AGGCGGCGTTGGGGTTGGGGAGG - Intronic
1002709266 5:181184424-181184446 AGGCCGCGCTGGGGTAGGGGAGG - Intergenic
1003482403 6:6545938-6545960 AGGCTGAGCTGGGGGTGGGGGGG + Intergenic
1004529374 6:16439358-16439380 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1005946684 6:30600986-30601008 AGCCCACGCTGGGGGAGGGGTGG + Exonic
1006180386 6:32150515-32150537 TGGCGCCGGCGGGGGCGGGGCGG + Exonic
1006369207 6:33633800-33633822 GGGCCAGGCTGGGGGCGGGGCGG + Intronic
1006503489 6:34473216-34473238 AGACGGGGCGGGGGGCGGGGGGG + Intronic
1006511807 6:34525644-34525666 AGGCCTGGCTGGGGGAAGGGAGG + Intronic
1006606218 6:35259606-35259628 CGGCGAAGCGGGGGGCGGGGTGG + Intronic
1007665328 6:43510041-43510063 GGGCGGCGCTGGGGCGGGGGCGG + Exonic
1007775702 6:44223413-44223435 AGGCGGCCCTGGGGGCGCAGGGG + Intronic
1007906610 6:45467606-45467628 ATGAGTGGCTGGGGGCGGTGGGG - Intronic
1008625208 6:53308883-53308905 AGGTGGGGCGGGGGGCGGGGAGG + Intronic
1013330440 6:109094993-109095015 AGAAGGCGCTGGGGCCGGGGCGG - Intergenic
1013507533 6:110815098-110815120 AGGCGAAGCTGGCGGCGGAGCGG - Exonic
1014517748 6:122400037-122400059 AGGCCGCGGTGGGGGAGGGGCGG + Intronic
1014802241 6:125790565-125790587 GGAGGTCGCGGGGGGCGGGGAGG + Intronic
1015060582 6:128960460-128960482 GGGGGTCGGCGGGGGCGGGGTGG - Intronic
1018179291 6:161206461-161206483 AGGTGTCACTGGGGGCAGAGTGG + Intronic
1018676478 6:166226537-166226559 AGGAGCCCCTGGGGGCTGGGAGG - Intergenic
1018876778 6:167827576-167827598 CGGCGGCGCGGGGGGCGCGGCGG + Intronic
1019159234 6:170058143-170058165 AGACAGGGCTGGGGGCGGGGCGG - Intergenic
1019202851 6:170333163-170333185 AGGAATTGCGGGGGGCGGGGGGG - Intronic
1019607497 7:1917468-1917490 AGGCGGTGCTGAGGGCGGAGAGG - Intronic
1019702337 7:2480070-2480092 AGATGTGGCCGGGGGCGGGGAGG - Intergenic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020212296 7:6165979-6166001 GGGCGCCGGTGTGGGCGGGGTGG - Intronic
1021828026 7:24573701-24573723 AGGTGCCGAGGGGGGCGGGGCGG - Intronic
1022112586 7:27240509-27240531 ATGCAGAGCTGGGGGCGGGGTGG + Intergenic
1022943746 7:35262101-35262123 CGGTGTCGCTGGCGGCGGCGGGG + Intergenic
1022973495 7:35537309-35537331 GGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1026735936 7:72948770-72948792 AGGCCTCGGTGGGGCCGGGCAGG + Exonic
1026765164 7:73155455-73155477 AAGCGGCGGCGGGGGCGGGGCGG - Intergenic
1027041637 7:74965210-74965232 AAGCGGCGGCGGGGGCGGGGCGG - Intronic
1027082005 7:75237159-75237181 AAGCGGCGGCGGGGGCGGGGCGG + Intergenic
1027107797 7:75416291-75416313 AGGCCTCGGTGGGGCCGGGCAGG - Intergenic
1027232610 7:76281560-76281582 AGGCCGCGCGGCGGGCGGGGCGG + Exonic
1029276768 7:99409754-99409776 AGGAGGCTCTGTGGGCGGGGGGG + Intronic
1029381098 7:100215339-100215361 AGGGGCAGGTGGGGGCGGGGAGG - Intronic
1029390588 7:100271704-100271726 AAGCGGCGGCGGGGGCGGGGCGG + Intronic
1029492716 7:100881127-100881149 AGGGATGGCGGGGGGCGGGGGGG + Intronic
1029514839 7:101018154-101018176 AGGGGTCCCAGGGGGAGGGGAGG - Intronic
1029746428 7:102517808-102517830 AGGCGGGGGCGGGGGCGGGGCGG + Intergenic
1029764365 7:102616787-102616809 AGGCGGGGGCGGGGGCGGGGCGG + Intronic
1032485993 7:132287934-132287956 AGGAGTCTCTGGGGATGGGGTGG - Intronic
1034174805 7:149091438-149091460 AGGCGGCCCTGAGGCCGGGGTGG - Intergenic
1034547279 7:151797230-151797252 AGGCGGCGGTGGGGGGTGGGGGG - Intronic
1034578971 7:152026068-152026090 AGGAGACGCTGGGGGAGGCGCGG - Intronic
1034589372 7:152127038-152127060 AGGGGTCCCTGGGGGAGGGAGGG + Intergenic
1034911745 7:155003193-155003215 GGGCGTCACTGGAGGCCGGGCGG - Intergenic
1035034456 7:155885894-155885916 TGGCGTTGGTGGGGGCGGGAGGG + Intergenic
1035062585 7:156080073-156080095 AGGTGGTGCTGGGGGTGGGGTGG - Intergenic
1035266624 7:157693065-157693087 AGGTGGCGCTGGGGGGCGGGGGG + Intronic
1036811027 8:11867863-11867885 CGGCGTCCCTGGGGGCCGGCGGG - Intronic
1037947658 8:22999396-22999418 CGGCGTCGCTGCGGGAGGGGCGG + Intronic
1038610144 8:29053362-29053384 ATGAGTCGGTGGGGGGGGGGCGG - Intronic
1039453892 8:37695830-37695852 AGGCGTCGGTGGAGGAGGGGAGG + Exonic
1039987735 8:42462068-42462090 AGGCGAATCTGGGGGAGGGGAGG + Intronic
1040850690 8:51898637-51898659 CGGGGTCCCTGGGGCCGGGGAGG - Intronic
1042174120 8:66022196-66022218 AGGAGTTGCTGGGGGCGGGGTGG - Intronic
1042367480 8:67953173-67953195 AGCCGGGGCGGGGGGCGGGGGGG - Intronic
1043388183 8:79768086-79768108 AGGAGGCGCGGGCGGCGGGGAGG + Intergenic
1044340485 8:91040964-91040986 AGGCATGGCTGGGGGAGGGGAGG + Exonic
1045098930 8:98825861-98825883 CGGCGCGGCCGGGGGCGGGGCGG - Intronic
1045336019 8:101205306-101205328 AGGGGTCGCGGGGGGCGGCAGGG - Intronic
1047682344 8:127266899-127266921 AGGCTTTGCTGGGAGCGGTGGGG - Intergenic
1047961636 8:130016012-130016034 AGGGGGCGCTCGGGTCGGGGTGG - Intronic
1048922506 8:139244207-139244229 AGGCCAAGCTGGGGGCTGGGGGG + Intergenic
1048990976 8:139759934-139759956 AGCCGTCCCTGGGGGCTGGATGG + Intronic
1049174992 8:141186797-141186819 AGGGGCCGCTGGGGGCCTGGAGG - Intronic
1049264926 8:141662699-141662721 AGGCATGGCTGGGGGCAGCGTGG + Intergenic
1049411487 8:142475722-142475744 AGGGGCCCGTGGGGGCGGGGCGG + Intronic
1049446541 8:142634072-142634094 AGGTCTCCCTGGGGGCGGCGAGG + Intergenic
1049527131 8:143133057-143133079 AGGCGACGGTGGGGCTGGGGAGG - Intergenic
1049646175 8:143736788-143736810 AGGCGGGGCTGGGGTGGGGGAGG - Intergenic
1049662115 8:143824205-143824227 AGGGCTGGCTGGGGGCGGGGCGG - Intronic
1049760678 8:144330765-144330787 AGGCGGGGGTGGGGGCGGGCGGG + Exonic
1049798292 8:144506364-144506386 AGGGGTCGGTGGGCGCGGGCGGG - Exonic
1052051046 9:23850237-23850259 CGGGGGTGCTGGGGGCGGGGGGG - Intergenic
1053214341 9:36258259-36258281 AGGCGGCCCTGGGGGTGGGCAGG + Intronic
1053393724 9:37753786-37753808 AAGCGAGGCCGGGGGCGGGGGGG + Intronic
1053684621 9:40510195-40510217 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1053739527 9:41124824-41124846 ACGCGTCGTTGCGGGGGGGGTGG + Intergenic
1053787610 9:41663782-41663804 AGGCGTGGCGGGGAGGGGGGCGG + Intergenic
1053934587 9:43138473-43138495 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1054175888 9:61875125-61875147 AGGCGTGGCGGGGAGGGGGGCGG + Intergenic
1054279105 9:63114770-63114792 GGGCATCTCTGGGGGCAGGGTGG - Intergenic
1054297715 9:63345657-63345679 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1054395731 9:64650168-64650190 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1054430375 9:65155363-65155385 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1054500005 9:65866158-65866180 GGGCATCTCTGGGGGCAGGGTGG - Intergenic
1054661651 9:67705683-67705705 AGGCGTGGCGGGGAGGGGGGCGG - Intergenic
1056992430 9:91423994-91424016 AGGGGGAGCTGAGGGCGGGGAGG - Intergenic
1057133749 9:92672131-92672153 AGGAGGCGGTGGGGGGGGGGTGG + Intergenic
1057311699 9:93947348-93947370 AGGAGAAGCTTGGGGCGGGGCGG - Intergenic
1057934107 9:99222224-99222246 AGGCGTCCCTGGGGTCAGAGAGG + Intronic
1059165558 9:112073494-112073516 GGGGGTGGGTGGGGGCGGGGTGG - Intronic
1059341823 9:113601563-113601585 AGGCATGGCTGGGGGTGGGGAGG + Intergenic
1059414321 9:114154045-114154067 AGTCTCCGCTGGGGGCGGGGAGG - Intergenic
1059414743 9:114155821-114155843 GGGCTGCGCTGGGGGCGCGGGGG + Exonic
1059423600 9:114207295-114207317 AGGCGGGAGTGGGGGCGGGGAGG + Intronic
1060359395 9:122940941-122940963 AGACGGGGCAGGGGGCGGGGCGG + Intronic
1060421512 9:123472750-123472772 AGGAGCCGCGGTGGGCGGGGTGG - Intronic
1060770724 9:126329916-126329938 AGCCGGGGTTGGGGGCGGGGTGG - Intronic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1061251840 9:129431121-129431143 CGGCGCTGCTGGGGGCGGGATGG - Intergenic
1061542057 9:131282896-131282918 CGGCGTCGGGGTGGGCGGGGCGG - Intergenic
1061588264 9:131582569-131582591 AGGCGGGGCTGGGGGCCTGGAGG + Intronic
1061753584 9:132797559-132797581 AGGGGTCTCTGGGGTAGGGGAGG + Intronic
1061832263 9:133303699-133303721 AGCCGTCTCTGGGGTGGGGGTGG - Intergenic
1061913653 9:133738072-133738094 AGGAGCGGCAGGGGGCGGGGAGG + Intronic
1061943534 9:133895290-133895312 TGGCGGGGCTGGGGTCGGGGAGG + Intronic
1062042530 9:134410691-134410713 AGGCGTGGCTGGAGCTGGGGGGG + Intronic
1062284033 9:135765230-135765252 TGGCGTCTCTAGGGGCCGGGAGG - Intronic
1062284059 9:135765331-135765353 TGGCGTCTCTGGGCGCCGGGAGG - Intronic
1062458944 9:136654869-136654891 AGGCTTTGCTGGTGGCTGGGAGG + Intergenic
1062461878 9:136665721-136665743 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1062463356 9:136671018-136671040 AGGCATTGGTGGGGGGGGGGGGG + Intronic
1062472593 9:136712890-136712912 ACGGGACGCTGGGGGAGGGGCGG + Intronic
1062499831 9:136847584-136847606 AGGGGTTGCTGGGGGTGGGAAGG - Exonic
1062584314 9:137242025-137242047 AGCCGTGGCTGGGGACTGGGCGG + Intronic
1185503974 X:618952-618974 CTGCGTGGCTGGGGGCGTGGGGG + Intergenic
1185512012 X:670736-670758 AGACGGGGCTGGGGGGGGGGGGG + Intergenic
1185645129 X:1610494-1610516 AGGCTTGGCTGGAGTCGGGGTGG - Intergenic
1185736551 X:2500658-2500680 AGGTGTGGCCGGGGGTGGGGGGG - Intronic
1186829778 X:13378929-13378951 CGTCGTCGCTGGGGGCTGGCAGG + Intergenic
1187332649 X:18354723-18354745 CGGCCGCGCGGGGGGCGGGGCGG - Exonic
1189461083 X:41243529-41243551 AGGCCGAGCGGGGGGCGGGGGGG + Intergenic
1190058112 X:47193919-47193941 AGGCGGCCCAGGCGGCGGGGAGG + Exonic
1190336191 X:49263853-49263875 AGGAGACCCTTGGGGCGGGGGGG - Intronic
1191210118 X:57875933-57875955 TGGCCTCTCTGGGGGCTGGGGGG - Intergenic
1192212523 X:69136959-69136981 ACGCGGCACTGGGGGCGGGGCGG - Intergenic
1192393269 X:70753207-70753229 GGGCGGCGAGGGGGGCGGGGAGG + Intronic
1192445442 X:71207715-71207737 AGGCGGGATTGGGGGCGGGGAGG - Intergenic
1194383619 X:93225060-93225082 AGGCGAAGGTGGGGGCGGGGTGG + Intergenic
1197195912 X:123700504-123700526 GGGCGGGGCTGGGGGCGGCGGGG + Intronic
1197695021 X:129540645-129540667 GGGCGGCGGTGGGGGGGGGGTGG + Intronic
1197972297 X:132127938-132127960 ATGCCTGGCTGGGGGTGGGGGGG - Exonic
1199649717 X:149939524-149939546 AGGCGGGGCTCGGCGCGGGGCGG + Intergenic
1200147733 X:153935161-153935183 GGGCGGGCCTGGGGGCGGGGCGG + Exonic
1201291149 Y:12421476-12421498 GGGCGCGGCTGGGGGCCGGGGGG - Intergenic
1201291190 Y:12421581-12421603 AGCCGGCGCTGGGGGCCCGGAGG + Intergenic