ID: 1165670400

View in Genome Browser
Species Human (GRCh38)
Location 19:37673677-37673699
Sequence ATCCAGGTGGGTAAGGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165670400_1165670416 28 Left 1165670400 19:37673677-37673699 CCAACACCCTTACCCACCTGGAT 0: 1
1: 0
2: 0
3: 32
4: 207
Right 1165670416 19:37673728-37673750 TTCTTTCCCTTGTTCCAATAGGG 0: 1
1: 3
2: 3
3: 46
4: 310
1165670400_1165670410 5 Left 1165670400 19:37673677-37673699 CCAACACCCTTACCCACCTGGAT 0: 1
1: 0
2: 0
3: 32
4: 207
Right 1165670410 19:37673705-37673727 CCTGTTTTCCCAGCCATCCAGGG 0: 1
1: 0
2: 1
3: 44
4: 576
1165670400_1165670415 27 Left 1165670400 19:37673677-37673699 CCAACACCCTTACCCACCTGGAT 0: 1
1: 0
2: 0
3: 32
4: 207
Right 1165670415 19:37673727-37673749 GTTCTTTCCCTTGTTCCAATAGG 0: 1
1: 1
2: 0
3: 23
4: 234
1165670400_1165670408 4 Left 1165670400 19:37673677-37673699 CCAACACCCTTACCCACCTGGAT 0: 1
1: 0
2: 0
3: 32
4: 207
Right 1165670408 19:37673704-37673726 CCCTGTTTTCCCAGCCATCCAGG 0: 1
1: 1
2: 3
3: 59
4: 1455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165670400 Original CRISPR ATCCAGGTGGGTAAGGGTGT TGG (reversed) Intronic
903222191 1:21875190-21875212 CTCCAGGTGAGGAAGGGTGATGG - Intronic
903550824 1:24156605-24156627 ATCCAGTTGGCTGAGGGTTTTGG - Exonic
904734199 1:32617872-32617894 AGCCAGGTGGGTAATGGGATTGG - Intronic
904909990 1:33927631-33927653 AAATAGGTGGGTAATGGTGTGGG - Intronic
906638081 1:47423494-47423516 ATCCAGGCAGGAAAGGGTGGTGG + Intergenic
907730157 1:57058138-57058160 ATGCAGGTGCGTGAGTGTGTGGG + Intronic
907814129 1:57901549-57901571 ATCAGGGTGGGTTAGGGTGCTGG - Intronic
908743484 1:67352854-67352876 ACCCATGTTGGTGAGGGTGTGGG + Intronic
913557926 1:119987528-119987550 AGCCAGGTGGGGAAGGGAGTGGG + Intronic
917785797 1:178456347-178456369 ATCAAGGTGGGGGAGGGTGGAGG - Intronic
920324165 1:205148665-205148687 ATACAGGTGGGTAGGTATGTTGG + Intronic
921138934 1:212286534-212286556 GCGCAGGTGGGGAAGGGTGTTGG - Intronic
922339113 1:224641358-224641380 GTCCAGGTGGGGAAGGATGGAGG - Intronic
923092108 1:230748410-230748432 CTCCAGGTGGGTACGGGCCTGGG + Intronic
923644829 1:235808438-235808460 ATCCAGGTTTGTATGTGTGTGGG - Exonic
1063281797 10:4637758-4637780 ATCCAGGTCAGGAAGGGTGTAGG - Intergenic
1064248604 10:13689816-13689838 ATTCAGGAGGGTAGGGGTTTGGG - Intronic
1064565304 10:16633433-16633455 CCCCAGGTGGGGATGGGTGTTGG - Intronic
1069209120 10:65733888-65733910 ATGCAAATGGGTAAGGCTGTGGG - Intergenic
1070504211 10:77098869-77098891 ATGCAGAGGGGTGAGGGTGTTGG - Intronic
1070655526 10:78268633-78268655 TTCCTGGGGGGTAAGGGGGTTGG - Intergenic
1070734220 10:78852345-78852367 ATCATGGTGGGTGAGGGTCTGGG - Intergenic
1073962194 10:108945093-108945115 ATCCAGGTGGCTCAGGGTTGGGG + Intergenic
1074328892 10:112483069-112483091 TTCCAGGAGGGTAAGGATGCTGG + Intronic
1074707942 10:116152079-116152101 AACCAGGTGGGAAAGGCTGATGG + Intronic
1075906470 10:126085990-126086012 AGCCATGGGGGTAAGTGTGTGGG + Intronic
1076208947 10:128625464-128625486 ATCCAGTGTGGTGAGGGTGTCGG + Intergenic
1076871824 10:133198308-133198330 AGCCAGGGGGCTGAGGGTGTGGG - Intronic
1078224480 11:9379642-9379664 ATACAGACGGGTAAGGCTGTGGG - Intergenic
1078502814 11:11899738-11899760 ATCCTGGTGAGTAAGGAAGTAGG + Intronic
1078759995 11:14244128-14244150 GTCCAGGTGAGAAAGGGTGATGG - Intronic
1079695214 11:23474170-23474192 ACCCTTGTAGGTAAGGGTGTTGG + Intergenic
1081048494 11:38307446-38307468 ATACATGTGGATAATGGTGTTGG + Intergenic
1081997972 11:47377057-47377079 TCCCAGGTGGGAAGGGGTGTCGG + Intronic
1082263380 11:50095319-50095341 ATCCAGGTGGGAGATGGTATTGG - Intergenic
1082697009 11:56380142-56380164 ATCCATGTTGGTAAAGGTGTGGG - Intergenic
1083245643 11:61425793-61425815 CTCCTGGTGGGTAGGGGTGGTGG - Intronic
1083779836 11:64912092-64912114 ATCCAGGTTGAGAAGGGGGTTGG + Exonic
1086392057 11:86375233-86375255 AGCCAGGAGGGTAAGCGTGTTGG + Exonic
1087163558 11:94974808-94974830 ATCCAGGTAGGAGATGGTGTTGG - Intronic
1089223315 11:116893966-116893988 ATCTAGGAAGGTGAGGGTGTGGG + Intronic
1089632690 11:119793545-119793567 ATGCAAGTGAGTCAGGGTGTGGG - Intergenic
1089633096 11:119795654-119795676 ATGCAAGTGAGTCAGGGTGTTGG + Intergenic
1092290425 12:7156924-7156946 GTCCAGGTGGGTAAGGGAAGGGG + Intronic
1093513744 12:19960493-19960515 AGCCAGGTGGGCAGGGGTTTGGG + Intergenic
1095200060 12:39373345-39373367 ATTCAGGCGGGTAAAGGAGTTGG - Intronic
1095432212 12:42145731-42145753 ATCCAGGCCTGTAAGGGTGTGGG + Intergenic
1101340684 12:103840330-103840352 GTCCAGGTGGGGAAGGTTCTGGG - Intronic
1101845082 12:108357254-108357276 ATCGAGGTTGTTGAGGGTGTTGG - Intergenic
1102476410 12:113191603-113191625 ATTCAGGTGGGTGAGGGAATGGG - Exonic
1107052760 13:36069645-36069667 ATCCAGGTGGGAAGAGGTGGCGG - Intronic
1107771083 13:43787567-43787589 ATTCAGGTTGGTAAGGGTGAGGG + Intergenic
1107828838 13:44356433-44356455 ATCAGAGTGGTTAAGGGTGTAGG - Intergenic
1108543374 13:51465840-51465862 ATCCAGGTGGGCAATGATGTTGG + Intergenic
1109398166 13:61788710-61788732 ATTCAAGAGGGTGAGGGTGTAGG - Intergenic
1109758309 13:66791956-66791978 ACCCAGGTGTGTAAGAGTCTTGG - Intronic
1112094058 13:96113020-96113042 TTCTAGTTTGGTAAGGGTGTAGG + Intronic
1112178897 13:97056772-97056794 AGCCATGTGGGTGTGGGTGTGGG - Intergenic
1113327342 13:109294765-109294787 GTGCAGGTGGGTATGTGTGTAGG - Intergenic
1114961246 14:27892679-27892701 AACCAGGTGGGGCAGGGCGTGGG - Intergenic
1115996218 14:39198458-39198480 ATCCATGTTGGTAAGGATATGGG - Intergenic
1116304855 14:43239936-43239958 AACATGGTGGTTAAGGGTGTGGG - Intergenic
1118780483 14:69004537-69004559 ACCAAAGTGGGAAAGGGTGTGGG - Intergenic
1120902920 14:89591319-89591341 AGCCAGGTGGGCAAGGGTCACGG - Intronic
1122027500 14:98888345-98888367 ATCCAGGGGGGTGATGGTGGTGG + Intergenic
1122856144 14:104561092-104561114 AGCCAGGTGGGGATGGGTGAGGG + Intronic
1123937930 15:25202972-25202994 CTCCAGGTGGGGAAGAGGGTGGG - Intergenic
1124373961 15:29118896-29118918 GTCCAGCTGGGTTAGGCTGTGGG + Intergenic
1126753156 15:51897927-51897949 ATCCAGGTGGGAAAAGATGGTGG - Intronic
1127712966 15:61619528-61619550 AAGCTGGTGGGTAAGGGTGGGGG + Intergenic
1128319234 15:66681274-66681296 TTACAGGGGGGTAAGGGGGTGGG + Intronic
1129736717 15:77970604-77970626 ATCCAAGTGGGGAAGGGGCTTGG + Intergenic
1130252939 15:82312724-82312746 ATCCAAGTGGGAAAGGGGCTTGG + Intergenic
1130882176 15:88064818-88064840 TTGCATGTGGGTAAGGGTGAAGG - Intronic
1131018223 15:89075397-89075419 TTCCAGGTAGGGAAGTGTGTGGG + Intergenic
1131074924 15:89489569-89489591 AGGCAGGTGGGTGAGGGAGTAGG - Intronic
1131150196 15:90042990-90043012 CTCCAGGAGGGTAAGCGGGTGGG - Intronic
1131221032 15:90584312-90584334 ATCCAGGAGGTGGAGGGTGTAGG - Intronic
1131931541 15:97448525-97448547 GTCCAGGTGGCTGAGGGTGGCGG + Intergenic
1132236367 15:100224915-100224937 ATGCAGGTGGTTAAGTCTGTGGG - Intronic
1132503157 16:293550-293572 CTCCAGCTGGGTTAGGGGGTTGG + Exonic
1132568772 16:635093-635115 AGCCTGGTGGGCAAGGGGGTAGG + Intronic
1136682953 16:31978596-31978618 GTCCAGGTGAGTGAGGGTGGGGG + Intergenic
1136886199 16:33931654-33931676 GTCCAGGTGAGTGAGGGTGGGGG - Intergenic
1139198815 16:64951328-64951350 AACCGGGTGGCTGAGGGTGTTGG - Intronic
1139522437 16:67491943-67491965 AACCAGGAAGCTAAGGGTGTGGG - Intergenic
1141277390 16:82601077-82601099 ATCCAGGTTAGTAAGGGATTCGG - Intergenic
1141693875 16:85611167-85611189 ATCCAGGTGGGAAAGGGGTTGGG + Intergenic
1142005824 16:87689201-87689223 TCCCAGGCGGGTAGGGGTGTTGG + Intronic
1203086238 16_KI270728v1_random:1186146-1186168 GTCCAGGTGAGTGAGGGTGGGGG + Intergenic
1143712341 17:8743609-8743631 ATCCAGGTTTGAAGGGGTGTGGG - Exonic
1143982290 17:10880344-10880366 ATGCTGGTTGGTGAGGGTGTTGG + Intergenic
1144998775 17:19288999-19289021 ATCCAGGTGGGAGATGGTGGGGG + Intronic
1146158534 17:30545656-30545678 ATATAGGGGGGTACGGGTGTAGG + Intergenic
1146602227 17:34227856-34227878 ATTCAGGTGGTTGAGGGTGGGGG - Intergenic
1146670553 17:34734509-34734531 ATCCAGGGGAGAAAGGGTGAGGG + Intergenic
1146936977 17:36818202-36818224 CACCAGGTGGGTAGGGGAGTGGG - Intergenic
1148042291 17:44717725-44717747 ATCCAGGGGGCTAGGCGTGTTGG + Intronic
1150050142 17:61953862-61953884 ATCTATGTGGGTATGGGGGTGGG - Intronic
1151223048 17:72627784-72627806 ATCCTGGTGTGTCAAGGTGTGGG - Intergenic
1155013876 18:21812463-21812485 ATCCAGGTGAGTAAGAATGAAGG + Intronic
1155036106 18:22026364-22026386 ATCCAGGTGGCTCAGGAAGTAGG - Intergenic
1156354467 18:36329408-36329430 ATACTGTTGGGTAAGGGAGTGGG - Intronic
1158497597 18:57970450-57970472 ATCCAGGTGGAGGAGGGAGTAGG + Intergenic
1159916043 18:74188782-74188804 ATCAAGGTGGGGAAGGCTGGAGG - Intergenic
1160066284 18:75577105-75577127 ATCAAGGTGGGGAAGGGGGAAGG - Intergenic
1160112960 18:76051007-76051029 CTCCAGGTGTGTAAGTGGGTTGG - Intergenic
1160704758 19:524727-524749 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704779 19:524782-524804 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704800 19:524839-524861 GTCCAGGTGGGAGAGGGTGTTGG - Intergenic
1160704821 19:524894-524916 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704842 19:524949-524971 GTCCAGGTGGGAGAGGGTGTTGG - Intergenic
1160704863 19:525004-525026 GTCCAGGTGGGAGAGGGTGTTGG - Intergenic
1160704884 19:525059-525081 GTCCAGGTGGGAGAGGGTGTTGG - Intergenic
1160704905 19:525116-525138 GTCCAGGTGGGAGAGGGTGTTGG - Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1164473718 19:28556394-28556416 ATCAAGGAGGGCAAGGGAGTGGG + Intergenic
1165086355 19:33350854-33350876 ATCCCTGTGGGAAATGGTGTTGG - Intergenic
1165492898 19:36135387-36135409 GTCCAGGTGGGAAAGGATGGAGG + Intergenic
1165670400 19:37673677-37673699 ATCCAGGTGGGTAAGGGTGTTGG - Intronic
1166302238 19:41917872-41917894 ACCCAGATGGGACAGGGTGTTGG - Intronic
1166768309 19:45265478-45265500 ACCCAGGTGTGTAAGAGTGTGGG + Intronic
1167483863 19:49748692-49748714 ATCCAGGAGGGAAAGGGGGATGG + Intronic
1168322257 19:55517538-55517560 GGCAAGGTGGGTAAGGGCGTGGG - Exonic
925321818 2:2976209-2976231 TTCAAGATGGGGAAGGGTGTGGG + Intergenic
925348839 2:3187774-3187796 ATGCAGGTGGGTGGGGCTGTGGG - Intergenic
925348874 2:3187862-3187884 ATGCAGGTGGGTGGGGCTGTGGG - Intergenic
927228549 2:20796336-20796358 CTCCAGGTGGGGAAGTGGGTGGG + Intronic
927260395 2:21082480-21082502 ATCAAGGTTGGTAAGTGTGTGGG - Intergenic
930876252 2:56220883-56220905 ATGCAGGTGGTCAAGGATGTAGG + Intronic
932172589 2:69571005-69571027 ATCAAGGTGGGCATGGGGGTGGG - Intronic
934618264 2:95788792-95788814 ATCCCGGAGGGGCAGGGTGTGGG + Intergenic
934642629 2:96035767-96035789 ATCCCGGAGGGGCAGGGTGTGGG - Intronic
936276365 2:111101340-111101362 AGCCCGGCGGGTATGGGTGTGGG - Intronic
937126676 2:119478991-119479013 TTCCAGGCAGGCAAGGGTGTCGG - Intronic
946012989 2:216581418-216581440 GTCAGAGTGGGTAAGGGTGTAGG + Intergenic
946573236 2:221047107-221047129 AACCAGGTGGGGAAGGGTTTGGG - Intergenic
946759320 2:222977513-222977535 ATTCAGGTGGCTAAGGTTGGAGG - Intergenic
947878639 2:233485754-233485776 ATCTAGCTGGGTAAAGTTGTGGG - Exonic
948025387 2:234772253-234772275 ATCCAGGTGGGAAGGGATGATGG + Intergenic
948893596 2:240918334-240918356 CTCCAGGTGGGCGAGGATGTTGG + Intergenic
1169717565 20:8637695-8637717 AGCCATGTGGGTTATGGTGTTGG + Intronic
1169983810 20:11419458-11419480 GTCTTGGTGGGTAAAGGTGTGGG - Intergenic
1171178821 20:23076253-23076275 ATCCAGGTGGGCAGTGGTGTGGG + Intergenic
1174666545 20:52263139-52263161 ATACAGGTGGGAAAGGGTGGAGG + Intergenic
1175851815 20:62097772-62097794 GTGCAGGTGGGAGAGGGTGTGGG + Intergenic
1181998009 22:26898134-26898156 ATCCAGGTGGGAAAGGAAGGTGG + Intergenic
1183305708 22:37082036-37082058 ATGCAGTTGGGCAAGGGTCTGGG - Intronic
1183665246 22:39242909-39242931 ATCCAGGTGGGAAAGGGGGCGGG - Intronic
1184100929 22:42341471-42341493 ATCCAGGTGGGTAAGGACCTGGG + Intronic
950112094 3:10425769-10425791 ATCCAGGTGAGCAAGGATGGTGG - Intronic
950139278 3:10604110-10604132 ACCCAGGTGGGTCAGGGAGCTGG + Intronic
950193902 3:10995683-10995705 ATGCAGGTGGCTAAAGGTGGTGG - Intronic
951266149 3:20569524-20569546 ATCCAGGTGATTAATGGTGTTGG + Intergenic
952465103 3:33576076-33576098 ATCCATGTGGGAAAGGGGTTGGG - Intronic
953448146 3:42984922-42984944 CTCCAGGTGGGAAAGAGTTTTGG + Intronic
954092364 3:48295199-48295221 ATCCTTGTGGGCAAGGATGTAGG + Exonic
954964358 3:54597252-54597274 AAGGAGGTGGGAAAGGGTGTGGG - Intronic
957288131 3:78243250-78243272 ACACAGGTGGCTAAGAGTGTGGG - Intergenic
959928032 3:111946664-111946686 AGCAAGGTGGGTAAGGGTGCAGG + Intronic
960152544 3:114264964-114264986 ATCCAGGTGGGAGAGGGTAAGGG - Intergenic
961671440 3:128534546-128534568 ATCCAGGTGGCCAAGGCTGAGGG + Intergenic
962848303 3:139289518-139289540 ATCCGGTGGGGTTAGGGTGTGGG + Intronic
963071876 3:141311475-141311497 ATCCAAGGGGGAAGGGGTGTGGG - Intergenic
963857020 3:150265305-150265327 ATCATATTGGGTAAGGGTGTAGG - Intergenic
964941785 3:162166650-162166672 ATCCAGTTGGGTAAGAGATTGGG - Intergenic
966417760 3:179707031-179707053 GTCCAGCTGGGTGAGGTTGTTGG - Exonic
967308696 3:188085480-188085502 CTGCAGGTGGGTGAGGATGTGGG + Intergenic
970082352 4:12301836-12301858 TTCCTGGTGGGTGAGGGGGTGGG + Intergenic
973662861 4:53125883-53125905 ATCCAGGTTGGGAAGAGTATGGG + Intronic
973666380 4:53163651-53163673 ATCCAGGAGGTGGAGGGTGTAGG + Intronic
978781500 4:112559828-112559850 AGCCTAGTGGGTAAGAGTGTGGG - Intronic
980603658 4:135060263-135060285 ACTCAGGAGGGTAAGGGTGGAGG - Intergenic
981663533 4:147195436-147195458 ATCCAGGTGGGTGTGGGTCATGG - Intergenic
982320344 4:154070776-154070798 ATCCAAGTGGGGAAGTGTGGAGG + Intergenic
985812385 5:2099375-2099397 ATCCAGGTGTGTTGGGGTCTTGG - Intergenic
985912722 5:2896242-2896264 CTCCTGGGGGGTAAGGGTGCGGG - Intergenic
986442921 5:7797391-7797413 ATCCAGGTGGGCATGGGGGTTGG - Intronic
987192848 5:15497036-15497058 AGCCAGGTGGGGGTGGGTGTTGG + Intergenic
987387080 5:17340062-17340084 AACAAGGTGGATGAGGGTGTGGG + Intergenic
987735599 5:21838872-21838894 ATCCATGTGGGTATGGATGAAGG - Intronic
992373401 5:76168362-76168384 ATCCTGGTGGGCAGGGGTGGGGG - Intronic
994583686 5:101679268-101679290 AAGCAGGTGGTTAAGGTTGTAGG + Intergenic
994914126 5:105950826-105950848 ATCTATGTGGGTAAGTGTATGGG + Intergenic
997234242 5:132263601-132263623 ATCAAGGTGGGCAGGGGAGTGGG - Intronic
999757971 5:154679470-154679492 AGCAAGGTGGTTAAGGGTGAGGG - Intergenic
1001080425 5:168663321-168663343 ATGGAGGTTGGGAAGGGTGTTGG + Intronic
1001680108 5:173550407-173550429 ATGCAAGTGGGTAAAGGTGAAGG + Intergenic
1002335168 5:178472360-178472382 GAGCAGGTGGATAAGGGTGTGGG + Intronic
1004454550 6:15779744-15779766 ATCCAGGAGGGTAAGAGAGCAGG - Intergenic
1005849510 6:29810923-29810945 ACCCAGAAGGGTAAGGGGGTTGG + Intergenic
1006981820 6:38153660-38153682 CGCCAGGTGGGGAAGGGTGGGGG + Exonic
1007045808 6:38773280-38773302 ACCCAGGTGGGCAAGGGTTCTGG - Intronic
1008307070 6:49916508-49916530 ATGTAGGTAGGTAAGGGTGAGGG - Intergenic
1010454388 6:76038499-76038521 ATCCTGGTGGGTAAGTGGGCTGG - Intronic
1014547729 6:122752511-122752533 CTCCAGGAGGGTAAGGTTGGGGG - Intergenic
1015092203 6:129372087-129372109 ATTCTGGTGGGGAAGGTTGTGGG - Intronic
1016261312 6:142174062-142174084 ATCCAGGTGGGACTGTGTGTGGG - Intronic
1018514384 6:164562551-164562573 ATACAATTGGGTAAGGGTATTGG - Intergenic
1021919343 7:25468376-25468398 ATCCAAGTGGGTAAGGATGAGGG + Intergenic
1024648181 7:51385800-51385822 ACTCAGGTGAGTATGGGTGTGGG + Intergenic
1026172216 7:67963900-67963922 ATCTGGGTGGGTAGGGGAGTGGG + Intergenic
1026789310 7:73321479-73321501 ATTCAGGTGTTTATGGGTGTGGG - Intronic
1028318910 7:89436726-89436748 GTCCAGGTGTGTAAGTCTGTGGG - Intergenic
1028941922 7:96530850-96530872 ATCCATGTGGGTTGGGGTGAGGG + Intronic
1029457188 7:100677332-100677354 AGCCTGGTGGGGAACGGTGTAGG - Exonic
1033671902 7:143501085-143501107 AGCCTGGTGGCTAAAGGTGTAGG + Intergenic
1036599124 8:10242924-10242946 ATGCAGGTGGGCAAGGGTCTGGG - Intronic
1038515861 8:28187238-28187260 ATCCAGGTGGGAGATGGTGGTGG - Intronic
1038683862 8:29697095-29697117 ATACATGTGGGTGAGGGTGTAGG - Intergenic
1040006842 8:42628151-42628173 ATCCAGGTTGGGAATGGTGCAGG - Intergenic
1040723548 8:50353842-50353864 ATCCAGGAAGGCAAGGGTGAAGG + Intronic
1043676823 8:82966927-82966949 CTCCAGAGGGGTAAGGGTCTTGG + Intergenic
1045466833 8:102477902-102477924 CTCAAGGTGGGTTATGGTGTTGG - Intergenic
1047220141 8:122912138-122912160 ATCCAGTGGGGTAAGGGTCAAGG - Intronic
1049738542 8:144222840-144222862 ATACAGGTAGGTACAGGTGTGGG + Intronic
1053017970 9:34674809-34674831 ACGTAGGTGGGTAAGGGTGTCGG + Intergenic
1056382692 9:86069633-86069655 ATCCAGTGGGCTATGGGTGTGGG + Intronic
1057117730 9:92541436-92541458 AACCAGGAGGGTGGGGGTGTGGG - Intronic
1057274988 9:93671432-93671454 ATGCAGGTGGGTGTGGATGTAGG + Intronic
1058073328 9:100624107-100624129 ATCTAGTTGGGTATGGGTGTAGG + Intergenic
1061401440 9:130370508-130370530 ACCCAGGGGGGTGGGGGTGTTGG - Intronic
1061487757 9:130928961-130928983 CTCCAGGTGGGTCTGGGTGAAGG - Intronic
1061516528 9:131093406-131093428 ATCCAGGAGGGGGATGGTGTGGG + Intronic
1187310713 X:18138649-18138671 AGCCAGAGGGGTAGGGGTGTGGG + Intergenic
1187559599 X:20389410-20389432 ATCCTGGTGGGTAATTGGGTTGG + Intergenic
1188153879 X:26716676-26716698 ATCCAGTTGGTTAATGGTGTTGG + Intergenic
1190197782 X:48334485-48334507 ATTCAGATGGTTAAGGGTGGGGG - Intergenic
1190318501 X:49165881-49165903 ATCCAGGAGGGGAGGGGTCTCGG + Intronic
1190641052 X:52482889-52482911 GGCCAGGAGGGGAAGGGTGTGGG - Intergenic
1190646620 X:52529976-52529998 GGCCAGGAGGGGAAGGGTGTGGG + Intergenic
1190664527 X:52684912-52684934 ATTCAGATGGTTAAGGGTGGGGG - Intronic
1190674895 X:52773510-52773532 ATTCAGATGGTTAAGGGTGGGGG + Intronic
1191018229 X:55833351-55833373 GTCCAGGTGGGTGAGGTTGGTGG + Intergenic
1192552443 X:72065045-72065067 ATCCAGGTTGGGTAGGGTGCTGG - Intergenic
1193794727 X:85859612-85859634 AGCCAGGGTGGTAAGGATGTAGG - Intergenic
1195616157 X:106913761-106913783 ATCCAGGTCCTTCAGGGTGTGGG + Intronic
1195704969 X:107732132-107732154 ATCCTGGAGGGGAAGGGTGGGGG - Intronic
1199037446 X:143069027-143069049 ATCCAATTGAGTAAGGTTGTGGG + Intergenic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic