ID: 1165705231

View in Genome Browser
Species Human (GRCh38)
Location 19:37971237-37971259
Sequence TCCCTAAGTGCTGGGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580530
Summary {0: 1, 1: 66, 2: 8127, 3: 307731, 4: 264605}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165705221_1165705231 27 Left 1165705221 19:37971187-37971209 CCCAGGCAGGTCTCAAACTCCTG 0: 254
1: 19906
2: 39786
3: 57249
4: 50789
Right 1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG 0: 1
1: 66
2: 8127
3: 307731
4: 264605
1165705225_1165705231 8 Left 1165705225 19:37971206-37971228 CCTGGGTTCAAGTGATCCTCCTG 0: 1160
1: 43741
2: 126034
3: 199614
4: 269506
Right 1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG 0: 1
1: 66
2: 8127
3: 307731
4: 264605
1165705226_1165705231 -8 Left 1165705226 19:37971222-37971244 CCTCCTGTCTCTGCCTCCCTAAG 0: 6
1: 172
2: 5041
3: 67318
4: 156065
Right 1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG 0: 1
1: 66
2: 8127
3: 307731
4: 264605
1165705222_1165705231 26 Left 1165705222 19:37971188-37971210 CCAGGCAGGTCTCAAACTCCTGG 0: 255
1: 19882
2: 83826
3: 154004
4: 187122
Right 1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG 0: 1
1: 66
2: 8127
3: 307731
4: 264605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165705231 Original CRISPR TCCCTAAGTGCTGGGAGTGC AGG Intronic
Too many off-targets to display for this crispr