ID: 1165677087

View in Genome Browser
Species Human (GRCh38)
Location 19:37735749-37735771
Sequence CAGAAACCTGGATATTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165677085_1165677087 -5 Left 1165677085 19:37735731-37735753 CCTGGAAAATATTATTAGCAGAA No data
Right 1165677087 19:37735749-37735771 CAGAAACCTGGATATTTTTGAGG No data
1165677083_1165677087 22 Left 1165677083 19:37735704-37735726 CCACAAACTGGGTGGAAATTGGA No data
Right 1165677087 19:37735749-37735771 CAGAAACCTGGATATTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165677087 Original CRISPR CAGAAACCTGGATATTTTTG AGG Intergenic
No off target data available for this crispr