ID: 1165681358

View in Genome Browser
Species Human (GRCh38)
Location 19:37779132-37779154
Sequence CGTTGATTGCGGTGGCACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165681358 Original CRISPR CGTTGATTGCGGTGGCACTG CGG (reversed) Intronic
900300502 1:1974474-1974496 CGTTGGCTGCGGTGGGCCTGGGG + Intronic
901221619 1:7586826-7586848 CGGTGGCTGCGGTGGAACTGAGG + Intronic
905171342 1:36111486-36111508 CGGTGATGGAGTTGGCACTGTGG - Intronic
924210973 1:241767119-241767141 AGTAGATGGTGGTGGCACTGGGG - Intronic
1070290038 10:75108193-75108215 GGTTGTTTGCCGTGGCCCTGGGG + Intronic
1089254598 11:117187656-117187678 GGTTGACAGCGCTGGCACTGGGG + Exonic
1091233627 11:134004260-134004282 AGTTGATTGTGGTGGAAGTGGGG - Intergenic
1091675269 12:2484598-2484620 CATTGGAGGCGGTGGCACTGAGG + Intronic
1112818524 13:103302520-103302542 GTTTGTTTGCGGTGGCTCTGTGG + Intergenic
1115433326 14:33346239-33346261 AGTTGATTCCGGTGGTACAGTGG + Intronic
1120398327 14:83996157-83996179 GGTGGAATGCAGTGGCACTGTGG - Intergenic
1121049983 14:90814141-90814163 CGGGGTTTGCGGGGGCACTGTGG - Intronic
1130978034 15:88792241-88792263 TGTGGATTGGGGTTGCACTGAGG - Intergenic
1134233913 16:12450778-12450800 CAATCATTGTGGTGGCACTGGGG + Intronic
1139311990 16:66035164-66035186 CCTTGATGGCAGTGACACTGTGG - Intergenic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1152531197 17:80920254-80920276 CGTTGATTGCGCTGGGTGTGGGG - Intronic
1152698615 17:81808177-81808199 CTTTGCTCGCTGTGGCACTGGGG + Intronic
1159404435 18:67981798-67981820 CGTTGTTTGTTGTAGCACTGTGG + Intergenic
1160583424 18:79900294-79900316 CGGTTACTGCGGTGGCACTGGGG - Intergenic
1160667466 19:338658-338680 TTTTGATTGCTGTGGCTCTGTGG - Intronic
1165681358 19:37779132-37779154 CGTTGATTGCGGTGGCACTGCGG - Intronic
1167515540 19:49921349-49921371 CGGTGATGGTGGTGGCAGTGGGG - Intronic
926132078 2:10309699-10309721 CGTTGAATGCAGTGGTGCTGTGG + Intronic
928740677 2:34348504-34348526 CTTATATTGCGGTGCCACTGGGG - Intergenic
937281336 2:120719465-120719487 CCTGGAATGCGGTGGCACAGAGG - Intergenic
944656014 2:201877354-201877376 CGCTGATTGGGGTGGGACTGTGG + Intronic
1181303875 22:21903074-21903096 CAGTGATAGCAGTGGCACTGGGG - Intergenic
963976093 3:151481718-151481740 CCTGGATTGCAGTGCCACTGTGG + Intergenic
966014297 3:175122238-175122260 TGTTGATTGCAGTGGCCCAGTGG - Intronic
972726317 4:41748892-41748914 CGTCTATTGGGCTGGCACTGGGG + Exonic
993862541 5:93153653-93153675 AGTTTATTGCAGTGGCACTTTGG + Intergenic
1000909786 5:167008006-167008028 TGTTGCTTGAGGTGGCACAGTGG + Intergenic
1001686079 5:173595958-173595980 TGTTTATAGCAGTGGCACTGAGG + Intergenic
1003246120 6:4383824-4383846 TGTTGACAGCAGTGGCACTGTGG - Intergenic
1007748008 6:44055056-44055078 CATTGACTGGGGTGGCAGTGTGG + Intergenic
1018341017 6:162851063-162851085 TGTTGACTGCGGCGGCAGTGGGG + Intronic
1018392373 6:163350255-163350277 TTTTGATTGAGGTGGCAATGTGG + Intergenic
1020211230 7:6159520-6159542 CATTGTTTGTGGTGGCGCTGAGG + Intronic
1021729956 7:23586397-23586419 CCATGATGGCGGCGGCACTGCGG + Intergenic
1025795557 7:64736657-64736679 CGGTGCTGGCGGTGGCGCTGGGG - Intergenic
1026808484 7:73443036-73443058 CTTTGATTGCCGTGGCCCCGGGG - Intronic
1035268546 7:157706020-157706042 CGTTGATTTGGAAGGCACTGGGG - Intronic
1038445167 8:27598587-27598609 CGTTCCTTCCGGTGTCACTGAGG - Exonic
1044610850 8:94090701-94090723 CTTTGAAAGCGGTGGCATTGGGG - Intergenic
1050045935 9:1545235-1545257 AGTGGATTGTGGTGCCACTGAGG - Intergenic
1051513677 9:17906744-17906766 CGCTGATTGCGGTGGCTCCGCGG - Intergenic
1052784595 9:32816814-32816836 CGTTAAGTCAGGTGGCACTGAGG - Intergenic
1056278441 9:85016110-85016132 GGATGATTACGGTGGCACTGAGG + Intronic
1062074199 9:134575624-134575646 CATTGACTGCTGGGGCACTGAGG - Intergenic