ID: 1165695292

View in Genome Browser
Species Human (GRCh38)
Location 19:37896058-37896080
Sequence CTGTTAGCCCAGATTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165695292_1165695300 16 Left 1165695292 19:37896058-37896080 CCTTTGTCAATCTGGGCTAACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1165695300 19:37896097-37896119 CTTGGAGAATGGGCCAAGAAGGG 0: 1
1: 1
2: 1
3: 20
4: 200
1165695292_1165695295 -9 Left 1165695292 19:37896058-37896080 CCTTTGTCAATCTGGGCTAACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1165695295 19:37896072-37896094 GGCTAACAGTTATATGGGCATGG 0: 1
1: 0
2: 0
3: 3
4: 81
1165695292_1165695296 -2 Left 1165695292 19:37896058-37896080 CCTTTGTCAATCTGGGCTAACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1165695296 19:37896079-37896101 AGTTATATGGGCATGGCTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 191
1165695292_1165695299 15 Left 1165695292 19:37896058-37896080 CCTTTGTCAATCTGGGCTAACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1165695299 19:37896096-37896118 TCTTGGAGAATGGGCCAAGAAGG 0: 1
1: 0
2: 0
3: 22
4: 219
1165695292_1165695301 25 Left 1165695292 19:37896058-37896080 CCTTTGTCAATCTGGGCTAACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1165695301 19:37896106-37896128 TGGGCCAAGAAGGGTAAGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 284
1165695292_1165695298 6 Left 1165695292 19:37896058-37896080 CCTTTGTCAATCTGGGCTAACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1165695298 19:37896087-37896109 GGGCATGGCTCTTGGAGAATGGG 0: 1
1: 0
2: 1
3: 6
4: 141
1165695292_1165695297 5 Left 1165695292 19:37896058-37896080 CCTTTGTCAATCTGGGCTAACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1165695297 19:37896086-37896108 TGGGCATGGCTCTTGGAGAATGG 0: 1
1: 0
2: 1
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165695292 Original CRISPR CTGTTAGCCCAGATTGACAA AGG (reversed) Intronic
901942541 1:12674557-12674579 CTGTTAGCCCTGCTAGATAAAGG + Intergenic
905406265 1:37734631-37734653 CTGCAACCACAGATTGACAATGG + Intronic
917347995 1:174048803-174048825 CTATTAGCCCAGTTGGACAGAGG + Intergenic
917964340 1:180169047-180169069 CTGTTTGCTCATAGTGACAAGGG - Intronic
1064055520 10:12094019-12094041 CAGTTAACCCAGAATGACACTGG - Intronic
1076195108 10:128512214-128512236 GTGTCAGCCCAGATTTGCAAAGG - Intergenic
1078313104 11:10266125-10266147 CTTTTATCCCAGATTTACAGAGG + Intronic
1080637210 11:34134564-34134586 CTGTTCACCCAGATTATCAAGGG + Exonic
1085841073 11:80012575-80012597 CTATTAGCCCAGATTGCTGAGGG + Intergenic
1085976587 11:81662014-81662036 GTGTGAGCCCAGATTAAAAATGG + Intergenic
1087659085 11:100964752-100964774 TTTTTAGCCCATAATGACAACGG - Intronic
1087662834 11:101007841-101007863 CTGTTAGTCAAGAATGACTAAGG - Intergenic
1088161190 11:106872964-106872986 CTGTGAGACCACATTGACACAGG - Intronic
1089340394 11:117753439-117753461 CTTATAGCACAGGTTGACAACGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091606479 12:1956921-1956943 CTGTTAGCCCATATGGATATGGG - Intronic
1094004469 12:25734037-25734059 CTGTTATCCCAGAGTAACCATGG - Intergenic
1097064357 12:56309820-56309842 CTTATAGTCCAGATTGACAATGG + Intronic
1103136374 12:118511316-118511338 ATGTTATCCCTGTTTGACAAAGG - Intergenic
1110474095 13:75892935-75892957 CTATTAGACCACATTGACCATGG - Intergenic
1114598195 14:23932272-23932294 CATGTAGCCCAGATTGAGAAGGG - Intergenic
1118562851 14:67105968-67105990 CTGGTAGACCAGATTAATAAAGG - Intronic
1119714712 14:76850808-76850830 CAGTGAGCCGAGATTGTCAAGGG + Intronic
1120793088 14:88603253-88603275 CTGTTACTCCAGTTTGAAAACGG + Intronic
1126365111 15:47886297-47886319 CTGGTAGCCCAGAGTGGCACGGG + Intergenic
1130884355 15:88081076-88081098 CTTCTAGCACAGATTGGCAAAGG + Intronic
1136274371 16:29169793-29169815 CTGTTGGCCCAGATCGACCCTGG - Intergenic
1136458758 16:30397228-30397250 CTGTGACCACAGATTGTCAAGGG + Intronic
1140509313 16:75495582-75495604 CTTTTAGCCCAGAATGTCAAAGG + Intergenic
1142078652 16:88135439-88135461 CTGTTGGCCCAGATCGACCCTGG - Intergenic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1148961032 17:51392940-51392962 CTGTGTGCCCAAATTGACTACGG - Intergenic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1153540627 18:6150323-6150345 CTGTTAGGCTAGTTTGAGAAGGG - Intronic
1154384190 18:13878898-13878920 CTGTCATCCCAGAGTGACAGTGG - Intergenic
1156127193 18:33920797-33920819 CTGTCAGCCCAGACTGAAAAGGG + Intronic
1159985073 18:74831966-74831988 GTGTTAGTCCAGACTGACAGCGG - Intronic
1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG + Intronic
1162339085 19:10080869-10080891 CTGTAATCCCAGCTTCACAAGGG + Intergenic
1165695292 19:37896058-37896080 CTGTTAGCCCAGATTGACAAAGG - Intronic
1168150397 19:54444330-54444352 CTGCTATCCAAGATTTACAAAGG + Intergenic
928614818 2:33027199-33027221 TTTTTATCCCAGATTGACTAAGG + Intronic
931381017 2:61753354-61753376 CTGTTAGCCCAGAATGATTTGGG + Intergenic
940368902 2:152878460-152878482 CTGTAGGCCCTGATTGCCAAAGG + Intergenic
942077152 2:172366490-172366512 CTGTTAGCCAAGACTGAGAAAGG - Intergenic
945955753 2:216084223-216084245 CTGCTAGCTCAGACTGACAGGGG + Intronic
947158127 2:227184263-227184285 CAGTTACCCAAGATGGACAAGGG + Intronic
1171164680 20:22959293-22959315 CTGTTAACCCAACTTGAAAATGG - Intergenic
1171187600 20:23133928-23133950 CTGTTTGCCCTGATTGACATGGG - Intergenic
1171452515 20:25246453-25246475 CTATTACCCCCGCTTGACAATGG - Intergenic
1175188289 20:57194739-57194761 CTGTGACCCCACATTTACAAAGG + Intronic
1184783655 22:46661509-46661531 CTGTAGGCCCAGGTTAACAATGG + Intronic
1184814742 22:46861016-46861038 CAGTGAGCCAAGATTGACCAGGG - Intronic
950498697 3:13350095-13350117 CAGTCATCCCAGAGTGACAAAGG + Intronic
952212515 3:31242495-31242517 CTGTTTGACCATATTGAGAAGGG - Intergenic
965367950 3:167822034-167822056 CTTTTAGACGAGATTGACATTGG - Intronic
967463263 3:189772703-189772725 CTGTTAGACAAGATTATCAAGGG - Intronic
974596358 4:64017836-64017858 CTTTTAGCCTAGATTGAAAGTGG - Intergenic
978373247 4:108050375-108050397 GTGTTAGCCCTGCTTGAGAATGG + Intronic
978373333 4:108050882-108050904 GTGTTAGCCCTGCTTGAGAATGG - Intronic
980472861 4:133271545-133271567 TTGTTAGCCTAGTTTGAAAAAGG + Intergenic
984218678 4:176946348-176946370 CTGTTGTGCCTGATTGACAATGG + Intergenic
984231246 4:177102447-177102469 CTGATAGCCCAGAAATACAAAGG + Intergenic
990664440 5:58055652-58055674 CTGGTAGGGCATATTGACAATGG - Intergenic
990822382 5:59857200-59857222 GTGTAAACCCAGATTGACCAAGG - Intronic
994096802 5:95854532-95854554 AGGTTAGCCCAGATTCAAAAGGG + Intronic
1000296133 5:159915259-159915281 CTGTTCGCCCAAGTTCACAAAGG - Intergenic
1001890324 5:175333047-175333069 CTGTTACCCCTGATTCTCAATGG + Intergenic
1004635994 6:17468235-17468257 TTGACAGCCCTGATTGACAATGG + Intronic
1006443012 6:34063689-34063711 CTGTGACCCCAGACTGACAGGGG - Intronic
1007777986 6:44234368-44234390 CTGTTAGCCAAGACTAAGAACGG + Intergenic
1008088074 6:47264958-47264980 CTGTCAGCCCAGATTTCCTATGG - Intronic
1008408700 6:51147981-51148003 TTATTAGCCCAGCTAGACAAAGG + Intergenic
1010605052 6:77878524-77878546 CTTTAAGCCCAGATTGTTAATGG - Intronic
1012723498 6:102779826-102779848 GTGTTATCCCAGATTGAGGAAGG + Intergenic
1014163770 6:118200615-118200637 CTTTTAGCCCAGATTTTTAAGGG + Intronic
1018117914 6:160606031-160606053 CTGTTAGCCCTGTTTCTCAAGGG + Intronic
1020447941 7:8289107-8289129 CTGTTAGCTCAAATTAATAAGGG + Intergenic
1024266346 7:47609800-47609822 CTGTGACCCCACATTGTCAATGG + Intergenic
1024439290 7:49397229-49397251 CAATTAGGCCAGACTGACAAAGG + Intergenic
1036402736 8:8424877-8424899 CAGCAATCCCAGATTGACAAAGG - Intergenic
1037515216 8:19624203-19624225 CTGATAGCCCTTATTGTCAAGGG + Intronic
1044627852 8:94251811-94251833 CAGGTAGACCAGATGGACAAGGG + Intronic
1051519053 9:17963732-17963754 CTGTTAGGCTAGAGGGACAAAGG - Intergenic
1060079991 9:120634884-120634906 CTGTTAGAAAAGATGGACAAAGG - Intronic
1061255338 9:129451907-129451929 CTGTTAGCCAAGATGGCCCAGGG + Intergenic
1061667290 9:132168072-132168094 CTGTATGACCAGAATGACAACGG - Intronic
1187205053 X:17174246-17174268 CTGTTAACCCTATTTGACAAAGG - Intergenic
1187613209 X:20965308-20965330 CTGTGAGACAAGATTGACAAAGG - Intergenic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1199879963 X:151966171-151966193 CTTTTTCCCCAGTTTGACAAAGG + Intronic
1201597971 Y:15693584-15693606 CTGTGAACACAGCTTGACAAGGG + Intergenic
1201609282 Y:15823029-15823051 CTGTTAGCCCTAAATGACAGTGG - Intergenic