ID: 1165708540

View in Genome Browser
Species Human (GRCh38)
Location 19:37993213-37993235
Sequence GATGACACCCACTTCACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165708530_1165708540 11 Left 1165708530 19:37993179-37993201 CCCTGCCCCTCAGTTTCTTCATC 0: 1
1: 2
2: 118
3: 615
4: 2097
Right 1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1165708528_1165708540 13 Left 1165708528 19:37993177-37993199 CCCCCTGCCCCTCAGTTTCTTCA 0: 1
1: 0
2: 17
3: 223
4: 1188
Right 1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1165708534_1165708540 4 Left 1165708534 19:37993186-37993208 CCTCAGTTTCTTCATCTGTGAGA 0: 6
1: 103
2: 1005
3: 4216
4: 11178
Right 1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1165708533_1165708540 5 Left 1165708533 19:37993185-37993207 CCCTCAGTTTCTTCATCTGTGAG 0: 1
1: 6
2: 74
3: 318
4: 1086
Right 1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1165708532_1165708540 6 Left 1165708532 19:37993184-37993206 CCCCTCAGTTTCTTCATCTGTGA 0: 2
1: 8
2: 52
3: 174
4: 623
Right 1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1165708529_1165708540 12 Left 1165708529 19:37993178-37993200 CCCCTGCCCCTCAGTTTCTTCAT 0: 1
1: 4
2: 82
3: 505
4: 1861
Right 1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1165708531_1165708540 10 Left 1165708531 19:37993180-37993202 CCTGCCCCTCAGTTTCTTCATCT 0: 1
1: 2
2: 119
3: 772
4: 2604
Right 1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165708540 Original CRISPR GATGACACCCACTTCACATG GGG Intronic
903745533 1:25584296-25584318 GAAGACACCCACCACACAAGGGG - Intergenic
904465037 1:30702544-30702566 CCTGACACCCCCTTCACTTGGGG + Intergenic
904956264 1:34286548-34286570 GATGAGACCAAATTCACATTGGG + Intergenic
905043562 1:34978904-34978926 GATGACACTCCCTTCCCTTGGGG - Intergenic
909764072 1:79332667-79332689 AATTACAGCCACTTCAAATGTGG + Intergenic
910721481 1:90291341-90291363 GATGAAAACAACTTCAAATGTGG - Intergenic
912330810 1:108818589-108818611 TATGATTCCCACTTTACATGCGG + Intronic
912937219 1:114014240-114014262 GATCACACTCCCTTCTCATGTGG + Intergenic
923509014 1:234633306-234633328 CATGGCTCCTACTTCACATGTGG - Intergenic
924485930 1:244484398-244484420 GATAACACCCACTTCTGGTGAGG + Intronic
924780669 1:247144556-247144578 GCTGACACCCACCTCAAAAGTGG - Intronic
1063166568 10:3468782-3468804 TATGACACGCACTTCACATTTGG + Intergenic
1066790912 10:39062333-39062355 GATGACCCACACATCACAAGTGG + Intergenic
1067280040 10:44864381-44864403 AATCACACCCACTCCACATTAGG - Intergenic
1069534136 10:69240725-69240747 GATGACACCAACTTCGCAGTAGG - Exonic
1069637007 10:69931026-69931048 GATGGCACCCATTTCACAGATGG - Intronic
1069782932 10:70968192-70968214 GATGAGACCCACAACTCATGGGG - Intergenic
1070680643 10:78446544-78446566 GAAGAGACCCATTTCATATGTGG + Intergenic
1074153426 10:110778707-110778729 GATGACACCCACTTTTCAGAGGG + Intronic
1075976897 10:126703927-126703949 GATGAGTCCCACTTCACAGCTGG + Intergenic
1076156030 10:128206614-128206636 GATGAGCCCCACTTGACTTGTGG - Intergenic
1076776569 10:132701256-132701278 AATGACACCCACATCCCGTGGGG - Intronic
1077199561 11:1298797-1298819 GATGACACACGCCTCACATCTGG + Intronic
1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG + Intergenic
1083417343 11:62534242-62534264 GCTGACAGCCACATCACAGGAGG + Intronic
1085040377 11:73323297-73323319 GAGGACTCCCACTTCACAGATGG - Intronic
1086834880 11:91608531-91608553 GATGACCCCCACTTTACAGGAGG + Intergenic
1087659904 11:100975062-100975084 GATGCCACCCACATCACCTTAGG - Intronic
1087686342 11:101269899-101269921 AATGACAACCACTTCACACAAGG - Intergenic
1088693710 11:112348859-112348881 GATGACACCTGCTTCCCACGCGG + Intergenic
1095734949 12:45546736-45546758 CATGGGACCCACTTCACAGGAGG - Intergenic
1095952423 12:47789095-47789117 GATAACACCCACATCACAGTTGG - Intronic
1096093974 12:48922393-48922415 GTTGACCCCAACTACACATGTGG + Intronic
1096522615 12:52192739-52192761 GAAAACACCCACCTCACAGGAGG + Intergenic
1097236531 12:57543948-57543970 GATGACACCCATTCCAGGTGTGG - Intronic
1097471099 12:59992838-59992860 GATAATAGCCACTTCAGATGGGG - Intergenic
1097679207 12:62633076-62633098 AATGATACCCACTTCTCCTGAGG - Intergenic
1110586189 13:77196277-77196299 GATGACAGCCAGTTCTGATGGGG + Intronic
1112691525 13:101901382-101901404 TATGACTCCCTCTTCACTTGGGG - Intronic
1122881202 14:104691177-104691199 AATGACACACACCGCACATGTGG + Intronic
1124145826 15:27124348-27124370 GATTACACTCACTTCACAGGTGG + Intronic
1128448496 15:67785978-67786000 AATGATACCAACTTCACAGGGGG + Intronic
1131150903 15:90046707-90046729 GCTAACACCCACTTCCCAGGAGG + Intronic
1137726474 16:50660011-50660033 GATGTCACCAAGTTCAAATGAGG + Intergenic
1141577049 16:84970786-84970808 CCTGGCACCCACTTCCCATGTGG + Intergenic
1146462141 17:33054784-33054806 GATCACACCCATTTCTCATCAGG - Intronic
1149037855 17:52156246-52156268 GATGCCACCCACTTCATATCTGG + Intronic
1150275312 17:63894263-63894285 GATGACACTCACTTCCCTTCGGG - Intergenic
1151111844 17:71687841-71687863 GCTGCCACCCCCTTCCCATGGGG + Intergenic
1158673863 18:59500979-59501001 GATTACACCCAGTTTACAGGTGG + Intronic
1160435286 18:78847419-78847441 GATGCCCCTGACTTCACATGGGG - Intergenic
1163643777 19:18476706-18476728 GATGACGGCCACCTCTCATGGGG - Intronic
1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG + Intronic
926290155 2:11522578-11522600 GAGGACAGCCACTGAACATGTGG + Intergenic
928406769 2:31020927-31020949 AATGAAACCCACATCCCATGTGG + Intronic
930648375 2:53937190-53937212 GATGACACCCAAATAAGATGAGG - Intronic
938927367 2:136056416-136056438 TACAACACACACTTCACATGTGG - Intergenic
941320174 2:164044916-164044938 GATGACACCTTCTTCTTATGAGG + Intergenic
943213209 2:184995733-184995755 GATGATTCCCACTACACATAAGG - Intergenic
946626477 2:221617166-221617188 GATGACAACAGCTTCAAATGTGG + Intergenic
948994994 2:241573548-241573570 TATGACACCCACTTGTGATGGGG + Exonic
1170413345 20:16113901-16113923 GATGACAGGCAAGTCACATGAGG + Intergenic
1170585985 20:17734576-17734598 GCTGAGAACCACTGCACATGGGG - Intronic
1171814731 20:29775593-29775615 GGTAACACCCACTTCAGATTCGG - Intergenic
1173710893 20:45154781-45154803 GATCACTTCCACTACACATGGGG - Intergenic
1175533089 20:59687837-59687859 GATGAAAATCACATCACATGGGG + Intronic
1176291266 21:5046128-5046150 GCTGGCAGCCACTGCACATGTGG - Intergenic
1176349107 21:5776156-5776178 CAAGACACCCATCTCACATGCGG + Intergenic
1176355921 21:5896740-5896762 CAAGACACCCATCTCACATGCGG + Intergenic
1176543428 21:8174226-8174248 CAAGACACCCATCTCACATGCGG + Intergenic
1176562379 21:8357271-8357293 CAAGACACCCATCTCACATGCGG + Intergenic
1179865989 21:44217513-44217535 GCTGGCAGCCACTGCACATGTGG + Intergenic
1203248295 22_KI270733v1_random:90445-90467 CAAGACACCCATCTCACATGCGG + Intergenic
954639762 3:52090901-52090923 GAGGTCAGCCTCTTCACATGGGG - Intronic
958106661 3:89082773-89082795 AATGTCACACATTTCACATGAGG + Intergenic
962869067 3:139472532-139472554 GAAGAAACCCAGGTCACATGGGG + Intronic
964747303 3:160024420-160024442 GAAGATGCCCACTTCATATGCGG + Intronic
965879400 3:173370496-173370518 GAGGACACCAATATCACATGAGG - Intergenic
968714170 4:2142037-2142059 CAAGAGACCCACTTCACAGGAGG - Intronic
970043548 4:11823657-11823679 GATGGCTCCACCTTCACATGTGG + Intergenic
975669110 4:76762478-76762500 GATGATACCCACTTGCCCTGTGG + Intronic
976645504 4:87383411-87383433 GATGACACAAACTTGAAATGTGG + Intronic
976747226 4:88415455-88415477 AATGACAACCACTTCAAATTGGG - Intronic
981587027 4:146314643-146314665 GATGACACCATCTTCATATATGG - Intronic
982392077 4:154875810-154875832 CTCGACACCCACTTCAGATGTGG + Intergenic
982966062 4:161909758-161909780 GATGAGACCCAATACACAAGTGG - Intronic
983368527 4:166827773-166827795 CCTGACACCCACTTCAAATCTGG + Intronic
984777267 4:183492737-183492759 GAGAACACCCACTCCACACGGGG + Intergenic
986808352 5:11330057-11330079 AATGATACACACATCACATGTGG + Intronic
988591244 5:32551601-32551623 GATGACTACCATTTCAAATGTGG - Intronic
994828097 5:104742635-104742657 GATGACATCCATTTTACCTGTGG - Intergenic
998556298 5:143127570-143127592 GATGACCCCCACTTAACACCTGG + Intronic
999720619 5:154396626-154396648 GATCACACCCTTTACACATGAGG - Intronic
999793427 5:154965149-154965171 GCTGAAACCCACTTCACTAGAGG + Intronic
1000472434 5:161661653-161661675 TATGACACCAAAATCACATGGGG + Intronic
1001698980 5:173692981-173693003 GATGACACTAACATTACATGTGG - Intergenic
1001989267 5:176102723-176102745 GATGACCCCTACTTAGCATGTGG - Intronic
1001989943 5:176108043-176108065 GATGACCCCTACTTAGCATGTGG - Intronic
1002226928 5:177730095-177730117 GATGACCCCTACTTAGCATGTGG + Intronic
1002227603 5:177735415-177735437 GATGACCCCTACTTAGCATGTGG + Intronic
1002695930 5:181088609-181088631 GATGACCCACAGTTCCCATGGGG + Intergenic
1002876957 6:1219194-1219216 GAAGACCTCCCCTTCACATGAGG - Intergenic
1016323920 6:142878551-142878573 GTTGCCACTGACTTCACATGGGG - Intronic
1016721407 6:147303219-147303241 AATCCCTCCCACTTCACATGGGG - Intronic
1017819856 6:158041464-158041486 GATGTCACCTACTTCCCCTGTGG + Intronic
1018219404 6:161563175-161563197 GATGTCACCTACTTTAGATGAGG - Intronic
1020216934 7:6199887-6199909 GATGTTAACCATTTCACATGTGG - Intronic
1020469026 7:8514569-8514591 CATGACACACACAGCACATGGGG - Intronic
1026276251 7:68879549-68879571 TATAACTCCCACTTTACATGTGG - Intergenic
1028794186 7:94885648-94885670 CAGGCCACCCACTGCACATGTGG - Intergenic
1029736914 7:102470101-102470123 GATGACCTCCCCTTCACCTGGGG + Intronic
1034130459 7:148711360-148711382 GATGTCACCCACCGCACCTGTGG - Intronic
1034948405 7:155279637-155279659 GAGGAAACCCACAGCACATGGGG - Intergenic
1035130025 7:156642796-156642818 GAGGAAACCCACAGCACATGGGG + Intronic
1035663944 8:1366453-1366475 GCTGCCCCCCACTTCAGATGGGG - Intergenic
1037848630 8:22307322-22307344 GATTACACCTACTTAAAATGTGG - Intronic
1038025414 8:23584229-23584251 GATGACACCCAGTGCTGATGAGG - Intergenic
1041469294 8:58191027-58191049 GAGGCCAACCACTTGACATGTGG - Intronic
1041581089 8:59460710-59460732 CAGGAAACCCATTTCACATGCGG - Intergenic
1048398338 8:134036969-134036991 GATAACACTCACATCACATGGGG - Intergenic
1048443185 8:134475151-134475173 GATGACACCCACCTCGCACGTGG - Intergenic
1049023249 8:139971658-139971680 GATGACATGCACTTAACATGAGG + Intronic
1049057526 8:140250535-140250557 GTTCACAGCCACTTCACATAAGG + Intronic
1049198102 8:141326389-141326411 CATCACACCCATTTCACAGGTGG + Intergenic
1049410338 8:142471186-142471208 GACAACACCCATTTCAGATGGGG + Intronic
1050100939 9:2119116-2119138 TATGACATCTATTTCACATGGGG - Intronic
1051710643 9:19927391-19927413 AATGGCACCTACTTCACTTGCGG + Intergenic
1053351597 9:37417050-37417072 GATGACACCCACTGCCCCAGAGG + Intergenic
1054712428 9:68524676-68524698 GATGAGTCCCACATCAGATGAGG - Intronic
1058872906 9:109217939-109217961 GATGACACGGCCTTCAAATGGGG - Intronic
1059764124 9:117367264-117367286 AAGGCCACCCACTTCACAGGTGG + Intronic
1061478939 9:130886915-130886937 GATGACCCCCACAGAACATGAGG - Intronic
1061856806 9:133445976-133445998 GCTGACAGCCACTTCAAATGTGG + Intronic
1203464698 Un_GL000220v1:73696-73718 CAAGACACCCATCTCACATGCGG + Intergenic
1189375720 X:40465013-40465035 GATGGCACACAGGTCACATGGGG + Intergenic
1192675084 X:73187076-73187098 CAGGAGACCCATTTCACATGCGG + Intergenic
1196332585 X:114490185-114490207 GATAACAACCACTTCCCATCAGG + Intergenic
1199927924 X:152488664-152488686 GTTGACACACAGTTCACAAGTGG - Intergenic
1202029144 Y:20553488-20553510 GGTAACACCCACTTTAAATGAGG + Intergenic