ID: 1165683974

View in Genome Browser
Species Human (GRCh38)
Location 19:37802148-37802170
Sequence CTGTGAACTGTGCATGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 1, 2: 14, 3: 61, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165683974_1165683982 26 Left 1165683974 19:37802148-37802170 CCCCCCACATGCACAGTTCACAG 0: 1
1: 1
2: 14
3: 61
4: 307
Right 1165683982 19:37802197-37802219 AATGCCACCGCTGATCAGACAGG 0: 2
1: 108
2: 630
3: 1066
4: 1634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165683974 Original CRISPR CTGTGAACTGTGCATGTGGG GGG (reversed) Intronic
900541849 1:3206854-3206876 CTGGGACCTGTGCAGCTGGGTGG + Intronic
902162599 1:14543403-14543425 CTGTGAACTGTGAAGTTGGCTGG + Intergenic
902985981 1:20154398-20154420 CTGTGAAGTATCCCTGTGGGCGG + Intergenic
903056560 1:20640227-20640249 CTGTGAACTGGGCATTTTTGGGG - Intronic
903352860 1:22728668-22728690 GTGTGATCAGTCCATGTGGGAGG - Intronic
904005340 1:27360556-27360578 CTGTGGACTGGGCCCGTGGGCGG - Intronic
905816434 1:40954586-40954608 ATGTGAACCGTGCATGTGTCTGG + Intergenic
909519568 1:76551834-76551856 CTGTGAAGTGTGTGTGTGGTGGG - Intronic
911271660 1:95808965-95808987 ATGTGTCCTGTGGATGTGGGTGG + Intergenic
911773002 1:101771054-101771076 ATGTGAAGTGAACATGTGGGGGG - Intergenic
913046579 1:115078426-115078448 CTGTGAATTTTGCAGGTTGGAGG - Intronic
914727010 1:150336244-150336266 TTGTGAACTGTACATGTGAGGGG - Intronic
916047223 1:161009186-161009208 GTGAGGACTGGGCATGTGGGAGG - Intronic
917995902 1:180438113-180438135 TTGTGAACTGCACATGTGAGGGG + Intronic
919931569 1:202224646-202224668 CTGTGAACTGCGCATGCGAGGGG - Intronic
922571464 1:226637030-226637052 GTGTGATCTGTGAATGTGTGTGG + Intronic
922746407 1:228046788-228046810 GTGTGATGTGTGCATGTGTGTGG + Intronic
1063604692 10:7512458-7512480 TTGTGAACTGCACATGTGAGTGG - Intergenic
1065312590 10:24430698-24430720 CTGTGAACTGCGCATGGTGAGGG - Intronic
1065754665 10:28920204-28920226 CTGTGAACTGCCCATGCGAGGGG - Intergenic
1067085457 10:43235725-43235747 CTGTCCCCTGTGCATGTGGCAGG - Intronic
1067805663 10:49391314-49391336 CTCTGAACTGTGTCTGGGGGCGG - Intronic
1068264051 10:54624779-54624801 TTGTGAACTGTGCATATGAGGGG + Intronic
1068590736 10:58850400-58850422 TTGTGAACTGTGCATGCGAGAGG + Intergenic
1068908015 10:62348580-62348602 CTGTCAACTGAGCATATGTGAGG - Intergenic
1069262510 10:66415494-66415516 CTGTGAACTGAGCAGGTAAGTGG - Intronic
1070984225 10:80674208-80674230 TTGTGAAATGTGGAGGTGGGAGG - Intergenic
1071686856 10:87767400-87767422 TTGTGAACTGTGCATGCGAGGGG - Intronic
1072618275 10:97063816-97063838 CTGTGCCCAGAGCATGTGGGAGG - Intronic
1072671423 10:97432586-97432608 GTGTGACATGTGCAGGTGGGAGG - Exonic
1073695845 10:105866513-105866535 CTTTGATCAGTGCATGTAGGTGG + Intergenic
1074895152 10:117770903-117770925 CTGGGAACTATGCTTGTGGGAGG + Intergenic
1075374994 10:121971911-121971933 CTGTAGACTGTTCATTTGGGTGG - Intronic
1075795127 10:125114798-125114820 CTGTTATCTCTGCATTTGGGTGG - Intronic
1076405701 10:130211340-130211362 CTGTCAACTGTGCATTTGTCTGG - Intergenic
1076443444 10:130495980-130496002 CTGGAAACTGTGGATTTGGGAGG - Intergenic
1076459143 10:130627262-130627284 CTGTGGACTGTGCAAATGGATGG + Intergenic
1077169085 11:1158463-1158485 TGGTGAACTGGGCATGTGTGGGG - Intronic
1077310609 11:1887376-1887398 CTGTCCTCTGTGCATCTGGGAGG + Intronic
1077312452 11:1895856-1895878 GTCTGAACTGTGCATGGTGGTGG + Intergenic
1077333659 11:1994155-1994177 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1077363337 11:2150979-2151001 CTGGGGACTGTTCATTTGGGGGG - Intronic
1077376817 11:2209121-2209143 CGGTGGACAGTGCAGGTGGGGGG + Intergenic
1078088667 11:8250514-8250536 CATTGAACTCTGCATTTGGGTGG + Intronic
1078581506 11:12542766-12542788 CAGAGATGTGTGCATGTGGGGGG - Intergenic
1080878550 11:36298498-36298520 TTGTGAACTGCGCATGTGAGGGG - Intronic
1081162168 11:39762574-39762596 ATGTGAACTGAACTTGTGGGGGG + Intergenic
1083625698 11:64070995-64071017 CTGTGAACTGTGGAGGTCTGAGG - Intronic
1083694338 11:64432617-64432639 CAGTGAACTCTGAATGTGAGAGG + Intergenic
1083821649 11:65174951-65174973 GTGTGACATGTGCAGGTGGGAGG + Intergenic
1085130532 11:74034177-74034199 CTGTGTCCTGAGCATCTGGGAGG + Exonic
1086003034 11:82002931-82002953 CTTTGAACTCTGCTTGTGGTAGG - Intergenic
1088362859 11:109009330-109009352 CTGTCAACTGTGCATGTGAGGGG - Intergenic
1202816640 11_KI270721v1_random:49337-49359 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092070141 12:5625446-5625468 CTTTGAAGTGAGCATTTGGGTGG + Intronic
1092759479 12:11796634-11796656 CTGTGCACTGTCCATGCGTGGGG + Intronic
1096445397 12:51686165-51686187 CTGTGAACTGTGGATGGATGGGG - Intronic
1097438173 12:59576475-59576497 ATGTGTACTGAGCATGAGGGAGG + Intergenic
1098140476 12:67445547-67445569 TTGTGAACTGTGCATGCGAGGGG - Intergenic
1098872832 12:75835896-75835918 CTATGAACTGTAGATGTGAGAGG + Intergenic
1099089883 12:78292951-78292973 TTCTGAACTGTGCATGTGAGGGG + Intergenic
1099868737 12:88319368-88319390 TTGTGAACTGTGCATGCGAGGGG + Intergenic
1099936426 12:89131100-89131122 CTGTGGAATGTGCATGTGTGTGG - Intergenic
1100336965 12:93640738-93640760 GTGTGACATGTGCAGGTGGGAGG + Intergenic
1101361497 12:104031605-104031627 GTGTGACATGTGCAGGTGGGAGG - Intronic
1101426602 12:104593352-104593374 CTCTGAATTGTCCCTGTGGGAGG + Intronic
1104285602 12:127421739-127421761 CTGAGGACGGTGCATTTGGGTGG - Intergenic
1104517998 12:129445735-129445757 CTGTGAACTGTGACTATGGGTGG - Intronic
1104680305 12:130746563-130746585 TTGTGAACTGTGCGTGTGAGGGG - Intergenic
1104921188 12:132291631-132291653 CTGGGTGCTGTGGATGTGGGTGG - Intronic
1104947961 12:132425465-132425487 CTGTGCACCGAGCATGAGGGAGG - Intergenic
1107542251 13:41401960-41401982 CTGTGATCTGAGAATGTGGTTGG + Intergenic
1108481935 13:50881423-50881445 TTGTGAACTGCTCATGTGAGGGG + Intergenic
1108540775 13:51442700-51442722 TTGTGAACTGTGCATGCAAGGGG + Intronic
1108826165 13:54415294-54415316 TTGTGAACTGTGCATGTGAGGGG + Intergenic
1110797185 13:79652955-79652977 CTGTGAACTGTGAATGAGGAGGG + Intergenic
1111201272 13:84940451-84940473 TTGTGAACTGTGCATGCAAGGGG + Intergenic
1111351812 13:87041232-87041254 GAGAGCACTGTGCATGTGGGTGG - Intergenic
1111756480 13:92402625-92402647 TTGTGAACTGCGCATGTGAGGGG - Intronic
1112865537 13:103891972-103891994 TTGTGAACTGTGTATGTGAGGGG + Intergenic
1114818263 14:25985688-25985710 CTGTGAACTGCGCATGTGAGAGG - Intergenic
1117851363 14:59973730-59973752 GTGGGAACTGTGGATGTGGAGGG + Intronic
1117868966 14:60177703-60177725 CTGTGAAGTATGCATGTGGGGGG + Intergenic
1118901568 14:69990506-69990528 CTGTGAACTCTGTATCTGGCAGG + Intronic
1119293741 14:73516791-73516813 CTGTGAACTGCACATGTGAGGGG + Intronic
1120204483 14:81573230-81573252 CTGTGATGTGTGCATGGGGATGG + Intergenic
1120663698 14:87280434-87280456 TTGTGAACTGCACATGTGAGGGG + Intergenic
1120680650 14:87477205-87477227 TTGTGAACTGCGCATGTGAGCGG - Intergenic
1121533798 14:94677369-94677391 AGGTGCTCTGTGCATGTGGGCGG - Intergenic
1121886233 14:97545681-97545703 CTGTGAACTGCACATGTGAGGGG - Intergenic
1124517117 15:30376043-30376065 GTGTGAACAGTGTGTGTGGGTGG + Intronic
1127234657 15:57035943-57035965 TTGTGAACTGTACGTGTGGGGGG + Intronic
1127604449 15:60572287-60572309 CTGAGAAATGTGTATGTTGGGGG + Intronic
1128707261 15:69845704-69845726 CTGTGCCCTGTGTATGTGTGGGG + Intergenic
1129384985 15:75191504-75191526 GTGTGAACAGTGCAGGTGAGAGG - Intergenic
1129522836 15:76196612-76196634 CTGTGTCCTGTGCATGAGGTGGG - Intronic
1130045926 15:80444486-80444508 CTGTGAGTGGTGCATGTGTGTGG + Intronic
1131960659 15:97787256-97787278 TTGTGAACTGCACATGTGAGGGG - Intergenic
1132402801 15:101523741-101523763 CTGGGCACTGTGCATGGCGGGGG - Intronic
1133483256 16:6192496-6192518 GTGTGAGCTGTGCATGTGTATGG - Intronic
1135679259 16:24442840-24442862 TTGTGAACTGCGCATGTGAGGGG - Intergenic
1135792745 16:25412502-25412524 TTGAGAACTGAGCATTTGGGGGG - Intergenic
1139302423 16:65956785-65956807 ATGTGAACTGTGGTTGGGGGGGG + Intergenic
1139936171 16:70572729-70572751 CTGAGAACTGTGTATATGTGGGG + Exonic
1140338682 16:74136324-74136346 TTGTGAACTGTGCATGCAAGAGG - Intergenic
1140647383 16:77047624-77047646 CTGTGAACTGGACATATGGTTGG + Intergenic
1141335522 16:83151435-83151457 CTGTGAAATGTACCTATGGGAGG + Intronic
1141714582 16:85719422-85719444 TTGAGAACAGTGCTTGTGGGAGG + Intronic
1141752482 16:85968072-85968094 CTGGGAACGGGGCATGGGGGTGG + Intergenic
1143859688 17:9879660-9879682 CTGTGCACTTTACACGTGGGTGG + Intronic
1144959081 17:19034717-19034739 CTGTGATCACTGGATGTGGGTGG + Intronic
1144976078 17:19139807-19139829 CTGTGATCACTGGATGTGGGTGG - Intronic
1147190264 17:38734300-38734322 CTGGGATCTGTGCTTGTGTGAGG + Exonic
1147665026 17:42141449-42141471 CGGTGAACTGTGCATGTGAGAGG + Intronic
1147719200 17:42528050-42528072 CTGTAAACAGTGGTTGTGGGAGG - Intergenic
1147719616 17:42530941-42530963 CTGTAAACAGTGGTTGTGGGAGG - Intergenic
1148057652 17:44810700-44810722 CTCTGATCAGTGCATGTGTGGGG + Intronic
1148094643 17:45043909-45043931 TTGTGGGCTGTGCAGGTGGGAGG - Intronic
1149445668 17:56711529-56711551 CTGAGCACTGTGCCTGTGTGTGG + Intergenic
1149830524 17:59867779-59867801 GAGTGTACTGTGCATGTGGGAGG + Intronic
1150225391 17:63522044-63522066 CTGTTCACTGAGCATCTGGGTGG - Intergenic
1150312088 17:64137040-64137062 CTGTGAAAAGTGCAAGAGGGAGG + Intergenic
1150840002 17:68599295-68599317 TAGTGAACTCTGCATGTGAGTGG + Intronic
1151469457 17:74309085-74309107 CTGTGAGCTGTGGATGAGTGAGG + Intronic
1151483873 17:74386716-74386738 CTGTGAACTTTGCCTGCGGAAGG - Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152029418 17:77832476-77832498 TTGTGAACTGTGCACATGTGAGG + Intergenic
1152068020 17:78122028-78122050 CTGTTCCCTGTGGATGTGGGTGG + Intronic
1152381849 17:79946297-79946319 CTGTGAACTGAGCATGTGAGGGG - Intronic
1153015213 18:576982-577004 CAGGGCACTATGCATGTGGGCGG - Intergenic
1153495717 18:5696702-5696724 TTGTGAACTGCACATGTGAGGGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154218147 18:12430724-12430746 CTGTGTAATGTGTATGTGTGTGG + Intronic
1155261001 18:24042398-24042420 CTGTGAACTGTGCACGTGGGGGG - Intronic
1156744135 18:40368865-40368887 CTGAGAACTGGGGATGAGGGTGG - Intergenic
1157695972 18:49723978-49724000 CTGTTGACTGAGAATGTGGGAGG - Intergenic
1158294098 18:55974889-55974911 CTGTGAACTCTGTATGAGTGTGG - Intergenic
1158763110 18:60414214-60414236 TTGTGAACTGCACATGTGAGGGG - Intergenic
1159824210 18:73186685-73186707 ATGTTAACAGTGCATTTGGGTGG - Intronic
1160240396 18:77118586-77118608 CTGTGGAGTGTGTGTGTGGGTGG - Intronic
1160968846 19:1758544-1758566 CTGTAAAATGTGCGTGTGGTGGG + Intronic
1161368162 19:3893140-3893162 CTGTGCATCTTGCATGTGGGGGG + Intronic
1162659600 19:12158566-12158588 TTGTGAACTGTGCATGAAGCAGG + Intergenic
1163388836 19:17017148-17017170 TTGTGAACTGTGCATGGGAGGGG + Intronic
1165683974 19:37802148-37802170 CTGTGAACTGTGCATGTGGGGGG - Intronic
1166917483 19:46205378-46205400 CTTTCTACTGTGCATGTGGTTGG - Intergenic
924977506 2:191678-191700 CTGTGCACAGTGCTGGTGGGAGG - Intergenic
925196887 2:1932935-1932957 CTTTAGACTGTGCATGTGGTTGG - Intronic
925438480 2:3863076-3863098 TTGTGAACTGCGCATGTGAGGGG + Intergenic
927044784 2:19266129-19266151 CAGAGAACTGAGCATGTGGAAGG - Intergenic
927880319 2:26685689-26685711 GGGTGTACAGTGCATGTGGGTGG + Intergenic
929298965 2:40279807-40279829 TAGTGAACTGTGCATGTTGGGGG - Intronic
930180559 2:48351633-48351655 TTGTGAACTGTGCATGTGAGGGG - Intronic
930264917 2:49188511-49188533 CTGTGAAATTTGCATGTTAGAGG - Intergenic
932120746 2:69097187-69097209 TTGTGAACTGTGGAAGTTGGAGG - Intronic
932415524 2:71571362-71571384 CTGTGATCTGTGCATGTGCTGGG - Intronic
932415554 2:71571685-71571707 CTGTGATCTGTGCATGTGCTGGG - Intronic
932415564 2:71571831-71571853 GTGTGATCTGTGCATGTGCTGGG - Intronic
932415573 2:71571915-71571937 GTGTGATCTGTGCATGTGCTGGG - Intronic
932415613 2:71572223-71572245 GTGTGATCTGTGCATGTGCTGGG - Intronic
933648278 2:84829713-84829735 GTGGGTACTGTGCATGTGTGTGG - Intronic
934169368 2:89326543-89326565 CTGTGACCTGGGCACCTGGGAGG - Intergenic
934197926 2:89856041-89856063 CTGTGACCTGGGCACCTGGGAGG + Intergenic
934569878 2:95362597-95362619 CCGTGAACTGTGCATGCGAGGGG - Intronic
934777692 2:96949608-96949630 CTGGGGACTGTGGTTGTGGGAGG - Intronic
935762266 2:106332299-106332321 TTGTGAACTGCACATGTGAGGGG + Intergenic
937381068 2:121376815-121376837 TTATGAACTGTGCATGCGAGGGG + Intronic
938190724 2:129277736-129277758 CTGTGAGCTGTCCATAGGGGAGG - Intergenic
939959324 2:148552325-148552347 GTGTCACCTGTGCATGTGTGTGG - Intergenic
940440388 2:153708331-153708353 CTGTGGAGTGTGTATGTGAGAGG + Intergenic
941115998 2:161472807-161472829 TTGTAAACTGTGCATATGAGGGG - Intronic
941509011 2:166382766-166382788 TTGTGAACTGTGCATGTAAGGGG + Intergenic
942286899 2:174427398-174427420 ATATGAACTGTGTATGTGGAAGG - Intronic
943220663 2:185100520-185100542 CTGTGAACTGAGGGTGGGGGTGG + Intergenic
943745180 2:191454792-191454814 TTGTGAATTGTGCATGTGAGGGG - Intergenic
944709438 2:202322511-202322533 CTGTTAACTGTGCATATGGATGG - Intergenic
946650101 2:221884008-221884030 CTGAAAAATGTGCATGTTGGGGG - Intergenic
946651622 2:221897674-221897696 TGGTGAACTGTGCATTTGGCAGG - Intergenic
946903646 2:224395849-224395871 TTGTGATCTGTGCATGTGAGAGG - Intronic
947000696 2:225452785-225452807 CTGTTACGTGTGCATGTGTGTGG - Intronic
947812136 2:233011225-233011247 CTGTGCACAGTGTATGTGTGAGG - Intronic
948642938 2:239386839-239386861 GTGAGAACTGTGCATGAGAGAGG + Intronic
948753808 2:240147145-240147167 CTGTGTATTGTGTGTGTGGGGGG + Intergenic
1170135516 20:13069506-13069528 TTGTGAACTGCGCATGCGAGGGG - Intronic
1172104603 20:32509179-32509201 CTGTGAGCTGGGCATTTGTGTGG + Intronic
1173075052 20:39810494-39810516 CTGGGAACTGTGAATTTGGCTGG + Intergenic
1175725017 20:61312107-61312129 GTGTGGTGTGTGCATGTGGGTGG + Intronic
1175805840 20:61828963-61828985 TTGTGACCTGCGCATGTGGATGG - Intronic
1177081301 21:16641579-16641601 TTGTGAACTGCACATGTGAGAGG - Intergenic
1178475803 21:32936009-32936031 CTGTGAACAGCCCATGAGGGAGG - Intergenic
1180018497 21:45103541-45103563 TTGTGAACTGCGCATGTGAGGGG - Intronic
1180124810 21:45783562-45783584 CTGTGCGCTGTGCCTCTGGGAGG - Intronic
1180129602 21:45819141-45819163 CTGTGAACTCTGGACCTGGGGGG + Intronic
1180802539 22:18638537-18638559 CTGTGACCTGTTCAGGTGTGGGG - Intergenic
1180853775 22:19034093-19034115 CTGTGACCTGTTCAGGTGTGGGG - Intergenic
1181093522 22:20490726-20490748 TTGTGAACCATGCATGTGAGGGG - Intronic
1181219184 22:21356724-21356746 CTGTGACCTGTTCAGGTGTGGGG + Intergenic
1181739458 22:24909087-24909109 TTGTGAATTGTGCATGTGAGGGG + Intronic
1182236776 22:28883010-28883032 CTGGGAACTGTGAATTGGGGCGG + Intergenic
1184590752 22:45481294-45481316 TTGTGAACTGTGCATGCGAGGGG + Intergenic
1184601809 22:45548394-45548416 GTGTGAAGTATGCATGTGGCGGG - Intronic
1184703387 22:46193321-46193343 CTGTAATCTGAGCATTTGGGAGG - Intronic
1184776965 22:46628100-46628122 CTGTGTGCTGAGCATGTGGTGGG + Intronic
1185370478 22:50458702-50458724 CTGTGAAGTGTGCGTGGCGGTGG + Intronic
949209775 3:1483676-1483698 ATGTGGGCTGTGAATGTGGGAGG - Intergenic
950502649 3:13374094-13374116 GTGTGCACTGTGGATGTGAGTGG - Intronic
950778040 3:15367242-15367264 CTGTGAAGTGAGCTTGTTGGGGG + Intergenic
952421478 3:33135369-33135391 CTGTGATCTCAGCATTTGGGAGG + Intronic
952474000 3:33686450-33686472 TTTTGAACTGTGCATGCGAGGGG + Intronic
952474324 3:33690987-33691009 TTGTGAACTGTGCATATTGAGGG - Intronic
952600225 3:35071012-35071034 TTGTGAACTGCTCATGTGAGGGG + Intergenic
953682650 3:45051479-45051501 CTGTGTACTTTACCTGTGGGAGG + Intergenic
955445458 3:59005291-59005313 GCTTGAACTGTGCATGTGGCTGG - Intronic
956251732 3:67240999-67241021 CTATTAAGTGTGTATGTGGGGGG - Intergenic
956695188 3:71912773-71912795 TTGTGAACAGAGCATGTGAGGGG - Intergenic
956733983 3:72222505-72222527 TTGTGAACTGTGCATGCGAGGGG - Intergenic
956808551 3:72841803-72841825 CTGTGAACTGTGCCTGCGAAGGG - Intronic
957286332 3:78222021-78222043 CTGTGACCTGTGCAGATGGCTGG + Intergenic
957526144 3:81380559-81380581 CAGTGGGCTGGGCATGTGGGTGG - Intergenic
959230572 3:103645833-103645855 ATGTGCACTGTTCATGTGGCAGG + Intergenic
960672898 3:120169245-120169267 TTGTGAACTGCACATGTGAGGGG + Intronic
962364944 3:134772651-134772673 CTGCCAACTGCACATGTGGGAGG + Intronic
963752536 3:149197749-149197771 TTGTGAACTGTGCATGTGAGGGG - Intronic
964297971 3:155254602-155254624 CTGAGAACTGAGAGTGTGGGTGG - Intergenic
965516196 3:169624112-169624134 CTGTGACCTGGGCATGTGTCAGG - Intronic
967385465 3:188906595-188906617 CTGTGAACTACGGATGTGGTGGG - Intergenic
967529640 3:190533661-190533683 CTGTGACCAGAGCACGTGGGAGG + Intronic
968787604 4:2634395-2634417 CTGTGAGCTGCTCATTTGGGGGG - Intronic
968855775 4:3120622-3120644 TTGTGAACTGCACATGTGAGGGG + Intronic
969410995 4:7028082-7028104 CTGTGATAGGTGTATGTGGGGGG - Intronic
970955580 4:21807102-21807124 GTGTGAACTGTGCATGTGAAGGG - Intronic
971127794 4:23773421-23773443 CTTTGAATTGTCCATTTGGGGGG - Intronic
972837651 4:42893236-42893258 CTGTAAACTGTTCATATGGGTGG + Intergenic
976514812 4:85953238-85953260 GTGTGAACTGAGTATGTGGGTGG - Intronic
976966119 4:91043450-91043472 ATGTGGACTGTGCATTTGGTTGG - Intronic
977151203 4:93514406-93514428 GTGTGTACTGTGGAGGTGGGGGG - Intronic
977177488 4:93834798-93834820 CTGTGAGCTCTGCTGGTGGGGGG - Intergenic
977265426 4:94848297-94848319 CTGTAAATTGGGCATGTTGGGGG - Intronic
977540627 4:98314142-98314164 TTCTGATGTGTGCATGTGGGAGG + Intronic
977699837 4:100008625-100008647 TTGTGAACTGTGCATGCGAGGGG - Intergenic
977722467 4:100255510-100255532 CAGGGAACTGTGCAGTTGGGTGG + Intergenic
977876694 4:102158133-102158155 TTGTGAACTGTGCATGCAAGGGG - Intergenic
978623170 4:110654967-110654989 CTGTGAACTGTGCATGCGAGGGG - Intergenic
979223604 4:118259248-118259270 CAGTGAGCTGTGTGTGTGGGAGG - Intergenic
979315952 4:119263515-119263537 TTGTGATTTGTGCATGTGAGGGG + Intronic
979699563 4:123652832-123652854 CTGTGATCTGTGGATGAGGGTGG + Intergenic
979798294 4:124875270-124875292 GAGTGCACTGTGCATGTGGGCGG - Intergenic
981107612 4:140899024-140899046 GTGTTAACTGTGCATGTTGTTGG + Intronic
981839985 4:149100486-149100508 TTGAGATATGTGCATGTGGGTGG + Intergenic
982162280 4:152582222-152582244 ATTTGAACCATGCATGTGGGAGG - Intergenic
982750573 4:159156643-159156665 CTGGGGCCTGTCCATGTGGGTGG - Intronic
985181546 4:187270128-187270150 CTCTGCACTGTGTGTGTGGGGGG - Intergenic
985587228 5:746754-746776 CTGTGTGCTGAGCACGTGGGGGG - Intronic
985684467 5:1274578-1274600 CTGAGAACTGTGCGTGAGAGGGG - Intronic
986023244 5:3824682-3824704 CTGTTAACTGAGGATGTGGATGG + Intergenic
987039741 5:14051144-14051166 CTGAGATCTGTACATGTGGTTGG - Intergenic
987776530 5:22373415-22373437 CAGTGAGCTGGGCATGTGAGAGG - Intronic
988859694 5:35264588-35264610 TGGGGAAATGTGCATGTGGGGGG + Intergenic
989589224 5:43098031-43098053 CTGTGAACAGTGCATGCTGGTGG - Intronic
991317957 5:65332499-65332521 CTGTGAACAGTAAATATGGGGGG + Intronic
995861605 5:116646958-116646980 TTGTGAACTGTGCATGTGAGGGG - Intergenic
997443542 5:133925597-133925619 CTGTGGACTTTACATGTTGGTGG - Intergenic
999333946 5:150699075-150699097 CTGGCAACTGTTTATGTGGGAGG - Intronic
1000889476 5:166786012-166786034 TTGTGTACTGAGCATGTGGTAGG - Intergenic
1002410403 5:179070169-179070191 TTGTGAACTGCGCACGTGAGGGG + Intronic
1004436550 6:15600701-15600723 CTGAGAACTGAGCAGGTGGTAGG + Intronic
1006258264 6:32848218-32848240 CAGAAATCTGTGCATGTGGGAGG - Intronic
1006305015 6:33213571-33213593 CAGAGAACTGAGCATGGGGGAGG - Intergenic
1006451076 6:34106033-34106055 GAGTGCACTGTGCATGTGTGTGG - Intronic
1006992359 6:38226254-38226276 CTTTGAACTGTGCAGGCGCGGGG - Intronic
1007097640 6:39223704-39223726 CTCTGAACTGTGTGTGTGGTTGG - Intronic
1011786997 6:90857997-90858019 CCCTGAACTTTGCATGTGGAGGG - Intergenic
1017125469 6:151060422-151060444 CTGTGAACTCTGCAAGTGCAAGG - Intronic
1017547159 6:155464923-155464945 TTGTGAACTGTGTGTGTGAGGGG - Intergenic
1018349762 6:162943958-162943980 CTGTGGGCTGGGCAGGTGGGTGG - Intronic
1018905768 6:168074991-168075013 GTGTGCACTGTGCATGTGTGTGG + Intronic
1018968118 6:168504465-168504487 TTGTGAACTGCGCATCTGAGGGG - Intronic
1019351028 7:554043-554065 CTGGGAGCTGTTCCTGTGGGTGG - Intronic
1019466400 7:1191840-1191862 TTGTGAACTGTGCATGCGAGGGG + Intergenic
1019528233 7:1490597-1490619 CTGCGATCCGTGCACGTGGGAGG - Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1020543641 7:9494036-9494058 CTGGGAACTGTGCATGGGGTTGG - Intergenic
1024627998 7:51224915-51224937 GGGTGACCTGTGCGTGTGGGCGG + Intronic
1024693529 7:51829565-51829587 TATTGAACTGTGCATGTGGAAGG + Intergenic
1025019137 7:55467050-55467072 TTGTGAACTGTGCAGGAGAGAGG - Intronic
1026112280 7:67468016-67468038 TTGTGAACTGCACATGTGCGAGG + Intergenic
1026447228 7:70495552-70495574 ATGTGACGTGTGCATGTGCGGGG - Intronic
1026447235 7:70495631-70495653 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447242 7:70495712-70495734 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447249 7:70495793-70495815 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447256 7:70495866-70495888 ATGTGACATGTGCATGTGTGGGG - Intronic
1026447262 7:70495945-70495967 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447273 7:70496026-70496048 ATGTGACGTGTGCATGTGTGTGG - Intronic
1026447278 7:70496103-70496125 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447285 7:70496184-70496206 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447289 7:70496254-70496276 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447296 7:70496335-70496357 ATGTGACATGTGCATGTGTGGGG - Intronic
1026447303 7:70496412-70496434 ATGTGACATGTGCATGTGTGGGG - Intronic
1026447309 7:70496482-70496504 ATGTGACGTGTGCATGTGTGTGG - Intronic
1026447314 7:70496565-70496587 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447322 7:70496640-70496662 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447329 7:70496717-70496739 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447336 7:70496796-70496818 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447342 7:70496866-70496888 ATGTGACGTGTGCATGTGTGTGG - Intronic
1026447347 7:70496945-70496967 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447353 7:70497028-70497050 ATGTGATGTGTGCATGTGTGGGG - Intronic
1026447359 7:70497111-70497133 ATGTGACGTGTGCATGTGTGGGG - Intronic
1026447376 7:70497277-70497299 ATGTGACGTGTGCATGTGTGTGG - Intronic
1026481366 7:70782408-70782430 CTGTCAAGTGTGCGTGTGGAAGG + Intronic
1026523613 7:71136335-71136357 CAGTGCACTGTGCATGTAAGAGG + Intronic
1027554424 7:79645814-79645836 CTGTGATCTGTGAGTGTGGTTGG + Intergenic
1028147492 7:87334480-87334502 TTGTGAACTGTGCATGCAAGGGG - Intergenic
1028625381 7:92871348-92871370 CTGTGAGATGTGCAAGTGGAAGG + Intergenic
1028798906 7:94938219-94938241 TTGTGAACTCTGCATGTGGAGGG + Intronic
1029232070 7:99078686-99078708 TTGTGAACTGCGCATGCGAGGGG + Intronic
1029598883 7:101552319-101552341 CTGTGAGCTGGGCATGGTGGTGG + Intronic
1030139898 7:106293631-106293653 TTGTGAACTGTGCATGCAAGGGG + Intergenic
1030384870 7:108856522-108856544 CTGTAAACAGTGAATGAGGGAGG - Intergenic
1030948815 7:115763425-115763447 CTGTGAACTGCGCATGTGAGGGG - Intergenic
1031120151 7:117713055-117713077 TTGTGAATTGTGCAAGTGAGGGG + Intronic
1032046920 7:128618897-128618919 CTGTGAACTCTCCATGTGTCAGG + Intergenic
1032086121 7:128884780-128884802 CTGTGAAGTGTGCATCTGCGAGG - Exonic
1032740013 7:134729536-134729558 ATGGGAACTGTGCCTGTGAGGGG + Intergenic
1032818298 7:135499752-135499774 CTGTCACCAGTGTATGTGGGAGG - Intronic
1034226381 7:149487108-149487130 TTGTGAACTGTGCATGCGAGGGG + Intronic
1037560623 8:20071401-20071423 CTGTGAACTGTGCGTGTAAGGGG + Intergenic
1038403016 8:27299803-27299825 CAGTGCATTTTGCATGTGGGAGG + Intronic
1038407143 8:27330611-27330633 CTGCGAGCTGTGCAAGGGGGCGG + Intronic
1038476808 8:27874394-27874416 CTGTGGACTGTGGCTGTGTGAGG - Intronic
1038507357 8:28096087-28096109 TTGTGAACCGTGCATGTGGTGGG + Intronic
1039901197 8:41753695-41753717 CTGGGAACTATGGGTGTGGGAGG - Intronic
1041930806 8:63284480-63284502 TTGTGAACTGCGCATGTGAGGGG + Intergenic
1042004055 8:64161003-64161025 CTGAGAAATGTGCATGTGTTTGG + Intergenic
1045225745 8:100243928-100243950 CTGTAAATTGTGCATCTGGAAGG + Intronic
1046951647 8:120025182-120025204 CTGTGATATGTGCATTTGGCAGG + Intronic
1048232076 8:132652210-132652232 CTGTGTACTCTGCAAGTGGGTGG - Intronic
1048407612 8:134139148-134139170 CTGTGAACTGGTCATATGGTCGG + Intergenic
1048632779 8:136262121-136262143 CTGGGAAGTGTGGGTGTGGGTGG + Intergenic
1048778565 8:137975752-137975774 CTCTGAATTGTGCATGTGTTGGG + Intergenic
1049043793 8:140132738-140132760 CTGGGAAAGGTGCAAGTGGGAGG + Intronic
1049175831 8:141192321-141192343 CTGTTACCTGTGCCTGTGGAAGG - Exonic
1049306151 8:141905349-141905371 CTGTGAACTGGCCATGGAGGAGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1050558801 9:6812552-6812574 TTGTGAACTGTGCATGTGAGGGG - Intronic
1050800324 9:9603617-9603639 TTGTGAACAGTGCATGTGTGAGG + Intronic
1052102340 9:24463992-24464014 CTGTGAATTATGCATGTTTGAGG + Intergenic
1052192607 9:25677451-25677473 AGGGGAACTGTACATGTGGGAGG + Exonic
1052997822 9:34560569-34560591 TTGCAAACTGTGCATGTGGGAGG + Intronic
1053017122 9:34668232-34668254 AAGAGAACAGTGCATGTGGGTGG - Intergenic
1055445530 9:76378377-76378399 CTGTGAGCTGTGGATGCTGGAGG - Intergenic
1057179949 9:93024418-93024440 ATGTGAGCTGTGTGTGTGGGAGG - Intronic
1057365377 9:94415702-94415724 CTCTGAACTGTGCATGTTAGGGG - Intronic
1057657943 9:96972373-96972395 CTCTGAACTGCGCATGTGAGGGG + Intronic
1057775591 9:98006021-98006043 TTGTGAACTGCACATGTGAGGGG + Intronic
1057977602 9:99622785-99622807 TTGTGAACTGCGCATGTGAGGGG - Intergenic
1058190945 9:101914984-101915006 TTGTGAACTGGGCATGTGAAGGG - Intergenic
1058910792 9:109518325-109518347 CTGTGAACTCTGCAGGAGGTGGG - Intergenic
1059459444 9:114420594-114420616 CTCTGGACTGTGCATGTGGAGGG + Intronic
1059715028 9:116905578-116905600 CTGGGCACTGTGAATGTGAGGGG - Intronic
1059746305 9:117204986-117205008 CTGGGCACTGTCTATGTGGGAGG + Intronic
1060895228 9:127212776-127212798 CTGTGAACTGTGGAGGATGGGGG + Intronic
1061235475 9:129339793-129339815 CTGTGAGTTGTGTATGAGGGAGG + Intergenic
1061936712 9:133861916-133861938 CTGGGATATTTGCATGTGGGTGG - Intronic
1062716779 9:138014623-138014645 CTGTGAGCTCTGCAGGTGGGTGG + Intronic
1185444875 X:252577-252599 AGGTGATCTCTGCATGTGGGTGG + Intergenic
1185444899 X:252705-252727 AGGTGATCTCTGCATGTGGGTGG + Intergenic
1185785057 X:2883880-2883902 CCGTGAACTGTGCATGTGAGGGG - Intergenic
1185906760 X:3940750-3940772 CTTTGCACTGTGAATGTAGGAGG + Intergenic
1186616867 X:11197881-11197903 CTGTCAACTTAGCATGTGGGAGG + Intronic
1186816209 X:13240470-13240492 CTGGGAACTGGGCAGGTAGGAGG - Intergenic
1187693257 X:21893214-21893236 TTGTGAACTGTGCATGCAAGGGG - Intergenic
1188773484 X:34184491-34184513 AAGTGTACTCTGCATGTGGGAGG + Intergenic
1190397935 X:50003555-50003577 CTGCAAACCCTGCATGTGGGAGG - Intronic
1190751782 X:53368283-53368305 CTGTGAATTGTGCACAAGGGAGG - Intergenic
1193135684 X:77968790-77968812 GTGTGACATGTGCAGGTGGGAGG + Intronic
1193669670 X:84368895-84368917 TTGTGAACTGTGCATGCAAGGGG - Intronic
1194601071 X:95922708-95922730 TTGTGAACTGTGCATGTGAGGGG - Intergenic
1195516180 X:105778811-105778833 CTATGAAATGTGTATGGGGGAGG - Intergenic
1195804653 X:108750196-108750218 ATGTGAAGGGTGCATGTGTGTGG - Intergenic
1196097739 X:111817648-111817670 CTGTGAACTGTGAAGTTGGCAGG + Intronic
1198231377 X:134692810-134692832 CTCTGAGTTGTGCGTGTGGGGGG - Intronic
1200141097 X:153903474-153903496 GTGTGATGTGTGCATGTGTGTGG + Intronic
1200957817 Y:8969730-8969752 CTGTTGACAGTGCCTGTGGGTGG + Intergenic