ID: 1165698300

View in Genome Browser
Species Human (GRCh38)
Location 19:37918048-37918070
Sequence TTACATTGGTGTCGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165698295_1165698300 4 Left 1165698295 19:37918021-37918043 CCAGTTTGTCAGCATTAATCTCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165698293_1165698300 28 Left 1165698293 19:37917997-37918019 CCTGTCTCAAAAAAAAAAGAAGT 0: 7
1: 289
2: 2379
3: 21293
4: 32639
Right 1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165698294_1165698300 5 Left 1165698294 19:37918020-37918042 CCCAGTTTGTCAGCATTAATCTC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165698292_1165698300 29 Left 1165698292 19:37917996-37918018 CCCTGTCTCAAAAAAAAAAGAAG 0: 42
1: 1210
2: 17324
3: 26696
4: 58934
Right 1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165698300 Original CRISPR TTACATTGGTGTCGGTGTGC TGG Intronic
905464756 1:38144488-38144510 TAACATTGGAGTCGGTGGGCTGG + Intergenic
909794356 1:79714620-79714642 TTAAAATGGTGTGGGGGTGCTGG - Intergenic
909811246 1:79933833-79933855 TAACATTTGAGTCGGTGGGCTGG + Intergenic
910497375 1:87846844-87846866 TAACATTTGAGTCGGTGGGCCGG + Intergenic
911037462 1:93566003-93566025 TTACTCTGGTGTCTGTGTGGAGG - Intronic
911536227 1:99104564-99104586 TTACATTGGTGTCCTTGAGGTGG - Intergenic
912657762 1:111503162-111503184 TGACATTGCTGTTGGGGTGCTGG - Exonic
912908433 1:113732030-113732052 CTACATTTGTGTATGTGTGCTGG + Intronic
917389523 1:174519512-174519534 TAACATTGGAGTCAGTGGGCTGG - Intronic
917682109 1:177377846-177377868 TAACATTTGAGTCAGTGTGCTGG + Intergenic
924190577 1:241547869-241547891 TAACATTTGTGTGTGTGTGCAGG - Intronic
1064186981 10:13170468-13170490 TTTCATGGAAGTCGGTGTGCGGG + Intronic
1071377944 10:85029793-85029815 TAACATTGGAATCAGTGTGCTGG + Intergenic
1071943246 10:90611363-90611385 TTACATTTGAGTCAGTGAGCTGG - Intergenic
1076996622 11:300160-300182 TAACACTGGTGTCGGGATGCAGG + Intergenic
1077296534 11:1829012-1829034 CTCCATTGGTGTCAGTGTGTGGG - Intronic
1079182713 11:18208088-18208110 TTAAATTGGTGTCCTTGTGGGGG - Intronic
1086053765 11:82624596-82624618 TAACATTTGAGTCGGTGAGCTGG + Intergenic
1088045640 11:105448035-105448057 TTAAATTGGTGTCTTTGTGGTGG - Intergenic
1088412672 11:109552539-109552561 TTACGTTGTTGTAGGTATGCCGG + Intergenic
1089752535 11:120661580-120661602 TTGCATTCAGGTCGGTGTGCTGG + Intronic
1090251474 11:125254784-125254806 TAACATTGATGACGGTGTCCAGG + Intronic
1091270930 11:134311343-134311365 TGACCTTGGAGTCAGTGTGCAGG + Intronic
1095391686 12:41714659-41714681 TTGCTTTGGTGTCAGTGTGCAGG + Intergenic
1095557030 12:43519670-43519692 TTACCATGGGGTAGGTGTGCCGG - Intronic
1097513351 12:60571177-60571199 TAACATTTGAGTCGGTGAGCTGG + Intergenic
1100551380 12:95649489-95649511 TTACAATGGGGTGTGTGTGCAGG + Intergenic
1104103384 12:125636171-125636193 TTAAATTGGTGTCCTTGTGGTGG + Intronic
1107400756 13:40066632-40066654 TAACATTGGAGTCAGTGGGCTGG - Intergenic
1107450704 13:40506536-40506558 AGACATTGGTGTCTGTGTGTTGG + Intergenic
1109843745 13:67956247-67956269 TTACATTCGTGTGTGTGTGTAGG + Intergenic
1116221013 14:42086658-42086680 TTAAATTGGTGTCCTTGTGGTGG + Intergenic
1116302292 14:43199172-43199194 TAACATTTGAGTCGGTGTACTGG + Intergenic
1117110029 14:52443098-52443120 TAACATTTGAGTCGGTGGGCTGG + Intronic
1124160537 15:27264545-27264567 TTAGGTTGGTGTTGATGTGCTGG - Intronic
1126216026 15:46156324-46156346 TTAAATTGGTGTCCTTGTGTGGG - Intergenic
1129237185 15:74230700-74230722 ATACATTGGTGTAAGTGTGAGGG + Intergenic
1134443015 16:14310620-14310642 TCCCAGTGGTGTCGGTGAGCAGG - Intergenic
1135072972 16:19368581-19368603 TAACATTTGAGTCGGTGGGCTGG - Intergenic
1135202677 16:20452205-20452227 TAACATTTGAGTCGGTGGGCTGG + Intronic
1135216423 16:20575661-20575683 TAACATTTGAGTCGGTGGGCTGG - Intronic
1137758643 16:50922635-50922657 TTCCATTGGTTTCGTTATGCCGG - Intergenic
1139103964 16:63802991-63803013 TTAAATTGGTGTCTTTGTGGGGG + Intergenic
1141547600 16:84781707-84781729 TAACATTTGTGTCAGTGGGCTGG + Intergenic
1149054544 17:52347332-52347354 TTAAATTGGTGTCCTTGGGCAGG + Intergenic
1155757181 18:29513950-29513972 TTAGATGGCTGTAGGTGTGCAGG + Intergenic
1157888205 18:51389182-51389204 TAACATTTGTGTCAGTGGGCTGG - Intergenic
1159131649 18:64287005-64287027 TAACATTGGAGTCAGTGGGCTGG - Intergenic
1159204223 18:65229297-65229319 TAACATTGGAGTCAGTGGGCTGG - Intergenic
1159613253 18:70549697-70549719 TAACATTTGAGTCAGTGTGCTGG + Intergenic
1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG + Intronic
1167548437 19:50143236-50143258 ATACATTGGTGGCAGTTTGCAGG - Intergenic
1167813354 19:51854762-51854784 TTACATATGTGTTGGTGTGCTGG + Intergenic
926755044 2:16227601-16227623 TTGCATAGGTGTCTGTGTTCTGG - Intergenic
927350036 2:22100263-22100285 TAACATTGGAGTCAGTGTACTGG - Intergenic
927643919 2:24863202-24863224 TAACATTTGAGTCGGTGGGCTGG + Intronic
930426670 2:51221756-51221778 TTTCATTGTTGTTGGTGGGCTGG + Intergenic
933108505 2:78365163-78365185 TTACATTTGTGTGTGTGTGTCGG - Intergenic
933279538 2:80317772-80317794 TTAGATTGGTGTTGTAGTGCAGG - Intronic
941507751 2:166368624-166368646 TTACATAGGTAAAGGTGTGCCGG - Intronic
943249221 2:185495691-185495713 TGACAGTGGTGTATGTGTGCAGG + Intergenic
947555546 2:231089880-231089902 TAACATTGGAGTCAGTGGGCTGG - Intronic
947993452 2:234505918-234505940 TAACATTTGAGTCGGTGGGCTGG - Intergenic
948376505 2:237524587-237524609 TAACATTGGAGTCAGTGGGCTGG - Intronic
1172190413 20:33058979-33059001 TTGCATTTGTGTGAGTGTGCAGG + Intronic
1173098795 20:40064493-40064515 TTAAATTGGTGTCCTTGTGAGGG - Intergenic
1174005907 20:47410526-47410548 TTCCATTGGTGTTGCTGTGCTGG + Intergenic
1174831865 20:53820678-53820700 TTAAATTGGTGTCCTTGTGCGGG + Intergenic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1177990394 21:28029615-28029637 TAACATTTGAGTCGGTGGGCTGG + Intergenic
1178012147 21:28301026-28301048 TAACATTTGAGTCAGTGTGCTGG + Intergenic
1180999617 22:19981929-19981951 ATACCTTGGTCTCGGTGCGCCGG + Exonic
1182025075 22:27111457-27111479 TTACAGTGCTGCCTGTGTGCTGG - Intergenic
949453235 3:4210808-4210830 TAACATTTGTGTCGCTGGGCTGG + Intronic
949928595 3:9060783-9060805 TTCCATAGGTGTGGCTGTGCAGG - Intronic
957621767 3:82603682-82603704 TTAACTTGGTGTCCTTGTGCAGG - Intergenic
957789109 3:84917369-84917391 TTGCATTGGTGTCTGTATACTGG - Intergenic
958715548 3:97775541-97775563 TAACATTTGAGTCAGTGTGCTGG - Intronic
959927163 3:111935836-111935858 TAACATTTGAGTCGGTGGGCTGG - Intronic
961263167 3:125618848-125618870 TGACATTTGTGTCGGTGGACTGG + Intergenic
962074946 3:132071855-132071877 TTAGATTGCTGTAGGTGTGTTGG + Intronic
962447097 3:135475938-135475960 ATACATTTGAGTCGGTGGGCTGG - Intergenic
962886453 3:139632399-139632421 TGACCTTGGTGTCAATGTGCAGG - Intronic
962898745 3:139738381-139738403 TTAAATTTGAGTCAGTGTGCTGG + Intergenic
963067139 3:141272864-141272886 TTACATTTGAGTCAGTGGGCTGG - Intronic
963355344 3:144204406-144204428 TTACATTTGAGTCAGTGGGCTGG - Intergenic
963629852 3:147719599-147719621 TAACATTTGTGTCAGTGGGCTGG + Intergenic
964659979 3:159109645-159109667 TTTCTTTGGTGTGGGTGTGTGGG + Intronic
964949694 3:162274846-162274868 TTACATGGCTGTAGGTGTGCAGG + Intergenic
964991132 3:162813909-162813931 TCAGATTGTTGTAGGTGTGCAGG + Intergenic
965209722 3:165769048-165769070 TTAAATTGGTGTCTTTGTGGGGG + Intergenic
966641989 3:182202215-182202237 TGAAACTGGTGTAGGTGTGCTGG - Intergenic
968383876 4:119491-119513 TTAGATGGCTGTAGGTGTGCAGG + Intergenic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
972527409 4:39929245-39929267 TTACATTTGAGTCAGTGGGCTGG + Intronic
974309521 4:60187134-60187156 TTAAATTGGTGTCTTTGTGGGGG - Intergenic
975429086 4:74267239-74267261 GTGCATTGGTGTCTGTTTGCAGG + Intronic
975677778 4:76844234-76844256 TAACATTTGTGTCAGTGGGCTGG + Intergenic
976254345 4:83084485-83084507 TTAAATTGGTGTCCTTGTGGAGG + Intergenic
977203947 4:94148922-94148944 TGACATTTGTGTCAGTGGGCTGG + Intergenic
978616429 4:110601231-110601253 ATACATTGGTTTGGGGGTGCTGG + Intergenic
979595140 4:122526213-122526235 TTACATTGGTGTCCTTGTTGAGG + Intergenic
979852936 4:125595504-125595526 TAACATTTGAGTCAGTGTGCTGG - Intergenic
980108505 4:128611798-128611820 TAACATTTGAGTCGGTGGGCTGG + Intergenic
981571914 4:146160713-146160735 TAACATTTGTGTCAGTGGGCTGG + Intergenic
981867957 4:149449191-149449213 TTAAATTGGTGTCCTTGTGGTGG - Intergenic
984068658 4:175082761-175082783 TTAAATTGGTGTCTCTGTGTGGG + Intergenic
984306391 4:177997282-177997304 TAACATTGGAGTCAGTGGGCTGG - Intergenic
988169878 5:27639685-27639707 TTAAATTGGTGTCTTTGTGAGGG + Intergenic
988232714 5:28501699-28501721 TTACATTTGAGTCAGTGGGCTGG - Intergenic
995285278 5:110381435-110381457 TTCCCTTGGTGTCAGTGTTCTGG + Intronic
996256364 5:121409145-121409167 GTTCAGTGGTGTAGGTGTGCAGG + Intergenic
1001543489 5:172555482-172555504 TAACATTGGAGTCAGTGGGCTGG + Intergenic
1002998292 6:2307214-2307236 TAACATTTGAGTCGGTGGGCTGG + Intergenic
1010551995 6:77235078-77235100 TAACATTTGAGTCGGTGGGCTGG + Intergenic
1011199812 6:84823412-84823434 TAACATTGGAGTCAGTGGGCTGG + Intergenic
1011491341 6:87896540-87896562 TAACATTGGAGTCAGTGGGCTGG - Intergenic
1012015677 6:93846963-93846985 TAACATTTGTGTCAGTGGGCTGG - Intergenic
1013049741 6:106520814-106520836 TCCCATTAGTGTTGGTGTGCAGG - Exonic
1013897163 6:115102721-115102743 TAACATTTGAGTCGGTGGGCTGG - Intergenic
1020960896 7:14800355-14800377 TAACATTTGAGTCAGTGTGCTGG + Intronic
1021495660 7:21271733-21271755 TTACATGGGTGTGGTGGTGCAGG - Intergenic
1022063612 7:26827002-26827024 TTATTTTGGTGTTGGTGTCCTGG - Intronic
1037979259 8:23239137-23239159 TAACATTTGAGTCGGTGGGCTGG + Intergenic
1044129938 8:88509368-88509390 TAACATTGGAGTCAGTGGGCTGG - Intergenic
1045820380 8:106329776-106329798 TTGCATAGGTGTCAGTGAGCGGG + Intronic
1048835857 8:138518141-138518163 TAACATTTGAGTCAGTGTGCTGG - Intergenic
1049523364 8:143106728-143106750 TTACATAGGTATACGTGTGCCGG - Intergenic
1049738066 8:144220655-144220677 TTACCTTGCTGTTGGTGTCCAGG - Exonic
1050482998 9:6105195-6105217 TAACGTTTGTGTCGGTGGGCTGG + Intergenic
1054856916 9:69910393-69910415 TAACATTTGAGTCGGTGGGCTGG + Intergenic
1058247528 9:102646791-102646813 TAACATTGGAGTCAGTGGGCTGG + Intergenic
1185920253 X:4083533-4083555 TGACATTGGAGTCGGTGGACTGG - Intergenic
1186470259 X:9815873-9815895 TTACATTTGAGTCAGTGGGCTGG - Intronic
1189584921 X:42449311-42449333 TTAAATTGGTGTCCTTGTGTGGG - Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1192836527 X:74805268-74805290 TTAAATTGGTGTCCTTGTGGTGG + Intronic
1193416941 X:81237166-81237188 TTAAATTGGTGTTCGTGTGAAGG - Intronic
1193815551 X:86101324-86101346 TTAAATTGGTGTCATTGTGGGGG - Intergenic
1193841252 X:86411322-86411344 TAACATTTGAGTCGGTGGGCTGG - Intronic
1194023438 X:88722785-88722807 TTAAATTGGTGTCCATGTGAGGG - Intergenic
1194115344 X:89889319-89889341 TTAAATTGGTGTCGTTGGGTGGG + Intergenic
1194427857 X:93762179-93762201 ATGCATTTGTGTCGGTGGGCAGG - Intergenic
1194532397 X:95068026-95068048 TTAAATTGGTGTCTGTGTTAGGG - Intergenic
1194584411 X:95715498-95715520 TAACATTTGTGTCAGTGGGCTGG + Intergenic
1199066641 X:143426531-143426553 TTAAATTGGTCTCCTTGTGCTGG - Intergenic
1199144694 X:144350964-144350986 TAACATTTGAGTCAGTGTGCTGG - Intergenic
1200364392 X:155645846-155645868 TTAAATTGGTGTCCTTGTGGAGG + Intronic
1200468136 Y:3546458-3546480 TTAAATTGGTGTCGTTGGGTGGG + Intergenic