ID: 1165700380

View in Genome Browser
Species Human (GRCh38)
Location 19:37932847-37932869
Sequence AAGAGTGGGCCGGGTGTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165700374_1165700380 1 Left 1165700374 19:37932823-37932845 CCTGTCTGCTCCTAACTGTGAAG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165700376_1165700380 -9 Left 1165700376 19:37932833-37932855 CCTAACTGTGAAGAAAGAGTGGG 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165700373_1165700380 14 Left 1165700373 19:37932810-37932832 CCTGAAATGTTTACCTGTCTGCT 0: 1
1: 0
2: 0
3: 13
4: 198
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165700371_1165700380 23 Left 1165700371 19:37932801-37932823 CCTCTTCTCCCTGAAATGTTTAC 0: 1
1: 0
2: 4
3: 22
4: 342
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165700367_1165700380 27 Left 1165700367 19:37932797-37932819 CCCCCCTCTTCTCCCTGAAATGT 0: 1
1: 0
2: 1
3: 33
4: 451
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165700370_1165700380 24 Left 1165700370 19:37932800-37932822 CCCTCTTCTCCCTGAAATGTTTA 0: 1
1: 1
2: 3
3: 39
4: 392
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165700369_1165700380 25 Left 1165700369 19:37932799-37932821 CCCCTCTTCTCCCTGAAATGTTT 0: 1
1: 0
2: 4
3: 54
4: 432
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165700368_1165700380 26 Left 1165700368 19:37932798-37932820 CCCCCTCTTCTCCCTGAAATGTT 0: 1
1: 0
2: 2
3: 56
4: 485
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157
1165700372_1165700380 15 Left 1165700372 19:37932809-37932831 CCCTGAAATGTTTACCTGTCTGC 0: 1
1: 0
2: 0
3: 19
4: 194
Right 1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165700380 Original CRISPR AAGAGTGGGCCGGGTGTTGA CGG Intronic
900431554 1:2605343-2605365 AGGCCTGGCCCGGGTGTTGAGGG + Intronic
900574611 1:3376895-3376917 AATAGGGGGCTGGGTGGTGATGG - Intronic
901657729 1:10779985-10780007 CAGGGTGGGCGGGGTGTTGGTGG - Intronic
902148406 1:14422462-14422484 AAGATTGGGCTGGGTGGTGCAGG - Intergenic
902684706 1:18068488-18068510 AAGACTGGGGCAGGTGTTGCTGG - Intergenic
902781534 1:18708189-18708211 GAGAGTGGGCTGGGGGTTGCGGG - Intronic
903375462 1:22863094-22863116 AGAAGTGGTCCGGCTGTTGATGG - Exonic
906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG + Intronic
906866138 1:49422695-49422717 AAGAGTGAGCTGGGTGAAGAAGG - Intronic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
910555602 1:88528936-88528958 AAAAGGTGGCCGTGTGTTGATGG + Intergenic
911058773 1:93730215-93730237 AGGAGTGAGCCAGGTGTTGGCGG - Intronic
911121545 1:94301983-94302005 AAGACTGGGCCATCTGTTGATGG - Intergenic
912972692 1:114298922-114298944 AAGCTTGGGCTGAGTGTTGAAGG - Intergenic
915893665 1:159794458-159794480 AAGAGTGGGCCAGGTGCAGTGGG + Intergenic
915960577 1:160263039-160263061 AAGAGTGGGCCGGGTGATGTGGG + Intergenic
918405113 1:184204459-184204481 AGGAGTAGGCCTGGTGTTGCTGG + Intergenic
919823015 1:201484679-201484701 AGGAGTGGGCAGGGTGTGGTGGG + Exonic
919910306 1:202106915-202106937 AAGAGAGGACAGGGTGTGGAAGG + Intergenic
920297676 1:204969022-204969044 AAGGGTGGGCATGGTGTTCAGGG - Intronic
923962032 1:239096675-239096697 TAGAGTGGGACAGGTGGTGATGG - Intergenic
924544997 1:245018513-245018535 ATGAGTGGGCAGGGTGCTGGTGG + Intronic
924845620 1:247767177-247767199 AAGGGTGGGAAGGGGGTTGAGGG - Intergenic
1063134234 10:3202253-3202275 AAGGGTGGGCGGGCTGTTGCTGG + Intergenic
1063630927 10:7733122-7733144 AGGAGGGGGGTGGGTGTTGAGGG - Intronic
1064745239 10:18472195-18472217 AAAAGTGGGCCGGATATTAAAGG - Intronic
1067527784 10:47048694-47048716 AAGCGTGGGCTGGGTGATGGAGG + Intergenic
1068993087 10:63171430-63171452 AAGAGTGGGCTGTCTGTTCAAGG - Intronic
1072607651 10:96997991-96998013 AAGGGCGGGCCGGGTGCTGCTGG - Intergenic
1074402268 10:113151909-113151931 AAGCGGGGGGCGGGTGGTGAGGG + Intronic
1074434053 10:113418660-113418682 AAGACTGGGAAGGGTGCTGATGG + Intergenic
1076283136 10:129267396-129267418 AAGAGGGGGCTGAGTTTTGAAGG + Intergenic
1077349395 11:2085486-2085508 ATGAGTGGGCCGCGTCTTCAAGG + Intergenic
1079420012 11:20277154-20277176 AAGAGTGGGCTGGGGGCTGCAGG - Intergenic
1092934086 12:13343816-13343838 AAGAGTAGACCAGGTTTTGAGGG - Intergenic
1097713135 12:62936385-62936407 GAGAGTGGCCCAGGTGTTGAAGG + Intergenic
1099155927 12:79176002-79176024 CAGAGCGGGCCGGGTGTGGAGGG + Intronic
1099213961 12:79831293-79831315 AAGAGGAGGCTGGGTGGTGATGG + Intronic
1102843179 12:116148073-116148095 AAGAGGGGGGCGGGAGTGGAGGG + Intronic
1104658398 12:130591393-130591415 AAGGGTCGCCTGGGTGTTGAAGG + Intronic
1105844942 13:24286155-24286177 ACGAGTGGGCGGGATGGTGAGGG - Intronic
1106418406 13:29565474-29565496 AAGAGGGGGCCTGCTGTTGATGG + Intronic
1106658871 13:31777290-31777312 AGGAGTAGGCCAGGTGTTGAGGG + Intronic
1108531335 13:51330052-51330074 AAGAGGGGGCCGAGTGGGGAAGG - Intergenic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1113203336 13:107890183-107890205 AAGAGTGTGCTGTGTGTGGAAGG + Intergenic
1113490581 13:110688620-110688642 AAGAGGAGGCTGGGTGTTGTGGG + Intronic
1114189471 14:20429760-20429782 AGGAGTGGGCAGGGTGTGGCAGG - Intronic
1114322205 14:21556358-21556380 AAGAGTGGGGCTGGTGGTTAAGG + Intergenic
1115803567 14:37024360-37024382 AACAGAGGGCAGTGTGTTGATGG + Intronic
1116142198 14:41011773-41011795 TAGAGTGGGAGGGGTGATGAAGG - Intergenic
1116773882 14:49157738-49157760 AAGAGTGGGCTGGGGGCTGCTGG + Intergenic
1120833834 14:89022669-89022691 TGGAGTGGGGAGGGTGTTGAAGG - Intergenic
1122268715 14:100558762-100558784 AGGAGTGGGCCTGGTGTGGTGGG - Intronic
1125671970 15:41480332-41480354 GAGGGTGGGGCGGGTGGTGAGGG + Intronic
1126102584 15:45128989-45129011 AATAGTGGTCCGGGTGTGGGTGG - Intronic
1127169201 15:56281541-56281563 AAGAGTGGGGCGGGGGGTGAGGG - Intronic
1130885692 15:88090732-88090754 AAGAGTGGGTCAGGGGTTGTGGG - Intronic
1130976685 15:88781936-88781958 AAGAGTGGGCACGGAGTTAAAGG + Intergenic
1131225569 15:90622127-90622149 AGGAGTGGGCCTGGAGTTCAAGG + Intronic
1132456444 16:26311-26333 GAGAGTGGGAGGGGTGTGGACGG - Intergenic
1134771275 16:16811807-16811829 AAGAGAGGGAGGGGTGTTGGCGG + Intergenic
1136039374 16:27565979-27566001 AAAGGTGGGCCTGGTTTTGATGG - Intronic
1137708140 16:50549037-50549059 AAGAGGGGGCAGGGTCTTGCGGG - Intronic
1137948979 16:52764024-52764046 AAGAGAGAGCCGGGAGTTGGAGG - Intergenic
1138560795 16:57799952-57799974 AAGAGTGGGGCGGGAGCTGGGGG + Intronic
1139884004 16:70196097-70196119 CAGGGTGGGCCAGGTGTTGTAGG + Intergenic
1141190633 16:81822253-81822275 ATCAGTGGACAGGGTGTTGAAGG + Intronic
1142016087 16:87748472-87748494 AAGCCTGGGCCGGGTGTGGGGGG - Intronic
1142157673 16:88540019-88540041 AGGAGGGGGTTGGGTGTTGAGGG - Intergenic
1144193257 17:12866037-12866059 AAGAGTGGGGTGGGAGTTGGGGG + Intronic
1146006545 17:29164175-29164197 AAGACTGGGCTGGGTGGTGGTGG - Intronic
1146464981 17:33079357-33079379 AAGGGTGGGAAGGGTGTTGCTGG + Intronic
1148022045 17:44559712-44559734 AAAAGTGGGGCGGGTTTTGAAGG - Intergenic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1148517571 17:48235102-48235124 AAGACTGAGCTGGGTTTTGAAGG + Intronic
1149989199 17:61371422-61371444 CAGAGTGGTCTGGGGGTTGAAGG + Intronic
1152073796 17:78146833-78146855 AGGAGAGGGCCTGGTGTGGAGGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1155003098 18:21705001-21705023 AAGGGTGGGCCGAGAGCTGACGG + Intronic
1159930832 18:74311658-74311680 AAGGGTGAGCCAGGTGTGGAGGG + Intergenic
1162741825 19:12778005-12778027 CCGAGTGGACCGGGTTTTGAGGG + Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1162821765 19:13227329-13227351 GAGAGTCGGCCGGGTGTTTCTGG + Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
925329940 2:3050907-3050929 AAGAGGTGGCTGGGTCTTGAGGG + Intergenic
925384598 2:3453362-3453384 CAGAAAGGGCCGGGTGTTGGAGG - Intronic
926297794 2:11581134-11581156 AATAGTGGGCAGTGTGTTGTTGG + Intronic
926803395 2:16682619-16682641 AAGAGTGGGCAGGTTGAGGAGGG + Intergenic
927717217 2:25360501-25360523 AAAAGTGGGAGGGGGGTTGATGG - Intergenic
930283848 2:49403616-49403638 GCAAGTGGGCCTGGTGTTGAGGG - Intergenic
932302472 2:70676906-70676928 AAGAGTGAGCTGGCTGTTCAGGG + Intronic
932591861 2:73072167-73072189 ACGAGTGGGCAGGGTGGCGACGG - Intronic
933233031 2:79830739-79830761 AAGAATGGGCCTGGTGTTTATGG + Intronic
933754844 2:85630106-85630128 AAGAGTGTGGGGGGTGGTGAGGG - Intronic
936745948 2:115576765-115576787 AAGTGTGGGCCTGGAGTTGGAGG - Intronic
937499666 2:122464261-122464283 AAAAGTGTGCCAGCTGTTGAAGG + Intergenic
938232211 2:129670966-129670988 ATGAGTGGGGCTGGGGTTGATGG - Intergenic
938654167 2:133413700-133413722 CAGGGTGGGCCTGGTGTTGCCGG - Intronic
942948692 2:181698263-181698285 AGGAGTTGGCCAGGTGATGAGGG - Intergenic
944727687 2:202487859-202487881 AAAAATTGGCCGGGTGTTGGTGG - Intronic
945097137 2:206230651-206230673 AAGAGAGGGCAGGGTTGTGAGGG + Intergenic
946057634 2:216915917-216915939 AAGAGAGGCCCGGGAGTTGTCGG + Intergenic
946137289 2:217657671-217657693 AAGTGTGGGCAGGATGTTAAAGG - Intronic
947431743 2:230034663-230034685 AAGACTGGGCCGGGTGCAGGCGG - Intergenic
947831412 2:233144328-233144350 AAGAGTGGGAGGGGTGGAGATGG + Intronic
948427304 2:237896025-237896047 CATTGTGGGCCGGGTGCTGAGGG - Intronic
948637560 2:239349177-239349199 AAGAGTGAGCCGGGTGGGCAGGG + Intronic
1170603631 20:17860034-17860056 AAGAGTGGGCAGGGTGGAGCAGG - Intergenic
1173821363 20:46022277-46022299 AAAAGGGGGCTGTGTGTTGAAGG + Intronic
1175329888 20:58156261-58156283 AAGAGAGGGCGGGGTGGTCAGGG + Intronic
1176095478 20:63342076-63342098 AACACTGGCCCGGGTGTAGAAGG + Intergenic
1178922864 21:36750412-36750434 AGCAGTGGGCTGGGTGTGGAGGG + Intergenic
1179542296 21:42091341-42091363 AAGAGCGGACTGGGTGTTGGGGG + Intronic
1182536504 22:31007760-31007782 AAGAGGAGGCCGGGTGTGGGTGG + Intergenic
1182932926 22:34192083-34192105 AAGTGTGGGCTGGGTGGTCAGGG + Intergenic
1183208134 22:36433346-36433368 AAGAGTGGGCCTGGAGGTGCTGG - Intergenic
1183303383 22:37069452-37069474 AAGGGAGGGCTGGGTGTGGAGGG - Intronic
1185276794 22:49953405-49953427 AAGAGCGGACAGGGTGTTCAGGG + Intergenic
950939352 3:16877814-16877836 AAGATTGGGCCAGGTTATGATGG + Intronic
951403832 3:22269420-22269442 TAGAGTAGTCAGGGTGTTGAGGG + Intronic
954431467 3:50472999-50473021 AAGAGTGGGCCACGGGTTGGGGG + Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
965259792 3:166467409-166467431 ATGATTGGGTCGGGTGTTCAGGG + Intergenic
965992661 3:174838952-174838974 AAGAATGGTGGGGGTGTTGATGG - Intronic
967203172 3:187093492-187093514 TAGAGTGGGCCTAGTGGTGATGG + Intergenic
968347968 3:198027206-198027228 CAGAGTTGGCCGGGTGACGAGGG - Intronic
968505847 4:971205-971227 ATGAGTGGGCAGGGTGGTGGGGG - Intronic
976783239 4:88785795-88785817 CAGTGTGGGCTGGGAGTTGAAGG + Intronic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
983851813 4:172590290-172590312 ATTAGTAGGCGGGGTGTTGATGG + Intronic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
986668142 5:10120808-10120830 AAGACTGGGCTGGGTGCTGGGGG - Intergenic
988823986 5:34915989-34916011 CAGAGTAGCCCGGGTGTTAACGG + Exonic
989645615 5:43629145-43629167 AAGAGTGGGAGGGGGGGTGAGGG - Intronic
991589143 5:68230891-68230913 AAGAGTGTGCTGGGTGTGCAAGG + Intronic
995753656 5:115478942-115478964 AAGAGTGGGAGGGGAGGTGAGGG - Intergenic
1001742193 5:174062648-174062670 AAGAGAGGGTGGGGTGCTGATGG + Intronic
1004611980 6:17250765-17250787 AAGAGTGGGGTGAGGGTTGAGGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007141312 6:39577399-39577421 AAGAATGGGCCAGGCTTTGAAGG - Intronic
1007318558 6:41009612-41009634 AAGAGTGGGCTGGGTAGGGAGGG + Intergenic
1008875192 6:56318454-56318476 AAGAGTGGTGAAGGTGTTGAAGG - Intronic
1011677082 6:89745101-89745123 AAGAGTGGGTCGGGGGCTGGGGG - Intronic
1016419131 6:143866100-143866122 ATAGGTGGGCCGGGTGTTGGCGG - Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1019448368 7:1083085-1083107 AAGAGTGGGCAGGGTGGTGCTGG - Intronic
1022244347 7:28543815-28543837 GGGAGTGGGCATGGTGTTGAGGG + Intronic
1029588778 7:101493242-101493264 TAGAGTGGGCGGGGTGGGGAGGG - Intronic
1033157030 7:138965974-138965996 AGGAGTGTGCCTGGTGTTGGGGG - Intronic
1035234134 7:157485318-157485340 GAGTGTGGGCCGGGTTTTGAAGG + Intergenic
1045246948 8:100450688-100450710 AGGAGAGGCCCAGGTGTTGAAGG - Intergenic
1049289194 8:141792467-141792489 CACAGTGGGCCGGGTGTGGGTGG + Intergenic
1049573709 8:143381087-143381109 CAGAGGGGGCCGTGTGTTCAGGG + Intronic
1055437492 9:76307246-76307268 AAGAGTCAGCCGGGTATAGATGG - Intronic
1056307453 9:85303946-85303968 AAGAGTGGGCAGGGTGAAGGGGG + Intergenic
1060667380 9:125439933-125439955 AAGAGTGAGCGGGCTTTTGAGGG + Intronic
1060860885 9:126954019-126954041 AAGTGTGGGCAGTGTGTGGAGGG - Intronic
1060952529 9:127612881-127612903 AGGAGAGGGACGGGTGTTGGGGG - Intronic
1188486918 X:30692250-30692272 AGGATTGGGCAGGGTGATGAAGG - Intronic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1190109296 X:47579566-47579588 GAGAGTGGGAGGGGTGTTCATGG - Intronic
1198312603 X:135436529-135436551 CAGAGTGGGCCGCGAGTTGGCGG + Intergenic
1199947300 X:152679745-152679767 AAGCGAGGGCCTGGTTTTGAGGG + Intergenic
1199962380 X:152788709-152788731 AAGCGAGGGCCTGGTTTTGAGGG - Intergenic
1200306002 X:155026735-155026757 GAGAGTGGGGCGGGAGTAGAGGG + Exonic
1200399918 X:156013412-156013434 GAGAGTGGGAGGGGTGTGGACGG + Intergenic
1202050008 Y:20770804-20770826 AAGAGTGGGACGGTGGTTGTTGG - Intronic
1202365024 Y:24154230-24154252 AAGAGTGTGACGGTAGTTGAGGG + Intergenic
1202505757 Y:25515892-25515914 AAGAGTGTGACGGTAGTTGAGGG - Intergenic