ID: 1165703021

View in Genome Browser
Species Human (GRCh38)
Location 19:37952929-37952951
Sequence GTGTATGCACAGAGGATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165703019_1165703021 6 Left 1165703019 19:37952900-37952922 CCTGGGTGATTGCATACACTTCA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1165703021 19:37952929-37952951 GTGTATGCACAGAGGATTCTTGG 0: 1
1: 0
2: 0
3: 16
4: 152
1165703018_1165703021 10 Left 1165703018 19:37952896-37952918 CCATCCTGGGTGATTGCATACAC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1165703021 19:37952929-37952951 GTGTATGCACAGAGGATTCTTGG 0: 1
1: 0
2: 0
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165703021 Original CRISPR GTGTATGCACAGAGGATTCT TGG Intronic
901371483 1:8801682-8801704 GTGTATGCACAGAATATTTTAGG - Intronic
902110121 1:14071353-14071375 CTGAAGGAACAGAGGATTCTGGG + Intergenic
903200815 1:21736958-21736980 GAGTATGAACAGCCGATTCTTGG - Intronic
908061248 1:60352010-60352032 GACTGTGCACAGAAGATTCTAGG + Intergenic
908509608 1:64840995-64841017 GTGTATGCACACGGGACTCTGGG - Intronic
908602201 1:65752612-65752634 GTGTATGCACAGAGGAAAACAGG - Intergenic
913380836 1:118208559-118208581 GTGTATGCACAGAGCACTTCTGG + Intergenic
913380988 1:118209919-118209941 GTGTATGCACAGAGCACTCCTGG + Intergenic
915519617 1:156434303-156434325 CTGTATGCACAGACTATGCTGGG - Intergenic
916903924 1:169260944-169260966 ATGTATGCACAGATACTTCTAGG - Intronic
918623248 1:186629458-186629480 GGGTATGCACAGAGATTTTTTGG - Intergenic
919420957 1:197369715-197369737 GGGTATGTAGAGAGCATTCTGGG - Intronic
920601478 1:207329133-207329155 GTGTTGGCACAGGGAATTCTGGG + Intronic
921950767 1:220927535-220927557 GTGTAGGCACAGGTGATTCCAGG + Intergenic
922544458 1:226445525-226445547 GTGTGTGCCCAGAGGAGGCTGGG - Intergenic
923671960 1:236048785-236048807 GTGTGTCCACAGAGGGTTCCCGG - Exonic
924010863 1:239664161-239664183 TTGTAGGCAAAGAGGATTCTTGG - Intronic
1064242479 10:13643168-13643190 GTGTGAGCACAGAGGATTAACGG + Intronic
1068686173 10:59872039-59872061 GTGTAAGCACAGAGGTTACAAGG - Intronic
1068764232 10:60745588-60745610 GTGAAGGCATAGAGGTTTCTGGG + Intergenic
1069080947 10:64087758-64087780 TTGTATTCACAGAGGATGTTGGG + Intergenic
1069749866 10:70738356-70738378 GTGTATGCATGAAGGATTCCTGG - Intronic
1070078401 10:73160905-73160927 ATGTATGTATAGAGTATTCTGGG + Intronic
1071745286 10:88411900-88411922 GTGAGTGCACAGAGCAGTCTGGG + Intronic
1073007447 10:100335696-100335718 GTGTAGACACAGAGAATTCTGGG - Intergenic
1074384815 10:113008290-113008312 GTGTATGCTCAGAGCATCCTTGG + Intronic
1074428149 10:113370294-113370316 GGGTCTGCCTAGAGGATTCTGGG - Intergenic
1075292920 10:121245657-121245679 GTATATGCACACAGAATTGTGGG - Intergenic
1076778765 10:132712296-132712318 GTGTATGCACAGTTGCTTGTGGG + Intronic
1079481402 11:20884476-20884498 TTGGATGCTCAGAAGATTCTGGG - Intronic
1080795511 11:35559504-35559526 GTATGTGCACAGAGCATTCCTGG + Intergenic
1084897332 11:72282963-72282985 GTAAATACCCAGAGGATTCTGGG - Intergenic
1085758491 11:79221493-79221515 GTGTATGCAGTGAAGTTTCTCGG - Intronic
1085790145 11:79490361-79490383 CTTTATGCAAACAGGATTCTTGG + Intergenic
1087532234 11:99398491-99398513 TTGGAAGCACAGAGGATTTTTGG - Intronic
1088589032 11:111386577-111386599 GTATATACACACAGGATTCATGG - Intronic
1089055850 11:115584226-115584248 ATGTATGCACGGAGTATTCATGG + Intergenic
1089085797 11:115815826-115815848 GTGTGTGCAGGGAGGATGCTGGG - Intergenic
1090858713 11:130634232-130634254 AGGGATGCCCAGAGGATTCTGGG - Intergenic
1091918858 12:4288570-4288592 ATGAATGCACAGAGGATTCAAGG - Intronic
1092440124 12:8493916-8493938 GTGTTTTCACAGAGAATTCATGG - Intergenic
1093651170 12:21647508-21647530 TTTTATGGACAGAGGAATCTAGG + Intronic
1095106360 12:38237960-38237982 GTGTATGTACTGAGGATGGTTGG + Intergenic
1097145315 12:56935811-56935833 GTGAATGAACAGAGAAGTCTTGG + Intergenic
1097771408 12:63590836-63590858 GTGTATGGGCAGAGGGTTCCGGG - Intronic
1099614807 12:84920774-84920796 GTGGGGGCACAGAGGATGCTTGG - Intergenic
1100386299 12:94107087-94107109 GTGAATGCACAGAAACTTCTTGG + Intergenic
1104155365 12:126126147-126126169 GTGGGTGCACAGATGATGCTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107146057 13:37061482-37061504 GTGCTTGCACAATGGATTCTTGG - Intergenic
1107458417 13:40577071-40577093 GTGGATGCACAGGAGATTCAGGG + Intronic
1108444788 13:50497302-50497324 TTGGCTACACAGAGGATTCTAGG + Intronic
1112935549 13:104793825-104793847 GTGTATGAAAAGCTGATTCTTGG + Intergenic
1114562985 14:23606923-23606945 TTGTGAGCACAGAGGATTGTGGG - Intergenic
1116158016 14:41233274-41233296 TTGTATCCACAGGAGATTCTGGG + Intergenic
1117422251 14:55558286-55558308 GAGTAGGCACAGAGTATTGTTGG + Intergenic
1119298527 14:73552617-73552639 GTGTCGGCACAGGGGATTGTGGG - Intronic
1119302824 14:73584804-73584826 GTGTCGGCACAGGGGATTGTGGG - Intergenic
1124253817 15:28124911-28124933 GTGTGTTTACAGAGGCTTCTTGG - Intronic
1127054292 15:55115927-55115949 GTGCATGCACAGTGGCCTCTTGG + Intergenic
1129636064 15:77319509-77319531 TTGGATGCAGAGAAGATTCTAGG + Intronic
1133477838 16:6140555-6140577 GTGAATGAACAGAGGATACTTGG - Intronic
1138012448 16:53395168-53395190 GTGTATCCACAGAGGATGTCAGG - Intergenic
1140657350 16:77154491-77154513 GTGTATGCATAGATAATTATAGG - Intergenic
1140841239 16:78841127-78841149 GTATAAGCACAGGGAATTCTGGG - Intronic
1142115731 16:88355200-88355222 CTGTCTGCACAGTGGACTCTGGG - Intergenic
1142677739 17:1524905-1524927 GAGTATGCACTGAGTATTCGGGG + Intronic
1143163352 17:4885471-4885493 GTGTCTTCACAGTGGATTTTGGG + Exonic
1144583185 17:16471591-16471613 GTGTACCCACAGAGGCTTCAGGG - Intronic
1145113794 17:20189343-20189365 CAGTATGCAGAGAGAATTCTGGG + Intronic
1149635698 17:58167588-58167610 GTTTATCCACAGAGCATTTTAGG + Intergenic
1154960973 18:21308365-21308387 GTGTATTTACAGAACATTCTAGG + Intronic
1157972508 18:52286365-52286387 GTGTGTGCACAGAGGACCCAAGG - Intergenic
1165703021 19:37952929-37952951 GTGTATGCACAGAGGATTCTTGG + Intronic
1167251475 19:48400607-48400629 GTGTACGCCCATAGCATTCTGGG + Intronic
925183166 2:1830118-1830140 GTGTCTGCAGAGAGGAGGCTGGG + Intronic
925290880 2:2748064-2748086 GAGTGTGCACACAGCATTCTTGG - Intergenic
926704738 2:15829050-15829072 GTGGATGCTCACTGGATTCTGGG - Intergenic
929825970 2:45310032-45310054 GAGGATGCACTGAGGATACTTGG - Intergenic
929826256 2:45311276-45311298 GAGGATGCACTGAGGATACTCGG - Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
932294179 2:70610394-70610416 GGGGATGGACAGAGGATCCTGGG - Intronic
941505880 2:166344724-166344746 CTGTTTGCACAAAGGATTGTAGG - Intronic
941650617 2:168088738-168088760 GTATATGCACATAGCATTTTGGG + Intronic
942303304 2:174583172-174583194 GTGTATGCAGAGAGCATTTCTGG - Intronic
944271892 2:197793613-197793635 GTGTAGCCAGAGAGGATTCCAGG + Intergenic
945118478 2:206433683-206433705 GTGTGTGCACTGATGTTTCTAGG + Intergenic
945949246 2:216023214-216023236 GTGGCAGCACAGAGGATTATAGG - Intronic
947229399 2:227870297-227870319 GTGTACGCAAAGAGAATTGTGGG - Intergenic
1169436090 20:5592396-5592418 GTGTATTCACAAAATATTCTTGG + Intronic
1171944635 20:31365561-31365583 TTGTATGCACATATGATTTTTGG - Intergenic
1173359713 20:42331666-42331688 GTGTATGCACAGAGAATTGGAGG + Intronic
1180901804 22:19378547-19378569 GTGTCAGAACTGAGGATTCTGGG + Intronic
1183245999 22:36693845-36693867 ATGTACGCACAGGGGATTCTGGG - Intronic
1183495599 22:38141811-38141833 CTGGGTGCGCAGAGGATTCTCGG + Intronic
1183906550 22:41045502-41045524 GTGTAAGCATAGTGGATTATCGG + Intergenic
1185299950 22:50074387-50074409 ATGTCTGCACAGTGCATTCTGGG - Intronic
955862174 3:63343326-63343348 CTGTATGGACAATGGATTCTAGG + Intronic
957037018 3:75302848-75302870 GTGTAACCTCAGAGGCTTCTTGG + Intergenic
958453809 3:94305634-94305656 GCAAATGCACAGAGGATTCCTGG - Intergenic
959598370 3:108152161-108152183 GTGGAAGCAGAGAGGCTTCTGGG + Intergenic
960742557 3:120851042-120851064 GTGTATGCCCAACAGATTCTGGG + Intergenic
960874741 3:122285217-122285239 GAGAATGCAGAGAGGTTTCTTGG + Exonic
961495490 3:127288189-127288211 ATTTATGCACAGGGGCTTCTCGG - Intergenic
961628149 3:128277895-128277917 GTGTGGGTAGAGAGGATTCTGGG + Intronic
962349047 3:134643569-134643591 GTGTGTGCACAGGGGCTTCCAGG - Intronic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
972698283 4:41469079-41469101 GTGGATGCACAGATGACTCTTGG - Intronic
973125288 4:46575667-46575689 GTGTATGCACAGAAAATTCCTGG + Intergenic
976871562 4:89800375-89800397 ATGTATTCACAAAGGATTTTAGG - Intronic
978475343 4:109122139-109122161 GTCTGAGCACAGAGGATTTTAGG + Intronic
982232369 4:153221503-153221525 GTGTATGGACAGAGGGTTATAGG - Intronic
982811286 4:159828847-159828869 ATGTGAGCACAGAGAATTCTTGG + Intergenic
983027042 4:162750833-162750855 CTGTATGCACAGATGTTTCATGG - Intergenic
983671327 4:170241159-170241181 GTATAAGCACAGAAGATACTTGG - Intergenic
986998729 5:13637283-13637305 GTGTATGCATATAGGTGTCTAGG + Intergenic
987027885 5:13946080-13946102 ATGTGTTGACAGAGGATTCTTGG - Intergenic
990259664 5:54008150-54008172 ATATATGCCCAGAGGACTCTTGG - Intronic
991295624 5:65077138-65077160 GTGCCTGCAGGGAGGATTCTGGG + Intergenic
994133613 5:96260338-96260360 GTGGATACACAGAACATTCTTGG + Intergenic
995066184 5:107865611-107865633 TTATATGCACAGAGGATTACTGG - Intronic
995072200 5:107937220-107937242 GTTTATGCTCAGATGATTATTGG - Intronic
996081761 5:119265479-119265501 GTGGATGCAGAGAGCATTTTGGG + Intergenic
996812487 5:127533152-127533174 GTGTATGCTCAGAACATTGTGGG + Intronic
1004023714 6:11798711-11798733 GTGAATGCACAGAGCGTACTGGG - Intronic
1004624487 6:17362046-17362068 GTCTAGCTACAGAGGATTCTTGG - Intergenic
1005414704 6:25587394-25587416 GTGTCTGGACAGAGGCTTGTGGG + Intronic
1006903695 6:37518940-37518962 GTGTAGACACAGAGTATTGTGGG - Intergenic
1007704643 6:43783354-43783376 GTGTGTGCTCAGGGGATGCTGGG + Intronic
1010153040 6:72758709-72758731 GTGTATTCAAAGATGATTATAGG - Intronic
1016055872 6:139577304-139577326 GTGGAAGCACAGAGCATTCTGGG + Intergenic
1018177137 6:161186787-161186809 GGGTAGGTACAGAGAATTCTAGG - Intronic
1018301939 6:162412318-162412340 GTGTCTGGACTGAGGATTCTAGG + Intronic
1019856807 7:3617445-3617467 GAGCATGCACAGAGCATCCTAGG + Intronic
1023185007 7:37524116-37524138 AGGGATGCACAGAGTATTCTGGG + Intergenic
1024360128 7:48459537-48459559 GAGCAAGCACAGAGGATCCTTGG - Intronic
1029826905 7:103207095-103207117 GTGTGTGGGCAGAGGGTTCTGGG - Intergenic
1030442062 7:109598168-109598190 GAGTAGGCAAAGAGGAATCTGGG - Intergenic
1030728453 7:112955074-112955096 GTGTATGCCAAGACAATTCTTGG - Intergenic
1031589182 7:123569112-123569134 CTGTAAGTACTGAGGATTCTGGG + Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1032992182 7:137405924-137405946 GTGGATACAGAGAGGATCCTAGG + Intronic
1034342039 7:150363707-150363729 GTGTCTTCACAGAGGATTTCTGG + Intergenic
1035873526 8:3161883-3161905 AACTATGCACAGAGCATTCTAGG - Intronic
1036193102 8:6689354-6689376 GTTGATGCACATAGAATTCTGGG + Intergenic
1036465752 8:8995327-8995349 GAGAATGCACAGAGGATTTTCGG + Intergenic
1037758601 8:21727362-21727384 GTGTAAGAACAGAGGATTGGGGG + Intronic
1037925644 8:22842255-22842277 GTCGATTCACAGTGGATTCTTGG + Intronic
1038649568 8:29390243-29390265 GTGGGTGCAGAGAGGATTGTGGG + Intergenic
1043966940 8:86489477-86489499 GTGTATACACATTGGAATCTTGG - Intronic
1044755031 8:95452651-95452673 CTGGATGCACAGAGGATGATGGG - Intergenic
1046707543 8:117472092-117472114 TTGTATGCACAGAGTTGTCTAGG - Intergenic
1047628505 8:126680872-126680894 CTGTATGCACACAGGTTTTTTGG - Intergenic
1049705355 8:144039686-144039708 GTGTCTGCTCAGAGGAGCCTGGG - Intronic
1052095747 9:24381541-24381563 GTTTATTCACAGAGGATGCCAGG - Intergenic
1052859161 9:33426333-33426355 GTGCATGCAGAGAAGATTCAGGG + Intergenic
1054977403 9:71164050-71164072 GCGTATGCACAAAGGATGCAGGG + Intronic
1056760809 9:89413391-89413413 ATGTATGCACAGTGGTTGCTGGG - Intronic
1057165226 9:92920354-92920376 ATAGAAGCACAGAGGATTCTGGG - Intergenic
1059286457 9:113176647-113176669 GTGCTTGCTCAGAGGTTTCTTGG + Exonic
1186917118 X:14234811-14234833 CTGGATGATCAGAGGATTCTGGG + Intergenic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1188617683 X:32178857-32178879 GTGTGTGTACACACGATTCTTGG + Intronic
1190550328 X:51572772-51572794 GTGACTGCCCAGAAGATTCTAGG - Intergenic
1190579483 X:51877545-51877567 AGGTATGCACAGAGGTTTGTTGG + Intronic
1190777296 X:53563172-53563194 GTGAAACCACAGAGGATACTGGG + Intronic
1195915856 X:109934846-109934868 GTTTATTATCAGAGGATTCTTGG + Intergenic
1197171863 X:123443677-123443699 GTGTCTGTACAGAGGCTTCAGGG + Intronic
1198099349 X:133411135-133411157 GTACATGCACAAAGGATTCCAGG - Intronic