ID: 1165707612

View in Genome Browser
Species Human (GRCh38)
Location 19:37987662-37987684
Sequence CAGCTGGCCTAGGGGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165707612_1165707619 -1 Left 1165707612 19:37987662-37987684 CCTGGGACCCCCTAGGCCAGCTG 0: 1
1: 0
2: 2
3: 25
4: 290
Right 1165707619 19:37987684-37987706 GGTCACTCACATCGATGCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1165707612_1165707620 19 Left 1165707612 19:37987662-37987684 CCTGGGACCCCCTAGGCCAGCTG 0: 1
1: 0
2: 2
3: 25
4: 290
Right 1165707620 19:37987704-37987726 AGGTCCCACAGTAGCAGTCATGG 0: 1
1: 0
2: 2
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165707612 Original CRISPR CAGCTGGCCTAGGGGGTCCC AGG (reversed) Intronic
900572399 1:3365063-3365085 CCACTGGCCGAGTGGGTCCCTGG - Intronic
901038664 1:6351216-6351238 CAGTTGGCCTAAGTGGGCCCTGG - Intronic
902156549 1:14492259-14492281 CAGATGGCCTCAGGGCTCCCTGG + Intergenic
902601060 1:17540313-17540335 GCGCTGACCTTGGGGGTCCCTGG + Intronic
903667115 1:25014788-25014810 CAGCTGGGGTTGAGGGTCCCTGG - Intergenic
904237718 1:29125033-29125055 GAGCTGGAAGAGGGGGTCCCGGG - Intergenic
904285212 1:29449607-29449629 CAGCTGACCTGGGGGAGCCCCGG - Intergenic
904336348 1:29800682-29800704 CATCTGGCCAAGTGAGTCCCTGG + Intergenic
904342359 1:29845189-29845211 CAGGTGGCCTGGGGTGTCCTTGG + Intergenic
904399803 1:30248538-30248560 CAGGTGGCCTGGGGTGTCCTTGG - Intergenic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905920173 1:41714057-41714079 CAGCTGGACTACAGGGGCCCGGG + Intronic
906323376 1:44829914-44829936 CAGCTCTCCTTGGGGGTCTCTGG + Exonic
907917129 1:58881566-58881588 CAGCTGGACTGAGGGATCCCTGG + Intergenic
910626591 1:89313985-89314007 CAGGTGGCCTAGGGGGTGTGGGG + Intergenic
916688132 1:167166370-167166392 CAGCTGACCTCTGGGGTCCCCGG - Intergenic
917981379 1:180271756-180271778 CCGCCCGCCTAGGGGGTCCTGGG + Intronic
918589505 1:186224459-186224481 CAGCAGGTCTATGGGGTCCTAGG - Intergenic
919003846 1:191870358-191870380 CAGCAGGCTTATGGGGTCCTAGG + Intergenic
920336648 1:205249510-205249532 CAGCCGGCCGTGGGGGCCCCTGG + Intronic
920640131 1:207743831-207743853 CAGCAGGCTTATGGGGTCCTGGG - Intergenic
923667067 1:236007794-236007816 CAGCTTTCCTGGGTGGTCCCTGG - Intronic
924610398 1:245568644-245568666 CAGCTGGCCCTGGGCGTCACAGG + Intronic
1062813232 10:481024-481046 CACCTGGGCTGGAGGGTCCCGGG - Intronic
1062938264 10:1403703-1403725 CTGCAGGCCGAGTGGGTCCCAGG - Intronic
1063159695 10:3410179-3410201 CAGCTTCCCTGGTGGGTCCCTGG + Intergenic
1066182945 10:32981110-32981132 CAGCTGGCCCAGGAGGGGCCTGG + Intronic
1067471561 10:46541854-46541876 CAGCTGTCCTACGGTATCCCAGG + Intergenic
1068496593 10:57791120-57791142 CAGCAGGCTTATGGGGTCCTGGG - Intergenic
1069544880 10:69320681-69320703 CTGCTGGGCTGGGGGGTGCCTGG + Intronic
1070609983 10:77926558-77926580 CCGCCGGCCTCGGGGGGCCCGGG - Intergenic
1073107259 10:101039281-101039303 CAGCTGACCTAGGGTCTTCCAGG + Intronic
1074441997 10:113486174-113486196 CAGCTTACCAAGGGGGTCTCAGG - Intergenic
1075222606 10:120598308-120598330 CAGATGGCCTGGAGAGTCCCAGG + Exonic
1076680800 10:132170272-132170294 CAGCCGCCCTCGGGGGACCCTGG - Intronic
1076695359 10:132244658-132244680 GAGGTGGCTTAGGGGGACCCTGG - Intronic
1076792088 10:132782401-132782423 CACCTGGCAGAGGGGGTCCCTGG - Exonic
1077556330 11:3227836-3227858 CAGCTGGGGTCGGGGGCCCCAGG + Exonic
1077720663 11:4625342-4625364 CAGCAGGCTTATGGGGTCCTGGG + Intergenic
1078079015 11:8190662-8190684 CAGCAGGCCTAGGAGGGGCCTGG - Intergenic
1078417326 11:11176514-11176536 CACCAGTCCTAGAGGGTCCCAGG + Intergenic
1078933290 11:15929706-15929728 CAGCTGGCCTGAGTGGACCCGGG - Intergenic
1080810720 11:35701657-35701679 CAGCAGGCTTATGGGGTCCTAGG + Intronic
1082121368 11:48383438-48383460 CAGCAGGCTTATAGGGTCCCAGG + Intergenic
1082228809 11:49740284-49740306 CAGCAGGCTTAGGGGGTCCTGGG + Intergenic
1082252496 11:49997192-49997214 CAGCAGGCTTATGGGGTCCCAGG - Intergenic
1082555356 11:54557689-54557711 CAGCAGGCTTATAGGGTCCCAGG + Intergenic
1083616471 11:64028905-64028927 CTGCTGGCCTAGGTGCTCCAGGG - Intronic
1084267077 11:68010603-68010625 CTGCTGGCCAGGGGGGTGCCCGG - Intronic
1084358166 11:68652943-68652965 AAGCTGGCCTTGGGTGTCCTTGG + Intergenic
1084449761 11:69229547-69229569 GAACTGGCCTATGGGGCCCCAGG - Intergenic
1086621257 11:88888839-88888861 CAGCAGGCTTAGGGGGTCCTGGG - Intronic
1087232968 11:95686627-95686649 CAGCTGGGCTTGTGGGTTCCTGG + Intergenic
1089566669 11:119375421-119375443 CACCTGGCCCAGGGGGCCCCTGG + Intronic
1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG + Exonic
1090291779 11:125552299-125552321 CAGCAGGCTTATGGGGTCCTGGG + Intergenic
1092527152 12:9316193-9316215 CAGCTGGCCTAGAGGCTACTGGG + Intergenic
1092540120 12:9415580-9415602 CAGCTGGCCTAGAGGCTACTGGG - Intergenic
1092938740 12:13387649-13387671 CAGTTGTCCTCAGGGGTCCCAGG - Intergenic
1094113317 12:26884019-26884041 TAGCTGGCCCAGGAGATCCCAGG - Intergenic
1094512920 12:31106876-31106898 CAGCTGGCCTAGAGGCTACTGGG + Intergenic
1094872133 12:34604459-34604481 CAGGGGACCTTGGGGGTCCCTGG + Intergenic
1095948350 12:47766657-47766679 CAGGTGGCCTGGGGGGTCAGGGG - Intronic
1095982949 12:47983093-47983115 CCCCTGGCCTCGTGGGTCCCAGG - Exonic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1096044095 12:48546671-48546693 CAGCAGGCTTATGGGGTCCTGGG + Intergenic
1096235203 12:49921715-49921737 CAGCTGGCCTGGGGGGTCCTTGG + Intergenic
1096627821 12:52906156-52906178 CACCTGGCCCAGGGGATCCTAGG - Intronic
1102192475 12:110999112-110999134 CAGCTGGTCTGGGAGATCCCAGG - Intergenic
1102239019 12:111312227-111312249 CAGCTGGCCCCGGGGGCCTCAGG - Intronic
1102959775 12:117085044-117085066 CAGCTGGCCAAGGGGCACCAGGG + Intronic
1103085429 12:118059384-118059406 GGGCTGGCCTAGAGGGTGCCTGG + Intronic
1103457800 12:121080015-121080037 CTGCAGGCCTGGGGGGTTCCGGG - Intergenic
1104799087 12:131541111-131541133 CAGCTGGCCTGGGTTGCCCCAGG - Intergenic
1106178377 13:27350450-27350472 AAGCTGACCTAGGGGGTGCCTGG + Intergenic
1106242929 13:27924754-27924776 CAGAGGGCCTAGGAGGACCCCGG + Exonic
1111249509 13:85585565-85585587 CTGCTGGCCTATGAGCTCCCTGG + Intergenic
1112437200 13:99399096-99399118 CAGCTGGCCTAGCAGAGCCCTGG + Intergenic
1113910769 13:113840196-113840218 CAGCTGACCTGGGGGCTTCCAGG + Intronic
1113920834 13:113908392-113908414 CTGCTGGCCTGGTGGGGCCCAGG + Intergenic
1118852327 14:69593484-69593506 CAGCTGTCATCAGGGGTCCCTGG + Intergenic
1118920076 14:70142026-70142048 CAGCTGGCCAATGGGTTCCACGG + Intronic
1118999617 14:70870500-70870522 CAGCAGGCTTATGGGGTCCTAGG + Intergenic
1121328855 14:93037053-93037075 CAGCTGGACCAGGGAGGCCCTGG + Intronic
1121408749 14:93734928-93734950 CAGGTGGGCTGGGGGCTCCCAGG - Intronic
1121544983 14:94756567-94756589 CCTCTGGCCTGGGGGGGCCCAGG - Intergenic
1122124301 14:99570868-99570890 CAACTGGCCTGGGTGGTCCCAGG + Intronic
1122147075 14:99697805-99697827 CAGCAGGCCATGGGGGTGCCTGG + Intronic
1122788091 14:104173153-104173175 CTGCTGGCCGAGGTGGCCCCTGG + Exonic
1124434485 15:29635610-29635632 CAGCACACCTAGGGGGTCCACGG + Intergenic
1130925630 15:88383633-88383655 CAGCTGACCTAGAGTGGCCCTGG - Intergenic
1137668777 16:50267226-50267248 CAGATGGCCCATGCGGTCCCTGG - Intronic
1138868226 16:60849579-60849601 CAGCAGGTCCAGTGGGTCCCTGG + Intergenic
1139661508 16:68424087-68424109 CAGGGGGCCTAGGTGGTCCTAGG + Intronic
1140067561 16:71624666-71624688 GAGCTGGACAAGGAGGTCCCTGG - Intergenic
1140481593 16:75265511-75265533 CAGCTGTCCCAGGGGTTTCCCGG + Intronic
1141614597 16:85203052-85203074 CAGCTGGCCTCGGCGGTGGCAGG + Intergenic
1142126769 16:88414366-88414388 CATCTGGCCTCGGGGGCACCTGG + Intergenic
1142129788 16:88427419-88427441 CAGCTGTCCGAGGGGGGCCCTGG - Intergenic
1142156274 16:88534118-88534140 CGGCCGGCCCAGGGGGTCCCGGG - Exonic
1142203720 16:88772973-88772995 CAGCTGGCCCCAGGGGTGCCTGG + Intronic
1142229368 16:88892647-88892669 CAGCTGCCCTGGGCGGGCCCAGG - Intronic
1143026326 17:3943898-3943920 GAGGTGGCCTGAGGGGTCCCCGG - Intronic
1143204472 17:5132510-5132532 CAGCTGGCCTGGGCGGTGGCGGG + Intronic
1143404422 17:6667775-6667797 CAGGAAGCCTGGGGGGTCCCAGG + Intergenic
1144626558 17:16846976-16846998 CAGCGGGCCTGGCGGGACCCTGG - Intergenic
1144875543 17:18395198-18395220 CAGCTGGCCTGGGCGGTGGCGGG + Intergenic
1145152360 17:20518649-20518671 CAGCGGGCCTGGCGGGACCCTGG - Intergenic
1145156683 17:20549223-20549245 CAGCTGGCCTGGGCGGTGGCGGG - Intergenic
1145248367 17:21284403-21284425 CAGCGGGCTCAGTGGGTCCCGGG + Intergenic
1145868469 17:28255639-28255661 CAGCTGGCCTAGGAGGGGCCTGG + Intergenic
1145978689 17:28998776-28998798 CAGCAAGCCTCTGGGGTCCCTGG - Intronic
1146062700 17:29615488-29615510 GAGCTGGCCTAGGGAGGCCTGGG - Exonic
1146163705 17:30572852-30572874 CAGCGGGCCTGGTGGGACCCTGG - Intergenic
1146850775 17:36219823-36219845 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
1147580700 17:41625663-41625685 CAGCGGGCCTGGCGGGACCCTGG - Intergenic
1147923622 17:43933463-43933485 CAGCTGGCCTAGGAGAGGCCTGG - Intergenic
1148341109 17:46874031-46874053 CAGCTGGCCTAGGAGGGGCCTGG - Intronic
1148641738 17:49192895-49192917 CGGCCGGTCTAGGAGGTCCCAGG + Intergenic
1149683903 17:58524322-58524344 CAGGTAGCCTAGAGGGTGCCTGG + Intronic
1150288173 17:63965823-63965845 CATGAGGCCTAGGGGGTCCTGGG + Intronic
1150804619 17:68309171-68309193 CAGCTGGCCCTGCGGGCCCCGGG - Intronic
1151715717 17:75830126-75830148 CAGCTGGACAAAGGGGTCGCTGG + Exonic
1151821859 17:76501082-76501104 CAGGACGCCTAAGGGGTCCCTGG - Intronic
1152070888 17:78133097-78133119 CAGCTGGTGTAGGCGGTGCCAGG + Intronic
1152987768 18:335168-335190 CAGTTGGGCCAGGGGGTCCCTGG + Exonic
1156038199 18:32789531-32789553 CAGCTGGCCAAGGGGGTTCTAGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156537627 18:37879319-37879341 CAGTGGGTCTAGTGGGTCCCTGG + Intergenic
1159395096 18:67846363-67846385 CAGTTCCCCTAGGGTGTCCCTGG - Intergenic
1160701086 19:507757-507779 GAGCTGGCCCGGGGGCTCCCCGG - Exonic
1160881967 19:1325019-1325041 CAGCGGGACAGGGGGGTCCCGGG + Intergenic
1161484141 19:4525651-4525673 CAGCTGGGCCAGGGTGTCCTGGG + Exonic
1161731636 19:5964383-5964405 CAGCTGGCAGAGTGGTTCCCAGG - Intronic
1162575155 19:11495048-11495070 CAGCTGGCCGAGGGGAAGCCGGG - Intronic
1163472451 19:17505454-17505476 CAGTTGGCCTGGGGGACCCCCGG - Exonic
1163475120 19:17521317-17521339 CAGCAGGCCTGGGGGCGCCCTGG + Intergenic
1163512985 19:17747275-17747297 CAGCCGGCCTAGGGCAGCCCCGG - Intergenic
1163638661 19:18449662-18449684 CAGCTGGCCCAGGGCAGCCCAGG - Intronic
1165707612 19:37987662-37987684 CAGCTGGCCTAGGGGGTCCCAGG - Intronic
1166319113 19:42005624-42005646 CAGCCTGCCTCGGGGGTGCCTGG + Intronic
1167655528 19:50761308-50761330 GGGCTGGCCTAGGGACTCCCTGG - Intergenic
1167657330 19:50773460-50773482 GGGCTGGCCTAGGGACTCCCGGG + Intergenic
1167660172 19:50791737-50791759 CAGCGGGCCTCGGGGCTCCCTGG - Exonic
1168316413 19:55486607-55486629 CGGGTGGCCTGGGGGGCCCCTGG + Exonic
1168324579 19:55531384-55531406 CAGCTGGCCCAGGTGGCCCTTGG - Intronic
926197839 2:10774461-10774483 CAGCTGGCACAGGGTGTCCCTGG - Intronic
926496246 2:13592433-13592455 CAGCTGGGCTAGAGAGTCCAAGG + Intergenic
926861756 2:17317411-17317433 AAGCTGGCCTAGTGGGTCCCAGG + Intergenic
926919329 2:17925524-17925546 CCGCAGGGCTAGGGGGTCTCAGG + Intronic
927487217 2:23496664-23496686 GAGCTGCCCTAGGGGGCCCAGGG + Intronic
929220748 2:39462802-39462824 CAGTTTGCCTAGGATGTCCCTGG + Intergenic
929366631 2:41166079-41166101 GAGCTGGCTTTGGGAGTCCCAGG - Intergenic
931756457 2:65378989-65379011 AATCAGGCCAAGGGGGTCCCAGG - Intronic
932743745 2:74313892-74313914 CAGCTGCCCTAGGTGCTCCCTGG + Intronic
935064647 2:99636994-99637016 CAGCTGGCTCTGGGAGTCCCAGG + Intronic
937153697 2:119703287-119703309 CAGCTGTCCCAAGAGGTCCCTGG - Intergenic
937985867 2:127637839-127637861 CAGCTGCCCTCCGGGTTCCCTGG - Intergenic
938112710 2:128579707-128579729 CAGCTGGGCGATGGGGGCCCTGG - Intergenic
938554503 2:132412194-132412216 CAGCAGGCCTGGGTGATCCCAGG + Intergenic
938661714 2:133493872-133493894 CAGCTGGCCTTGGGCCTTCCAGG - Intronic
939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG + Intronic
940622898 2:156135123-156135145 AAGCTGGCCAAGTGGCTCCCAGG - Intergenic
941385294 2:164843895-164843917 CAGCTGCCCTGGAGAGTCCCAGG + Intergenic
942171788 2:173296786-173296808 CAGCAGGCTTATGGAGTCCCAGG + Intergenic
943453645 2:188075785-188075807 CAGATGTCCTTGGGGGTCCTGGG + Intergenic
943753591 2:191535554-191535576 CAACTGGGCTAAGGGGTCCAAGG + Intergenic
947634345 2:231672639-231672661 CAGCTGGGCCACGGGGACCCTGG + Intergenic
948075992 2:235165545-235165567 GTGCTGGCCTCGGGTGTCCCTGG - Intergenic
948393887 2:237630853-237630875 CAGCTGGCCTTGGCTTTCCCGGG + Intronic
948529774 2:238597047-238597069 GAGCTGGTCCAGGGGGTCCCCGG + Intergenic
948536290 2:238650185-238650207 CAGCTGGCTGAGGGGCTCCAGGG + Intergenic
948809905 2:240469148-240469170 CAGCTGGGCAAGGTGGTGCCTGG - Intergenic
1171030015 20:21668910-21668932 GAGCTGGCCAAGGGTGTCCTTGG - Intergenic
1171411435 20:24950935-24950957 CAGCTGTCCTAGCGTGTCCTGGG + Intronic
1172097458 20:32467405-32467427 GAGCCGGGCTAGGGGGTCCTTGG - Intronic
1174280109 20:49433142-49433164 CTGCTGCCCTAGGGGCTCCTGGG - Intronic
1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG + Intergenic
1175200088 20:57270803-57270825 CAGCTGGCCTGGAAGCTCCCTGG + Intergenic
1176299134 21:5090357-5090379 CAGGTGGGCTTGGGGGTCACAGG + Intergenic
1178327560 21:31658062-31658084 CACCTGAACAAGGGGGTCCCTGG - Intergenic
1178916829 21:36709482-36709504 CAGGTGGCCTGGGGAGTCCTGGG - Intronic
1179259764 21:39747434-39747456 CACATGGCCTGGGGGGTTCCAGG + Intronic
1179494339 21:41762264-41762286 CAGCTGAGGAAGGGGGTCCCGGG + Intronic
1179822591 21:43945216-43945238 GATTTGGCCTACGGGGTCCCAGG + Intronic
1179857892 21:44171591-44171613 CAGGTGGGCTTGGGGGTCACAGG - Intergenic
1180009422 21:45040032-45040054 CTGGGGGCCTGGGGGGTCCCTGG + Intergenic
1180067919 21:45421835-45421857 CAACTGGCCCTGGGGGACCCCGG - Intronic
1180073653 21:45450944-45450966 CACCTGGCCTTGGTGGACCCGGG - Intronic
1180177442 21:46097704-46097726 CAGCTGCCCTGGGGGGTGCAGGG - Intergenic
1180786952 22:18552816-18552838 CCCCTGGCCTAGGTGGCCCCTGG - Intergenic
1181234788 22:21442490-21442512 CCCCTGGCCTAGGTGGCCCCTGG + Exonic
1181243862 22:21492341-21492363 CCCCTGGCCTAGGTGGCCCCTGG - Intergenic
1182289170 22:29265597-29265619 CAGTTGGCCATGGGGGCCCCTGG + Exonic
1182428912 22:30289051-30289073 GGGCTGGACTAGGGGGTCCAAGG - Intronic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
1184475628 22:44719843-44719865 CTGCTGGCCTAGCTGCTCCCAGG + Intronic
1184550160 22:45200149-45200171 CCGCTGGCCCAGGAGGACCCAGG + Intronic
1184609546 22:45594003-45594025 CAGGTGACATAGGGGGTCCAGGG + Intronic
1184746880 22:46461428-46461450 CTGCTGGCCCAGGGGTCCCCAGG + Intronic
1184798790 22:46747768-46747790 CAGCTGGCCTAGCCCATCCCCGG - Intergenic
1185148154 22:49150320-49150342 CAGCTGGCCTGGGGTCTCCTGGG - Intergenic
1185163649 22:49244559-49244581 CCACTGGCCAAAGGGGTCCCAGG + Intergenic
1185166353 22:49264955-49264977 CACCTGGCATCTGGGGTCCCAGG + Intergenic
1185394402 22:50579338-50579360 CAGGAGGCCTGGGGAGTCCCGGG - Intronic
950534446 3:13571081-13571103 CAGCTGGCCAGGGGGGTGCCTGG - Exonic
950718839 3:14868264-14868286 CAGGTGGGGGAGGGGGTCCCTGG - Intronic
952455075 3:33465276-33465298 CAGCAGGCTTATGGGGTCCTGGG + Intergenic
953698927 3:45181166-45181188 CAGCTGGCCCAGGGCCCCCCTGG + Intergenic
953705231 3:45225858-45225880 CTGCTGGCCTCGGCGGCCCCCGG - Exonic
953885104 3:46710551-46710573 CAGCTGTGCTGGGAGGTCCCAGG + Exonic
953912472 3:46899896-46899918 CAGCAGGCCTGCGGGGTCCATGG + Intronic
954025655 3:47781525-47781547 CAGCTGGCCTCGCGGGCCTCGGG - Intronic
954053961 3:48006458-48006480 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
954136375 3:48583935-48583957 CACCTGGTCCAGGGGGACCCTGG + Exonic
954682134 3:52351513-52351535 CAGCTGACATAGGGGGTCTGTGG - Intronic
959869157 3:111306745-111306767 CTTGTGGCCAAGGGGGTCCCAGG + Intronic
961374094 3:126450916-126450938 CACCAGGCTCAGGGGGTCCCGGG + Intronic
961376210 3:126467767-126467789 CAGCTGGGAAAGGGGGTTCCAGG - Intronic
961448105 3:126990547-126990569 GGCCTGGCCTCGGGGGTCCCAGG - Intronic
961658048 3:128454024-128454046 CAGCTGGCCCCTGGGGACCCAGG - Intergenic
961831833 3:129626988-129627010 CAGCCGGCCTAGGGGGGCGGGGG + Intergenic
968467941 4:762356-762378 CTGGTGGCCCAGGGGCTCCCTGG - Intronic
968573632 4:1355012-1355034 CCACTGGCCCGGGGGGTCCCTGG - Intronic
968597130 4:1491364-1491386 CAGCTGCACTCGGGGGTCCTCGG - Intergenic
969114584 4:4863132-4863154 CACCTGACATAGAGGGTCCCAGG + Exonic
969326431 4:6447107-6447129 GACCAGGCCTTGGGGGTCCCTGG + Intronic
969718026 4:8877773-8877795 CAGCTGGCCCCGGCGGTTCCAGG - Intergenic
970089341 4:12387558-12387580 CAGTGGGCCCAGTGGGTCCCTGG - Intergenic
971968693 4:33594456-33594478 CAGCAGGCTTATGGGGTCCTGGG - Intergenic
972215894 4:36896484-36896506 CAGCAGGCTTATGGGGTCCTGGG - Intergenic
972650463 4:41012719-41012741 CAGTTCCCCTAGTGGGTCCCAGG - Intronic
973803125 4:54498151-54498173 CAGCTGGGGGAGGGGGTCCTAGG - Intergenic
974075763 4:57166872-57166894 CAGCTGGCCTTCGGTGTCACTGG + Intergenic
976780172 4:88749953-88749975 CTGCTTGCCTAGAGGGGCCCTGG + Intronic
979122920 4:116926265-116926287 CGGGTGGCCTGGCGGGTCCCGGG - Intergenic
979553446 4:122017539-122017561 CACCTTGCCTAAGTGGTCCCTGG - Intergenic
985764147 5:1768084-1768106 CAGCTGCACCCGGGGGTCCCTGG - Intergenic
985795795 5:1961486-1961508 CACCTGGCCTCGAGGGGCCCTGG + Intergenic
987578501 5:19759529-19759551 CAGTGGGCCCAGTGGGTCCCTGG - Intronic
988044377 5:25931175-25931197 CAGATGGGCTAGGGTTTCCCTGG + Intergenic
989097670 5:37796122-37796144 CAGCGGGTCCAGTGGGTCCCTGG + Intergenic
989253633 5:39343386-39343408 CACCTGGCTCAGAGGGTCCCAGG + Intronic
994360489 5:98844355-98844377 CAGTGGGCCTATGGAGTCCCAGG + Intergenic
996702703 5:126465930-126465952 CTGGTGGCCTGGTGGGTCCCCGG - Intronic
999123814 5:149231236-149231258 CAGCTGGCCCAGCGCGTACCTGG - Intronic
999728015 5:154453053-154453075 CAGATGGGCAAGGGGGTCACAGG - Intronic
1000432365 5:161166368-161166390 CAGCTGGCCCTGCCGGTCCCGGG - Intergenic
1001382056 5:171311652-171311674 CAGCCCGCCTGGGGGGTCCGGGG - Exonic
1002066202 5:176653010-176653032 CACCTGGGCTAGCGGGCCCCAGG + Intronic
1002077336 5:176716595-176716617 AAGCTGGGCAGGGGGGTCCCAGG + Intergenic
1002442935 5:179273767-179273789 TGGCTGGCCTAGGGGGTCAGGGG - Intronic
1006088716 6:31615435-31615457 CAGCTGGCCTAGGGTAGCCCGGG + Intronic
1006119344 6:31794954-31794976 CAGCAGGCCTGGGGGGCCCAGGG - Exonic
1007282086 6:40720321-40720343 CAGCTGGGCTGGGGAGTGCCTGG + Intergenic
1008887868 6:56450723-56450745 CTGCTGGCCTAGGAGCTCCCAGG - Intergenic
1010180565 6:73082130-73082152 CAGCTGGCCTCAGGAATCCCTGG - Intronic
1012211374 6:96522150-96522172 CAGCTGGGCTGGGGGGCTCCAGG - Intronic
1013170599 6:107634250-107634272 CAGCAGGCCTGGGGGGTTCCCGG - Exonic
1013980462 6:116121702-116121724 CAGCTGGCCTACCAGGACCCCGG - Exonic
1015920671 6:138263414-138263436 CCGGTGGCCTAGGCAGTCCCGGG - Exonic
1016891765 6:149014519-149014541 CATCTGGCAGATGGGGTCCCTGG - Intronic
1018714758 6:166523419-166523441 CAGCTGGCCCAGGGAGGCCTGGG + Intronic
1019297901 7:288835-288857 CAGCTGGCCCCAGGGGTGCCTGG - Intergenic
1019433995 7:1012413-1012435 CAGCTGGGCCTGCGGGTCCCCGG - Intronic
1020001927 7:4761138-4761160 CAGATGGCCCCCGGGGTCCCCGG + Exonic
1023869026 7:44252725-44252747 CAGGTGGACTCGAGGGTCCCTGG - Intronic
1024220829 7:47285138-47285160 CAGATGGGCTAGGATGTCCCTGG + Intronic
1025255260 7:57380488-57380510 CAGCTGGCCTCGGGGGACAGCGG - Intergenic
1026457745 7:70587470-70587492 CACCTGGCCTAGATGGTCCTTGG + Intronic
1026906523 7:74065959-74065981 GAGGTGTCCTAGGGGGTGCCGGG + Exonic
1027348728 7:77288588-77288610 CACCTGGCCTCTGGGTTCCCTGG + Intronic
1032018536 7:128394172-128394194 CAGGTGGTCCATGGGGTCCCTGG + Intronic
1032267750 7:130380699-130380721 CAGCTGTCCCAGGTGGTGCCAGG - Intronic
1033304259 7:140212855-140212877 CACCTGGGCTAGGGTGTCCAAGG + Intergenic
1033597380 7:142867212-142867234 CAGCTGACCTAGGGGCTACTCGG + Intronic
1034493610 7:151407491-151407513 CAGCTGGCCCCGGGAGCCCCTGG - Intronic
1034497629 7:151431936-151431958 TCCCTGGCCCAGGGGGTCCCTGG + Intronic
1034538456 7:151740436-151740458 CACCAGTCCTAGGGGGTTCCTGG + Intronic
1034991052 7:155548446-155548468 CTGCTGTCCTCAGGGGTCCCAGG - Intergenic
1035104682 7:156432292-156432314 CAGCTGGGCGAGGTGATCCCAGG - Intergenic
1035345281 7:158193248-158193270 CAGCTGTCCCATGGGGCCCCTGG - Intronic
1035812951 8:2507667-2507689 CCCCTGCCCTAGGGGGACCCGGG - Intergenic
1036153948 8:6324787-6324809 TAGCTGGTCTAGCGGGTCCCAGG - Intergenic
1037752719 8:21693052-21693074 GAGCTGGCCCAGGGGTCCCCTGG - Exonic
1037829471 8:22179270-22179292 GAGCTGGCCTGGGGAGTCCTGGG + Intronic
1039649633 8:39327936-39327958 CAGCAGGACTAATGGGTCCCGGG - Intergenic
1039896596 8:41720833-41720855 CAGCTACCCTAGGGGAACCCAGG + Intronic
1040526265 8:48227815-48227837 CGGCTGGCTTATGGGGTCCTTGG - Intergenic
1042729625 8:71917696-71917718 TGGCTGGCCTAGGGATTCCCAGG - Intronic
1045678956 8:104638738-104638760 CTTCTGTCCTAGAGGGTCCCTGG - Intronic
1046578975 8:116068193-116068215 CAGCAGGCATATGGGGTCCAGGG - Intergenic
1049782143 8:144433994-144434016 CAGCTTGCCATGGGGCTCCCAGG - Exonic
1049787320 8:144457223-144457245 CATCTGCCCTAGGAGGGCCCAGG - Intronic
1051219462 9:14832930-14832952 CAGCAGGCCTATGGGGTCCTGGG - Intronic
1051225407 9:14893364-14893386 CAGCAGGCTTATGGGGTCCTAGG - Intronic
1051966298 9:22833377-22833399 CAGTGGGTCTAGTGGGTCCCTGG + Intergenic
1056767657 9:89454836-89454858 CAGCTGACCCAGTGGGGCCCTGG + Intronic
1060256008 9:122031626-122031648 GAGCTGGGACAGGGGGTCCCAGG - Intronic
1061037226 9:128120587-128120609 CCGCTGGCCTGGGGCTTCCCAGG - Intergenic
1061044035 9:128154665-128154687 CAGCAGGCCCAGGGGGTGACAGG - Intergenic
1061406050 9:130393627-130393649 CACCTGGCCTTGGGGGACCAGGG + Intronic
1061864298 9:133484676-133484698 GAGCTGGTCTGGGGGGACCCTGG + Intergenic
1061876607 9:133547223-133547245 CCGCAGGCCTTGGGGGCCCCAGG + Intronic
1061908537 9:133711076-133711098 CAGCTGACCGAGGGAGGCCCAGG + Intronic
1062115535 9:134806257-134806279 CTGCCGGCCCTGGGGGTCCCTGG - Exonic
1062546354 9:137065292-137065314 CAGAGAGCCTAGAGGGTCCCAGG + Intronic
1062591802 9:137277780-137277802 AAGCTGGCCCAGGAGGCCCCTGG + Exonic
1192777040 X:74255976-74255998 CAGCAGGCTTATGGGGTCCTGGG - Intergenic
1194403619 X:93467827-93467849 CAGCTGGCCCAGGGGTTCTCAGG - Intergenic
1195258048 X:103107611-103107633 CAGCTGGCCTTGCCGGCCCCAGG - Intergenic
1195702575 X:107716283-107716305 CAGCCGGCCTACAAGGTCCCAGG + Intronic
1196463612 X:115952254-115952276 CAGCAGGCCTAGGAAGGCCCCGG + Intergenic
1196660124 X:118260549-118260571 CAGCTGACCTTGGTGGTGCCAGG - Intergenic
1199772480 X:150983695-150983717 CATCTGGCCTCGGGGGCCCTGGG - Intronic
1200292009 X:154884430-154884452 CAGATGGACTAGGGGTTGCCAGG + Intronic
1200338847 X:155380167-155380189 CAGATGGACTAGGGGTTGCCAGG + Intergenic
1200347622 X:155460525-155460547 CAGATGGACTAGGGGTTGCCAGG - Intergenic