ID: 1165693549

View in Genome Browser
Species Human (GRCh38)
Location 19:37883284-37883306
Sequence TCATTAAGTCCCTAAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165693548_1165693549 -1 Left 1165693548 19:37883262-37883284 CCTTAATTGCTAGAAGGAAGGTT No data
Right 1165693549 19:37883284-37883306 TCATTAAGTCCCTAAGTAACTGG No data
1165693545_1165693549 21 Left 1165693545 19:37883240-37883262 CCTTTTGCTTTAACTCTTGTCTC No data
Right 1165693549 19:37883284-37883306 TCATTAAGTCCCTAAGTAACTGG No data
1165693544_1165693549 27 Left 1165693544 19:37883234-37883256 CCTACTCCTTTTGCTTTAACTCT No data
Right 1165693549 19:37883284-37883306 TCATTAAGTCCCTAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165693549 Original CRISPR TCATTAAGTCCCTAAGTAAC TGG Intergenic