ID: 1165705426

View in Genome Browser
Species Human (GRCh38)
Location 19:37972954-37972976
Sequence TGTGATCCTGATTAGTTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165705421_1165705426 11 Left 1165705421 19:37972920-37972942 CCAGAAGTTGCACACATTTCCTT 0: 1
1: 0
2: 2
3: 22
4: 217
Right 1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG 0: 1
1: 0
2: 2
3: 9
4: 114
1165705422_1165705426 -8 Left 1165705422 19:37972939-37972961 CCTTCACTCCTTCCCTGTGATCC 0: 1
1: 0
2: 3
3: 58
4: 618
Right 1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG 0: 1
1: 0
2: 2
3: 9
4: 114
1165705420_1165705426 12 Left 1165705420 19:37972919-37972941 CCCAGAAGTTGCACACATTTCCT No data
Right 1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG 0: 1
1: 0
2: 2
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165705426 Original CRISPR TGTGATCCTGATTAGTTACA TGG Intronic
901042696 1:6374904-6374926 GTTCATCCTGATCAGTTACATGG + Intronic
910224021 1:84918141-84918163 TGTGATTGTGTTTAATTACAGGG + Intergenic
913103291 1:115589826-115589848 TTTGAACATGTTTAGTTACATGG + Intergenic
913528476 1:119715438-119715460 TGTGATCCTGATTAATTTGATGG - Intronic
916874403 1:168953603-168953625 TGTGAACATGATCTGTTACATGG - Intergenic
917872315 1:179252874-179252896 TGTTATACTCATTAGTTAAATGG + Intergenic
919512685 1:198486032-198486054 TGTGATCTTATTTGGTTACAGGG + Intergenic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1063583474 10:7330354-7330376 TGTGATTCAGATTAGTTATGGGG - Intronic
1064929492 10:20608734-20608756 TGTGAGCATCATTAGTGACAAGG - Intergenic
1065672658 10:28137844-28137866 TGTGAGTCTGATGAGTTACAAGG - Intronic
1065951230 10:30653247-30653269 TGTGCTGCAGATTTGTTACATGG - Intergenic
1070269728 10:74941255-74941277 TGTTATTCTGAATAGTCACATGG + Intronic
1071207493 10:83298144-83298166 TGTGATACTGATTATTTAAATGG + Intergenic
1072487359 10:95868645-95868667 TGTGATCCTCATTTGTAAAATGG - Exonic
1074798769 10:116977590-116977612 TGTGATTCTGCATGGTTACAGGG + Intronic
1075192939 10:120327981-120328003 TGTGAGCCTCATTAATAACAGGG - Intergenic
1078438175 11:11342747-11342769 TGTGAACCTGAGTAGTCTCATGG - Intronic
1080814561 11:35741697-35741719 TGTTATCCTGATAAGTTCCGAGG - Intronic
1081227125 11:40537750-40537772 TGTGATACAGATTAGTTCCCTGG + Intronic
1083010430 11:59392159-59392181 TGTGACCCTGATTTGGAACATGG - Intergenic
1083176730 11:60954772-60954794 TCTGATAGTGTTTAGTTACATGG + Intergenic
1093182887 12:15987684-15987706 TGTTCTCCTGATTGGTTACATGG + Intronic
1093185810 12:16018387-16018409 TGTCCTCATGATTCGTTACAGGG - Intronic
1095607097 12:44081371-44081393 TGTGATCCTAATTAGATGCATGG + Intronic
1096021142 12:48326581-48326603 TGTGACCCTGAGGATTTACATGG - Intergenic
1096423481 12:51480649-51480671 TGGATTTCTGATTAGTTACACGG - Intronic
1098790785 12:74819165-74819187 CATGATACTGATTATTTACATGG + Intergenic
1102565985 12:113797780-113797802 TGTGATCATCTTTAGTTATAGGG - Intergenic
1102616500 12:114159182-114159204 TGAGATCCTGCTTAGTCATAAGG - Intergenic
1104211308 12:126691373-126691395 TGTTATTCTGATAGGTTACAGGG + Intergenic
1106468066 13:30030549-30030571 TGTGACCCTGATTATTCCCAAGG + Intergenic
1107446525 13:40474396-40474418 GATGAGCCTGATTAGATACAAGG + Intergenic
1109302447 13:60603260-60603282 TGTGACCCTGCTTTGTTACTAGG - Intergenic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1110471161 13:75861756-75861778 TGTGATCCTCAGAAATTACAGGG - Intergenic
1114212803 14:20630243-20630265 TGTGATTCTGTTTACTCACAAGG - Intergenic
1115760468 14:36575937-36575959 TGTGCTCCTGATGGGTTAGAAGG - Intergenic
1117844159 14:59893785-59893807 TGTGATCCTGCTTAGTCTAAAGG - Intergenic
1119102344 14:71891483-71891505 TGGTATCCTGATTTCTTACATGG + Intergenic
1122175975 14:99919500-99919522 TGGGAGCCTGATGAGTTAGAAGG - Intronic
1128929394 15:71690556-71690578 TGTGAACATGTTAAGTTACATGG + Intronic
1132906152 16:2283746-2283768 TGTGATCTTGCTTAGAAACAGGG + Intronic
1134536419 16:15030214-15030236 TCTGATTCTGGTAAGTTACATGG - Intronic
1137995544 16:53206843-53206865 TGTAATCCTGATTAATAATAGGG - Intronic
1139054845 16:63170346-63170368 TGAGTTTCTGATTAGTCACAGGG + Intergenic
1139859650 16:70010572-70010594 TCTGATTCTGGTAAGTTACATGG + Intergenic
1146188496 17:30744481-30744503 TGAGATCCTGAATTGTTACCTGG + Intergenic
1148524764 17:48321048-48321070 TGTGATACTAATCAGTAACATGG + Intronic
1148800717 17:50223671-50223693 TGTGATCCTCAAAATTTACAAGG - Intergenic
1152531978 17:80923988-80924010 CGTGCTCCTGTTTCGTTACATGG - Intronic
1153373526 18:4349046-4349068 TAAGATCCTTATTAGCTACAAGG + Intronic
1156431675 18:37081388-37081410 TGTGATACTGATTAATTAAATGG - Intronic
1156613709 18:38757706-38757728 TGTGATAATGATTAGCTATATGG + Intergenic
1158860242 18:61584479-61584501 TGTGATCCTGATTGGTCTAAGGG + Intergenic
1163195421 19:15716317-15716339 TGGGATCCTCATTTGTGACATGG - Intergenic
1163218646 19:15898539-15898561 TGGGATCCTCATTTGTGACATGG + Intergenic
1164891953 19:31831399-31831421 TCTGATACTGATTAGTTTCTGGG - Intergenic
1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG + Intronic
927639886 2:24839782-24839804 TGTGACCCTGATGAGGGACAGGG - Intronic
927707708 2:25307088-25307110 TGTCATCATGATTAGTTAGGGGG - Intronic
932435051 2:71698300-71698322 TGTGAACCTGGTTAGTTAAGGGG + Intergenic
933176693 2:79181625-79181647 TGTAATTCTGATTAGTTAGGAGG - Intergenic
933200743 2:79445358-79445380 TCTGATATTGATTTGTTACATGG + Intronic
935441077 2:103095932-103095954 TGTGATGCAGATAACTTACATGG - Intergenic
939580259 2:143938252-143938274 TGTGATCCTGATTAATTAAAAGG - Exonic
941109666 2:161405218-161405240 TGTGATACTTAGTAGTAACAGGG - Intronic
945008839 2:205440173-205440195 TCTGATCTTTATTTGTTACAGGG - Intronic
945493235 2:210480100-210480122 TGTGATCCTGAATGGCCACATGG - Intronic
946954821 2:224917857-224917879 TGTGCACCTCAGTAGTTACAGGG + Intronic
947623958 2:231607852-231607874 TGGCATCCTGATGAGTGACAAGG + Intergenic
1168804593 20:664897-664919 TGAGATCCAGAGAAGTTACAGGG - Intronic
1170538309 20:17363542-17363564 TGTGATCATGACAAGATACAGGG + Intronic
1177889984 21:26793506-26793528 TGTGATCCTGTTAAAATACAGGG - Intergenic
1178151545 21:29800136-29800158 TGTGATCCAGATAACTTATAAGG - Intronic
1183125489 22:35776186-35776208 TGTGATCTTTTTTAGCTACAAGG - Intronic
1184901653 22:47450099-47450121 TGTGAGCATGTTTGGTTACACGG - Intergenic
950829797 3:15861653-15861675 TGAGAACCTGATTAGGAACATGG + Intergenic
954178743 3:48864944-48864966 TATAATCCTGAATAATTACAAGG + Intronic
955715258 3:61822892-61822914 TTTGAGACTGATTCGTTACATGG + Intronic
959582433 3:107995435-107995457 TGTAAGACTGATTAATTACATGG - Intergenic
960912625 3:122664538-122664560 TGTGTTTCTGTTTAGTTATAGGG + Intergenic
966564381 3:181360355-181360377 TCTTATCCTGATTATTTAAAAGG - Intergenic
971608445 4:28688579-28688601 TGTGATAATCATTATTTACATGG - Intergenic
971896921 4:32608558-32608580 TATGATGCTGGTTTGTTACATGG - Intergenic
977329669 4:95621765-95621787 TGGGACCCTGAGTAGTGACATGG - Intergenic
984462640 4:180057706-180057728 TGTGATGCTGCTTAGTTAACTGG + Intergenic
984784935 4:183558857-183558879 TGACATACTGATTAGGTACACGG + Intergenic
993399465 5:87430980-87431002 TGTGTCCCTGATCAGTAACAGGG + Intergenic
995945687 5:117642875-117642897 TGTGATCATGCATAGATACAGGG + Intergenic
998884944 5:146684484-146684506 TGTGATCCTGATTAGATACCTGG + Intronic
1010142340 6:72625583-72625605 TGTGGTTCTGAGAAGTTACATGG + Intronic
1011351872 6:86432668-86432690 TTTGGTCCTGATGAGTCACAAGG + Intergenic
1012323664 6:97885746-97885768 TGGGATCCTTATTACTTTCATGG + Intergenic
1024757833 7:52557199-52557221 TGAGCTCCTGATTATTGACAGGG - Intergenic
1030355443 7:108537481-108537503 TGTGCTCCTAACAAGTTACAAGG - Intronic
1034149923 7:148907020-148907042 TGTGGTCCTGATTTGTATCAGGG - Intergenic
1035320671 7:158027318-158027340 TGTGATCCTGTTTAAATAAATGG + Intronic
1038259806 8:25982794-25982816 TGTGTTTCTGTTTAATTACATGG - Intronic
1042451550 8:68953198-68953220 TGGGATACTGTTTAGTTAAAAGG + Intergenic
1042601752 8:70505813-70505835 TGTCATCCTCCTTAGTTGCAAGG + Intergenic
1043603468 8:81970435-81970457 TGTGATGGTTATTGGTTACAAGG - Intergenic
1051487988 9:17629173-17629195 TGTGATCTGGATTAGTCACAAGG + Intronic
1051753025 9:20364255-20364277 TGTGTACCTGATTTATTACATGG - Intronic
1052625324 9:30967954-30967976 TGTGATACAGATAAGTTACGTGG - Intergenic
1058874451 9:109231343-109231365 TCTGATGATGATTAGTTACCTGG + Intronic
1060019391 9:120116082-120116104 TGTGATCCTGGCCAGTTCCAGGG - Intergenic
1187675487 X:21711987-21712009 TGTGGTCCTGATGAGTAAAAGGG - Intronic
1187728397 X:22227729-22227751 TGTTATCTTGATTATTTTCAGGG + Intronic
1188879684 X:35476625-35476647 TGTGATTCTGATTTATTACTGGG + Intergenic
1192618977 X:72657688-72657710 TGTATTTCTGATTAATTACATGG - Intronic
1194144671 X:90247289-90247311 TGTGATGGTGATTAGTTGCGGGG - Intergenic
1194465609 X:94231437-94231459 TGTGTTTCTGATTAGGTACTTGG + Intergenic
1196150849 X:112372059-112372081 TTTAATTTTGATTAGTTACATGG - Intergenic
1196653029 X:118188182-118188204 AGTGAACCTGATTTGTTCCAAGG + Intergenic
1198163318 X:134028924-134028946 TGTTATCCTTATTATTTTCATGG - Intergenic
1199143469 X:144336920-144336942 TCTGATGCTGATTAGTTAGAAGG - Intergenic