ID: 1165705149

View in Genome Browser
Species Human (GRCh38)
Location 19:37970647-37970669
Sequence CCTCTCCTGCAGGATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165705139_1165705149 14 Left 1165705139 19:37970610-37970632 CCCTGAACTGGCATGACTGCAAA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 311
1165705140_1165705149 13 Left 1165705140 19:37970611-37970633 CCTGAACTGGCATGACTGCAAAG 0: 1
1: 0
2: 3
3: 8
4: 145
Right 1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165705149 Original CRISPR CCTCTCCTGCAGGATGTGGA GGG Intronic
900177646 1:1297928-1297950 CAGCTCCTGCAGGCAGTGGAGGG + Exonic
900298402 1:1964418-1964440 CTTCTCTTCCAGGAGGTGGAGGG - Intronic
900337544 1:2172081-2172103 CCTCTCGTGCAGGAAGTTGAGGG - Exonic
901056293 1:6450057-6450079 GCCCTGCTGCAGGCTGTGGAGGG - Intronic
902833510 1:19032963-19032985 CCCCTCCTGGAGGATGAGGAGGG - Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904344266 1:29857720-29857742 CCTCTCCTGTGAGATGTGGGTGG - Intergenic
904408639 1:30311562-30311584 CCTCGCCTGCAGCATGCGGGGGG + Intergenic
904409977 1:30319473-30319495 CCTGTCCTGCAGGAGGAGCACGG + Intergenic
904421438 1:30397156-30397178 CCTCCCCTGGAGGATTCGGAGGG + Intergenic
905447586 1:38037091-38037113 CCTCACCTGTAGGCTGGGGATGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906208391 1:43999019-43999041 CCTGTGCTCCAGGATGTGGCTGG - Intronic
906481684 1:46203454-46203476 CCTGACCTGCGGGATGTGGAGGG + Exonic
907167041 1:52421993-52422015 CCTGTTCTCCAAGATGTGGAAGG + Intronic
908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG + Intronic
910194712 1:84628760-84628782 TCTCTCCTGCAGGAAGTCCAAGG - Exonic
911576560 1:99585300-99585322 ACTATCCTGTAGCATGTGGAAGG - Intergenic
912331504 1:108824231-108824253 CCTGTCTGGCAGGCTGTGGACGG + Intronic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
912677331 1:111695974-111695996 ACTCTGGTGCAGGATGTTGATGG + Intronic
912963381 1:114215930-114215952 CCTCTCCTGCAGGAGGAGATAGG - Intergenic
913549044 1:119898558-119898580 CCTCTCCTGGAGGCTGAGCAAGG - Intergenic
913681283 1:121188274-121188296 CCTCTCCTGAAAAATGTGAAGGG + Intronic
914033114 1:143975914-143975936 CCTCTCCTGAAAAATGTGAAGGG + Intergenic
914156331 1:145092052-145092074 CCTCTCCTGAAAAATGTGAAGGG - Intronic
915226443 1:154415137-154415159 CCTGTCCTGCAGGCTGAGGACGG - Intronic
915361401 1:155288225-155288247 CCCCTCCAGGAGGAGGTGGACGG + Exonic
915593367 1:156882938-156882960 CCTCTCCTGCCGGGTATGGGTGG + Intergenic
916784747 1:168078429-168078451 GCTCTAGTGCAGGATGTTGATGG + Intergenic
917872729 1:179256356-179256378 GCTATCCTGCAGGATGAGGTGGG - Intergenic
918007339 1:180554268-180554290 CCTCCCCTACAGCATTTGGAGGG + Intergenic
918148721 1:181780433-181780455 CCTCTCCTGGTGCAAGTGGAGGG + Intronic
918243459 1:182639872-182639894 GCTCTCTTCCAGGTTGTGGACGG - Intergenic
918292432 1:183121804-183121826 CCTGTCCTGTGGGATATGGAGGG + Exonic
918516328 1:185367439-185367461 TCTCCCCTACAGCATGTGGAAGG + Intergenic
918771842 1:188571217-188571239 CTTCTCCTGCAAGAACTGGAAGG - Intergenic
920357724 1:205387183-205387205 GTTCTCCTGCAGTATGTAGAAGG + Intronic
920468599 1:206206799-206206821 CCTCTCCTGAAAAATGTGAAGGG + Intronic
922810182 1:228410940-228410962 GCTCACCTGCAGCATCTGGAGGG + Exonic
924681177 1:246235712-246235734 CCTCTCCTCTAGGAAGGGGAGGG + Intronic
1063016564 10:2083867-2083889 CATCTACTGCAGCATGTGGTTGG - Intergenic
1063564878 10:7163900-7163922 CTTTTCCTGCAGGATATTGACGG - Exonic
1063802556 10:9596557-9596579 GCCCTCCTGCAGGCTGCGGATGG + Intergenic
1064281189 10:13953027-13953049 TCTCTTCTGTAGGATGAGGATGG + Intronic
1066000506 10:31100739-31100761 CCTTTTCTGGAGGATGTGGTAGG + Intergenic
1066271852 10:33831700-33831722 CCTCTCTTGCAGGCAGAGGATGG + Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067703171 10:48588258-48588280 CCTATCCTGCAGGGTGGGGCAGG - Intronic
1069723287 10:70562743-70562765 CCTCCCCTGCACGCTATGGAAGG - Intronic
1069758856 10:70793754-70793776 AATCTACTGCAGTATGTGGATGG - Intergenic
1070673042 10:78391560-78391582 CCTGGCCTGCAGGAGGTGGTGGG + Intergenic
1070677364 10:78421188-78421210 CCCCTCCTCCAGGATGGGGAAGG - Intergenic
1071499054 10:86190573-86190595 GCACACCTGCAGGATGGGGATGG - Intronic
1071935466 10:90525990-90526012 CCTCTCCTCCTTGAAGTGGAGGG - Intergenic
1075783631 10:125033288-125033310 AGGCTCCTGCTGGATGTGGAAGG + Intronic
1076504179 10:130961033-130961055 CCCCTGCTTCAGGATGTGGGAGG - Intergenic
1078535627 11:12171088-12171110 CCTTCCCTGCAGGGTGGGGATGG + Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1080282916 11:30579488-30579510 CCTCTGCTACAGGATGTGCTGGG - Intronic
1080746272 11:35111346-35111368 CCTCTGCAGCAGGATTGGGAAGG + Intergenic
1082821654 11:57548053-57548075 CCTCTTCTGCTGGCTGAGGATGG + Intronic
1083624882 11:64067317-64067339 CCTCTCCCGGAGGATGGTGAGGG + Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1086341843 11:85855193-85855215 CCGCCCCTGCAGGCTGTGGAGGG + Exonic
1087637593 11:100719943-100719965 CCTCCCCTGCTGAATGTGGCTGG + Intronic
1088738535 11:112748207-112748229 CCTCTGCCGCTGGATGTGGTAGG + Intergenic
1088812599 11:113401620-113401642 CCTGTCCTGCTGGTTGTGGCTGG + Intergenic
1089310593 11:117555857-117555879 CCTCTCCTGCAGAGTATGGAGGG + Intronic
1089792312 11:120953853-120953875 CCTCCACTGCAGTAAGTGGAGGG - Intronic
1093021700 12:14209842-14209864 CATCTCCTGCAGGATATGTATGG - Intergenic
1093302984 12:17477465-17477487 CCTTTCCTGAAGAATGAGGACGG - Intergenic
1094375292 12:29783301-29783323 CCTCCTCTCCAGGATGTGCATGG - Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096618152 12:52846282-52846304 CCTTGTCTCCAGGATGTGGATGG - Exonic
1096777485 12:53973213-53973235 CCTCTCCTGCCGGCTCCGGATGG - Exonic
1097225575 12:57475304-57475326 CCGCTCCTGCAGGCTTTGTAAGG + Exonic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1100103777 12:91143186-91143208 CCTCTCCTAAAGGCTTTGGAAGG + Exonic
1100655134 12:96635982-96636004 CCTCCCCTCCAGGAGGTGGGAGG + Intronic
1101353725 12:103957061-103957083 CCTCTCCTCCAAGAGGTAGAAGG - Exonic
1101403368 12:104407365-104407387 CATATCCTGCAGGAAATGGAGGG - Intergenic
1101900381 12:108787643-108787665 ACTCTTCTGCAGGATGCGAAGGG + Exonic
1102584666 12:113914681-113914703 CCCCTCTTGCACGTTGTGGATGG + Intronic
1102633099 12:114299379-114299401 TGCCTCCTGCAGGATGAGGATGG + Intergenic
1103264056 12:119614023-119614045 CCACTCCTGCAGGGTTGGGAAGG + Intronic
1103601791 12:122059080-122059102 CCTCTCCCCAAGGATTTGGAAGG + Exonic
1103994040 12:124817662-124817684 CCTGTCCTTCAACATGTGGAAGG - Exonic
1104645800 12:130496533-130496555 TCCCTCCTGCAGGAAGTGGATGG - Intronic
1104831681 12:131756729-131756751 CCTCACCTGCAGGCTGGGGTGGG + Intronic
1105887226 13:24652369-24652391 GCTCTCCTCCAAGATGTGCAGGG - Intergenic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1109386502 13:61634908-61634930 GCTCTCCTGAAGTATGTTGATGG - Intergenic
1109693095 13:65918783-65918805 ACTCTCCTGAGGGAGGTGGAAGG + Intergenic
1112619403 13:101039263-101039285 CATTTCCTGTATGATGTGGATGG - Intergenic
1113103438 13:106746401-106746423 CCTCTACTGGTGGATGAGGAGGG - Intergenic
1113800279 13:113082859-113082881 CCTGCCCAGCAGGATGAGGAGGG - Intronic
1113832290 13:113305617-113305639 CCTTTGCTTCAGGATGGGGAAGG + Intronic
1113922878 13:113923961-113923983 CCTCTCCTTCTGGGTGTGGGTGG - Intergenic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1114051479 14:18922025-18922047 CTTCTCCTGCAATCTGTGGAGGG + Intergenic
1114111082 14:19479899-19479921 CTTCTCCTGCAATCTGTGGAGGG - Intergenic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1118808292 14:69256396-69256418 TCTCTCCTGCAGGCTGTTGCTGG - Intergenic
1118905946 14:70023220-70023242 CCGCTCCTCCAGGGTGTGGCTGG - Exonic
1121521645 14:94590168-94590190 CCTCTCCTGCAGGGTGGTGGGGG + Exonic
1122244389 14:100391716-100391738 CTGCTACTGCAGTATGTGGAGGG - Intronic
1122427547 14:101620614-101620636 GCCCTCAGGCAGGATGTGGATGG + Intergenic
1122817509 14:104320888-104320910 CCTCTCCAGCTGGGTGTGGGCGG - Intergenic
1123506304 15:20943031-20943053 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1123563530 15:21516735-21516757 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1123599782 15:21954022-21954044 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1123882139 15:24686552-24686574 CCTCTCCTGAAGACTGAGGACGG + Intergenic
1124021860 15:25932827-25932849 CCTCCACTGCAGGATGTGGTTGG + Intergenic
1126231076 15:46325845-46325867 CCTTGTCTGCAGGATTTGGAAGG - Intergenic
1129154759 15:73710856-73710878 CATCTCCAGCTGGAGGTGGAGGG + Intronic
1129616804 15:77105174-77105196 ACTCTCATGCAGGAAGTGGGGGG - Exonic
1129793778 15:78360839-78360861 CCTCTCATTGAGGATGTGCAGGG + Intergenic
1130112051 15:80973625-80973647 CTTCTCCTGCAGTCTGTGGTTGG - Intronic
1130790121 15:87145567-87145589 CCTTTCAGGTAGGATGTGGAAGG - Intergenic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1130967511 15:88708287-88708309 CCTCTCCTGCCACATGTGAAAGG - Intergenic
1132230698 15:100181722-100181744 TCTCTCCTGAAGGAGGAGGAAGG + Intronic
1132374637 15:101320970-101320992 CCTCTCCTACAGGATGGGACGGG + Intronic
1202971888 15_KI270727v1_random:243872-243894 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1132482895 16:175459-175481 CAGCTCCTGCAGGGTGAGGAAGG - Intergenic
1133226562 16:4343536-4343558 CCTTTCCTGAAGGATGAGGTGGG - Intronic
1133708621 16:8379570-8379592 CCTCTCCCCCAGGATGGAGAAGG - Intergenic
1134209924 16:12267591-12267613 CTGCTCCTGCAGGATGAGGGAGG - Intronic
1135535083 16:23287629-23287651 CACCTCCTGGAGGATGAGGAAGG + Intronic
1135627726 16:24010721-24010743 CTTCTCCTGCAGGTTTTGGGAGG + Intronic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137724953 16:50650821-50650843 CCAGTCCTGCAGGAAGTGAAGGG - Intergenic
1138239009 16:55411447-55411469 CCTCTCCTGCAGGGGAAGGACGG + Intronic
1138852954 16:60652065-60652087 GCTCTCCTACAGAAAGTGGAAGG - Intergenic
1139339808 16:66261045-66261067 CACCTCCTGCAGGAGGAGGAAGG + Intergenic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1143204749 17:5133879-5133901 CCTCTCCTTCATGATCTGTAGGG - Exonic
1143400524 17:6639725-6639747 CCTCTCCTGCAGGCACGGGATGG + Intronic
1144413528 17:15023918-15023940 GCTCTCCTGCTGGATATGCAGGG - Intergenic
1144533187 17:16060112-16060134 CCTCCCCTTCAGGATGAGGAAGG + Intronic
1145059187 17:19721462-19721484 CCTGGCCTGCAGGATTGGGAGGG - Intergenic
1145403623 17:22568313-22568335 CTTCTCCTGCAGTCTCTGGAGGG - Intergenic
1145755961 17:27390186-27390208 GCACTCATGGAGGATGTGGATGG - Intergenic
1146247704 17:31304564-31304586 CCTCCCCTTCTGGATTTGGAAGG - Exonic
1147794699 17:43034146-43034168 CTTGTCCTGCAGGCTGAGGAAGG + Intergenic
1147851765 17:43449239-43449261 CACCTCCTCCAGGAGGTGGAGGG - Intergenic
1149582653 17:57762122-57762144 CCTCCCCTGCAGGCTGGGCAGGG - Intergenic
1152581972 17:81169612-81169634 CCTCCCCTGGAGCATCTGGAGGG - Intergenic
1153954719 18:10086524-10086546 CCTCTCCGGCTGGCTGCGGAAGG - Intergenic
1154172622 18:12062170-12062192 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1154485455 18:14868318-14868340 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1155935237 18:31746446-31746468 CCTTTCCTGGAGGATGGGGTTGG + Intergenic
1156459679 18:37314713-37314735 CCTCCCCTGCAGCTTGTGGGGGG + Intronic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1157546677 18:48551371-48551393 TCTCCCCTGCAGCTTGTGGAGGG + Intronic
1160298831 18:77660522-77660544 CCACTGCTGGAGGATGGGGAAGG - Intergenic
1161792494 19:6368722-6368744 CCTCTCCAGAATCATGTGGAGGG + Exonic
1162500475 19:11050715-11050737 CCTCTCCTGCAGAATGTTTCAGG - Intronic
1163155306 19:15436963-15436985 CAGCTCCTGCAGGATGTTGATGG + Exonic
1164589131 19:29496454-29496476 CCTGTCCAGGAGGCTGTGGAGGG + Intergenic
1164667580 19:30051706-30051728 CCTGTCCTGCATGGTGAGGAAGG + Intergenic
1164724639 19:30457885-30457907 CCTCTGCTGCAGGCTGCAGATGG - Intronic
1165097530 19:33417732-33417754 CCTCTCCTGCTGCCTGAGGAGGG - Intronic
1165427856 19:35755673-35755695 CCTCCCCTCCAGGATGAGCACGG - Exonic
1165521234 19:36315866-36315888 CATCTACTGCAGGCTATGGATGG - Intergenic
1165622831 19:37262724-37262746 CATCTACTGCAGGCTATGGATGG + Intergenic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1165821097 19:38676607-38676629 CCTCTGGGGCCGGATGTGGAAGG + Intronic
1165838026 19:38771129-38771151 CCTCCCCTGCAGGCCGTGGTTGG - Exonic
1165841539 19:38791568-38791590 CCTCCCCTGCAGGCCGTGGTTGG + Exonic
1166033935 19:40153768-40153790 CGTCTCCGGCAGGAAGTGAAGGG + Intergenic
1166824638 19:45601337-45601359 CCTCTCTTCCAGGATTTGGCTGG - Intronic
1166997760 19:46727953-46727975 GCTGACCTGCGGGATGTGGATGG - Exonic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
925420756 2:3709374-3709396 CCGCTTCTGTAAGATGTGGAGGG - Intronic
926002767 2:9347097-9347119 CCACCCCTGCAGGATGTAGGCGG - Intronic
926240186 2:11079388-11079410 CCCTTCCTGCAGGATGTGACAGG + Intergenic
926737410 2:16083833-16083855 CCTCTTCAGCAGGAGGTCGAGGG + Intergenic
928127205 2:28625146-28625168 CATCTCCTGCTGGCTGGGGAGGG + Intronic
928877120 2:36053099-36053121 GTTCTCCTGCAGGAACTGGAAGG - Intergenic
931427593 2:62185291-62185313 CCTCTCCCCAAGGAAGTGGAGGG + Intergenic
931847032 2:66214559-66214581 CCTCTCTCACAGAATGTGGAGGG + Intergenic
932578809 2:72980083-72980105 CCTCTTCTGCAAGAAGTGGGAGG + Intronic
934712126 2:96523111-96523133 CTGCTCCTGCTGGCTGTGGAGGG - Intergenic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
936153187 2:110032749-110032771 CCTCACCTGCAGGACATGGCGGG + Intergenic
936191494 2:110338666-110338688 CCTCACCTGCAGGACATGGCGGG - Intergenic
938015852 2:127866653-127866675 TCTGCCCTGCAGGCTGTGGATGG - Intronic
938096209 2:128465770-128465792 CCTGCCCTGCAGGGTGGGGAAGG + Intergenic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
940015199 2:149097204-149097226 CCTCTCCTACTGGAAGTGCAGGG + Intronic
940257885 2:151750408-151750430 GCTTTCCTGCAGGGTGTGGGGGG + Intergenic
940419120 2:153457907-153457929 CCTCACCAACAGGATGGGGAGGG - Intergenic
942116604 2:172735285-172735307 CTTCTCCTGCGGGGTGAGGAAGG - Intronic
943536789 2:189162091-189162113 CCTCTCAGGCAGTATGTGGGAGG + Intronic
943872852 2:193024133-193024155 ACTCTGATGCAGGATGTTGATGG - Intergenic
944685238 2:202112208-202112230 CCTTTCCTGGAGGTTGTGGCTGG - Intronic
946247316 2:218395077-218395099 ACTGGCCTGCTGGATGTGGAGGG + Exonic
946421634 2:219568282-219568304 CGGCCCCTGCAGGACGTGGAGGG - Exonic
947385165 2:229584273-229584295 CCTCACCTGGAGGATGGGGTAGG - Intronic
947556556 2:231098637-231098659 CCTCCCCTAGAGGAAGTGGAAGG - Intronic
947747812 2:232518166-232518188 CCTATGTTGCAGGATGTTGATGG - Intergenic
948053509 2:234995204-234995226 TCTGTCCTCCAGGATGTGAAGGG + Intronic
948084193 2:235232745-235232767 CCGCTCAGTCAGGATGTGGAGGG - Intergenic
948643982 2:239392523-239392545 CCTTGCTTGCAGGATGTGGGTGG - Intronic
1168782933 20:510033-510055 CCCATACTGCAGGAGGTGGAGGG + Intronic
1170408351 20:16063232-16063254 CCTCCCCTGCTCCATGTGGAGGG - Intergenic
1171947147 20:31388797-31388819 CCTCTCCTGCAGCTGGTAGATGG + Intronic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1174087582 20:48020023-48020045 CCTCTCCTGCTGGAGGTCCAGGG + Intergenic
1175801616 20:61804289-61804311 CCTCACCTGCACCATGTGGCTGG - Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176795881 21:13371159-13371181 CTTCTCCTGCAGTCTCTGGAGGG - Intergenic
1178324130 21:31629618-31629640 CCTTTCCTGCAGGCTGTCAAGGG - Intergenic
1178887225 21:36493847-36493869 CATCTCCTCCATGGTGTGGAGGG + Intronic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179558438 21:42195348-42195370 CGTGTCCTGCTGGATGTGGATGG + Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180469952 22:15644401-15644423 CTTCTCCTGCAATCTGTGGAGGG + Intergenic
1181349097 22:22242731-22242753 CATCTCCAGCAGGGTCTGGAAGG + Intergenic
1182075274 22:27491145-27491167 CCTCTCCTGCTAGATGGGGCTGG + Intergenic
1182686523 22:32124356-32124378 CCACTTCTGCAGAATCTGGAGGG + Intergenic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1182964272 22:34506678-34506700 TCTCTCCTACAATATGTGGATGG + Intergenic
1183130219 22:35827297-35827319 CCTCTTCTGCAAGATTTGCAAGG + Intronic
1183191711 22:36325789-36325811 CAGCTCCTGCAGAATGGGGACGG - Intronic
1183257311 22:36770834-36770856 CCTCCCCTGCACACTGTGGAAGG - Intronic
1183522536 22:38303683-38303705 CCTGGCCTACAGGATGAGGATGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1185148060 22:49149939-49149961 CTCCTCCTCCAGGATGTGGGTGG - Intergenic
1185159579 22:49215143-49215165 CCTCACCTGCGGGCTGTGGACGG + Intergenic
950445082 3:13032425-13032447 CCGAACCTGCAGGATGCGGATGG + Intronic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
953135395 3:40177366-40177388 CCTGACCTACAGGCTGTGGAGGG + Intronic
954117423 3:48474899-48474921 CCTCTTCTGCATGGTGGGGAGGG - Intronic
954428244 3:50454912-50454934 CCTCTGCTTCAGGATCTGGATGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955000765 3:54925323-54925345 CCTCTCTTGCAGGTTGTAGAAGG - Intronic
957034451 3:75281090-75281112 CCTCTGCTGAAGGAGGTGGGGGG - Intergenic
959128841 3:102325839-102325861 TCTCTCCTGCAGTTTTTGGAAGG + Intronic
961501582 3:127340164-127340186 CCTCTCCACCTCGATGTGGACGG + Intergenic
962118371 3:132535868-132535890 CCTCTCCTTGAGGATGTGTCTGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964767346 3:160191605-160191627 CCTCTACAGAAGGATGGGGAAGG + Intergenic
968069899 3:195778304-195778326 TCTCTCAGGCAGGATGGGGATGG + Exonic
968628658 4:1639064-1639086 CCTCTGCTGCAGGTCGGGGAGGG - Intronic
968753422 4:2402053-2402075 CCGGTCCTGCCGGCTGTGGAGGG + Intronic
969302059 4:6302935-6302957 CCTTTCCTGGGGGATGTGCACGG + Exonic
969556720 4:7916599-7916621 CCACTCCTGCAGGAGGGGGAGGG - Intronic
969556726 4:7916604-7916626 CCCCTCCTGCAGGAGTGGGAAGG + Intronic
969583666 4:8079972-8079994 CCTCACCTGCACCATGCGGAAGG + Intronic
970347686 4:15169480-15169502 CCTGTCCTCCATGATGGGGATGG + Intergenic
970968390 4:21953278-21953300 CCTCTGCTCCAGCCTGTGGATGG + Intergenic
971035942 4:22693020-22693042 CTTTCCCTGCAGGATTTGGATGG + Intergenic
971505324 4:27360134-27360156 CCTCTCTTCCTGGGTGTGGAGGG - Intergenic
972669314 4:41198765-41198787 CCTCTCCTGAAGACTTTGGAGGG - Intronic
974004472 4:56542387-56542409 CCTCTCCTGCATGATGGGTATGG + Intronic
975643351 4:76523086-76523108 CCTCTCCTACAGGCTTTGCAGGG - Intronic
976675498 4:87697893-87697915 CCTCTCCTTCAGGCTAGGGAGGG - Intergenic
977937879 4:102827256-102827278 CCTCTCCTGCTGGAGGAGGAGGG - Intronic
979157365 4:117413472-117413494 CCTCTCCTGCAGGAAATCAAGGG - Intergenic
981859068 4:149333236-149333258 CCTCCCCTAGAGGATTTGGAGGG - Intergenic
983993919 4:174158452-174158474 GCCCTCATGCAGGTTGTGGATGG + Intergenic
984876881 4:184376710-184376732 CCTCCCCTGGAGGCTTTGGAGGG + Intergenic
985647981 5:1093999-1094021 CCTGTCCTGAAGGCTGTGGCGGG - Intronic
985991263 5:3563852-3563874 CCTCTCCAGCAGACTCTGGAAGG - Intergenic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
987197095 5:15537532-15537554 CATCCCCTGCAGGATGGGGTTGG + Intronic
987216241 5:15740314-15740336 CCTTTCCTGCAAGTTATGGATGG + Intronic
987522660 5:19006805-19006827 ACCATCCTGCAGGATGTTGAAGG - Intergenic
988665401 5:33321860-33321882 CCACTTCTGCATGATGAGGAAGG + Intergenic
989450031 5:41575613-41575635 CCTCTCTTCCAGGCTGTGAAGGG - Intergenic
991175799 5:63686533-63686555 CCTCTTCAGCAGGAAGTAGATGG - Intergenic
995785811 5:115826169-115826191 CGCCTCATGCAGGAAGTGGAAGG - Intergenic
997280633 5:132642039-132642061 GCTACCCTGCAGGAAGTGGAGGG - Intronic
998469714 5:142374339-142374361 CCAATCCTGAAGGATGTGGTGGG - Intergenic
999028146 5:148259250-148259272 ACACACCTGCAGGATGTGGCTGG + Intergenic
999262978 5:150249022-150249044 CTTCCACTGCAGGATGGGGATGG + Intronic
999383855 5:151140493-151140515 CCTCTCCTGGATGCTTTGGAAGG - Intronic
1001398603 5:171433556-171433578 CCTGAGCAGCAGGATGTGGAAGG + Intronic
1003115087 6:3278254-3278276 CCTCTCATGCAGGCTGTGACAGG + Intronic
1003243150 6:4361806-4361828 CCTCTCCTCCTGGCTGTGGCTGG + Intergenic
1003619941 6:7691024-7691046 CTTCTCCTGAAGCATGTGAATGG + Intergenic
1004518264 6:16339097-16339119 CCTTCCCTGCGGGATGTGGAAGG - Intronic
1005012192 6:21346720-21346742 CCTCCCCTAGAGGATTTGGAGGG - Intergenic
1007053224 6:38854677-38854699 CCTCTCCTTCAGGATATACAGGG - Intronic
1008552554 6:52646966-52646988 CCATTCCTGGAGGAAGTGGAAGG - Intergenic
1011495533 6:87933597-87933619 CCTGGCATCCAGGATGTGGAGGG + Intergenic
1014759595 6:125341858-125341880 CCTCTCTTAGAGGATTTGGAGGG + Intergenic
1014810965 6:125885147-125885169 TTTCTCCTGCAGGGTGTGGTTGG + Exonic
1016786935 6:148021178-148021200 CCCCTCCTCCAGAATCTGGATGG - Intergenic
1017195154 6:151692572-151692594 CCTCTCCTGATAGAGGTGGATGG - Intronic
1017772206 6:157652072-157652094 CCTCCTCTGCAGGATGTCAAAGG - Intronic
1018476813 6:164150713-164150735 CCTGTCCACCAGGGTGTGGAGGG + Intergenic
1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG + Intergenic
1020149048 7:5667518-5667540 CTGCTCCTGCAGGATGGAGAAGG - Intronic
1021797174 7:24267747-24267769 CCTCTGCTGTAGAGTGTGGAAGG + Intergenic
1021884998 7:25129492-25129514 CCACTGCTGGGGGATGTGGAAGG + Intergenic
1021923604 7:25513031-25513053 CCTCTCCAGCAGGAGGGGAAGGG - Intergenic
1023177028 7:37445527-37445549 CCTTTGCTGAAGGATGTGGCTGG - Intronic
1025035471 7:55590517-55590539 CTTCTCCTCCAGGATGAGGTGGG + Intergenic
1026009841 7:66628474-66628496 CCTTTCCTGGAGGATGTGGCGGG - Intergenic
1026953950 7:74365195-74365217 GCTCTCCTGCAGGGGTTGGATGG + Intronic
1027001340 7:74657020-74657042 TCTCTCCCTCAGGATTTGGAAGG - Intergenic
1032238544 7:130143760-130143782 CCTCACCTGGTCGATGTGGAAGG - Intergenic
1032439347 7:131930277-131930299 GCTCACCTGTATGATGTGGAAGG + Intergenic
1032471550 7:132182616-132182638 CAGCCCCTGCAGGATGTGGTGGG - Intronic
1033647354 7:143315758-143315780 TCTCTTCTTCAGGATGCGGAAGG - Intergenic
1033660098 7:143396992-143397014 CCTGGCCTCCAGGATGGGGAGGG + Intronic
1034530809 7:151695354-151695376 CTCCCCCTGCAGGAAGTGGATGG - Intronic
1034999866 7:155604060-155604082 CCTCCCTTGCAGTATTTGGACGG - Intergenic
1035073155 7:156159409-156159431 CCACTCCTGCAGCATGGGGATGG + Intergenic
1035530825 8:349767-349789 CCGAGCCTGGAGGATGTGGACGG - Intergenic
1036480837 8:9138101-9138123 CCTCTCCTGCATTGTGGGGAGGG + Exonic
1039005189 8:33028441-33028463 CCTCTGCTACAGGATGGGGTAGG - Intergenic
1039891808 8:41690589-41690611 CCTCTCCTGCAGGTGTTGGAAGG - Exonic
1046119177 8:109823564-109823586 CCTTTCCTGTAAGATCTGGATGG - Intergenic
1046121803 8:109856548-109856570 CCTTCCCTGGAGGTTGTGGATGG + Intergenic
1047416783 8:124671139-124671161 CCTGTCATGGTGGATGTGGAAGG - Intronic
1047653275 8:126947759-126947781 CTTTTCCTGAAGGATGTGGAGGG + Intergenic
1048538410 8:135319249-135319271 CCTTTCCTGCATGATCTGTATGG - Intergenic
1049511302 8:143028154-143028176 CCTCCCCTGCAGGTTGAGGTTGG - Intergenic
1051296493 9:15601423-15601445 CCTCTTCTGTAGAATCTGGAAGG + Intronic
1055389327 9:75801913-75801935 TCTCTCAGACAGGATGTGGAGGG + Intergenic
1055469374 9:76595968-76595990 CCTATCCTTCAGGAAGTGGAAGG + Intergenic
1055555018 9:77465026-77465048 CCTCTCCTATAGGCTTTGGAGGG + Intronic
1056849886 9:90073530-90073552 ACTCTCCATCAGGATGAGGAGGG - Intergenic
1057223030 9:93268003-93268025 GCTCTCCTGAATGAGGTGGAGGG - Exonic
1057675122 9:97131821-97131843 CCTGTCCAGCAGGATGTGCTGGG - Intergenic
1057899444 9:98936759-98936781 ACTCTCCTCCAGAATGTGGTTGG - Intergenic
1058155222 9:101507195-101507217 TCTCTCTTGCAATATGTGGATGG + Intronic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1061271606 9:129546909-129546931 CCTAGACTGAAGGATGTGGAGGG + Intergenic
1061537783 9:131260221-131260243 CCTCTTCTGCCAGAGGTGGAGGG - Exonic
1062401720 9:136375731-136375753 CCTCTCTTGCAGGCTGGGGGTGG + Exonic
1062733745 9:138123125-138123147 TCTCTTCTGCTGTATGTGGAAGG - Exonic
1185548466 X:965237-965259 CCTCCCCTACAGCCTGTGGAGGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187440947 X:19319215-19319237 CCTCTCCAGCTGGAGGCGGAAGG - Intergenic
1187850410 X:23586233-23586255 CTTCTCCAGCACGATGTGGAGGG + Intergenic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189104903 X:38225396-38225418 CCTCTCCTGCAGTACGTAGATGG - Intronic
1193406740 X:81109639-81109661 GCTATCCTGTAGGATGTTGAAGG + Intergenic
1199484957 X:148337676-148337698 CCACTGCTGCAGGATGGGGAAGG - Intergenic
1199833915 X:151569836-151569858 CCTTTCTTTCAGGAAGTGGAAGG + Intronic