ID: 1165692580

View in Genome Browser
Species Human (GRCh38)
Location 19:37875088-37875110
Sequence CTCCTGCCATGTCACCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165692574_1165692580 21 Left 1165692574 19:37875044-37875066 CCTGTGAGGCAAGAAACTCTGTT No data
Right 1165692580 19:37875088-37875110 CTCCTGCCATGTCACCTGTAGGG No data
1165692572_1165692580 23 Left 1165692572 19:37875042-37875064 CCCCTGTGAGGCAAGAAACTCTG No data
Right 1165692580 19:37875088-37875110 CTCCTGCCATGTCACCTGTAGGG No data
1165692573_1165692580 22 Left 1165692573 19:37875043-37875065 CCCTGTGAGGCAAGAAACTCTGT No data
Right 1165692580 19:37875088-37875110 CTCCTGCCATGTCACCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165692580 Original CRISPR CTCCTGCCATGTCACCTGTA GGG Intergenic
No off target data available for this crispr