ID: 1165708548

View in Genome Browser
Species Human (GRCh38)
Location 19:37993268-37993290
Sequence CTGTGCCAAGAGCTGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165708548_1165708550 0 Left 1165708548 19:37993268-37993290 CCTTGAACCAGCTCTTGGCACAG 0: 1
1: 0
2: 1
3: 22
4: 204
Right 1165708550 19:37993291-37993313 AGAAAGTTCTCATTGTGCGTTGG 0: 1
1: 0
2: 1
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165708548 Original CRISPR CTGTGCCAAGAGCTGGTTCA AGG (reversed) Intronic
900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG + Intronic
902923205 1:19679426-19679448 CTTAGCCAAGAGCTGGCCCAAGG - Exonic
903069775 1:20721450-20721472 CTGGGGCAGGAGCTTGTTCACGG - Intronic
903375244 1:22861704-22861726 CTGAGGCCAGAGCTGGTTGAGGG + Intronic
904460479 1:30675657-30675679 CAATGCCAAAAGCTGGTTCTTGG + Intergenic
905142947 1:35863177-35863199 CAGTGCCAAAACCTGGTTAATGG - Intergenic
906868297 1:49447369-49447391 CTGTACCCAGAGCTGATGCAGGG - Intronic
907417805 1:54326551-54326573 CAGTGCCAGGAGCTGCGTCAAGG - Intronic
907456838 1:54581612-54581634 CTGTGCCAAGTGCTGGCCCCAGG - Intronic
907583289 1:55591516-55591538 CTCTGCCAACAGCTTGATCATGG - Intergenic
908985045 1:70007283-70007305 CTGTGCCAAGAACTGGATGAAGG + Intronic
910552043 1:88486320-88486342 CTGTGTCAAGACCTGGTACCAGG - Intergenic
912435710 1:109659668-109659690 CTGTGGCCAGAGCTGGATTAGGG + Intronic
912681900 1:111734129-111734151 CTGTGCCAAGAGCTGTAGGAGGG + Intronic
912971518 1:114288283-114288305 CTGTCCCTGGGGCTGGTTCAAGG - Intergenic
913506334 1:119519233-119519255 CAGAGCCAAGAGCTGGGTCAAGG + Intergenic
918243889 1:182642573-182642595 CTGTGCTGAGAGCTGGGTGAGGG - Intergenic
919530706 1:198715770-198715792 ATGTGCCAAGCACTGTTTCAAGG - Intronic
920038659 1:203082126-203082148 CTGAGCCCGGAGCTGGTGCAGGG + Intergenic
920378410 1:205521899-205521921 CTGTGCCTGGTGCTGGTGCATGG + Intronic
921010940 1:211140315-211140337 CTGTGAATAGATCTGGTTCAGGG + Intergenic
922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG + Exonic
1062906766 10:1184783-1184805 CTCTCCCAAGAGCTTGCTCAGGG + Intronic
1063732401 10:8712876-8712898 GTGTGACAAGGGCTGGTTGATGG + Intergenic
1064281803 10:13957997-13958019 CTGTGCCGAGAGCAGGATCTAGG - Intronic
1064462239 10:15546335-15546357 GTGTGCCAAGGGCTGCTTCAGGG - Intronic
1066034515 10:31468048-31468070 GTGCCACAAGAGCTGGTTCAGGG - Intronic
1067142003 10:43666168-43666190 CAGAGCCCAGAGGTGGTTCAGGG + Intergenic
1067547167 10:47201033-47201055 CTGTGAGAAGAACTGGTTTAGGG + Intergenic
1069891083 10:71652862-71652884 CTGGGCCAGGGGCTGGTTCAGGG + Intronic
1071437349 10:85659782-85659804 CTGTGCCATGTGCTGTTACATGG + Intronic
1072728434 10:97828967-97828989 CTGTGCCCAGGGCAGGTTCTAGG - Intergenic
1073230058 10:101961587-101961609 CTGTGTCAGGAGCAGTTTCAAGG + Intronic
1075081431 10:119386521-119386543 CTGTACCAAGAGCTGTTTTTTGG + Intronic
1075086192 10:119415871-119415893 CTGTGCCATGAGTGGGTTGAAGG + Intronic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076879130 10:133231321-133231343 CTGCTCCACGTGCTGGTTCAAGG - Exonic
1077013972 11:391946-391968 CTGTGTCAGGAGCTGGCTCCAGG + Intergenic
1077897745 11:6466195-6466217 TTGTGCTAAGAGGTGGGTCAGGG - Intronic
1077914105 11:6600045-6600067 GTGAGCCAAGACCTGGTTCCTGG - Exonic
1078660596 11:13282541-13282563 CTGGGCCAAGGGCTGGTACAGGG - Intronic
1081091328 11:38869429-38869451 ATGTGCCAAGGGCTGTGTCAAGG - Intergenic
1081644072 11:44777855-44777877 GTATGCCAAGCCCTGGTTCAGGG + Intronic
1083000874 11:59289473-59289495 CTGAGCCAAGAACAGCTTCAGGG - Intergenic
1083410518 11:62489346-62489368 CTGAGCCAAGAGCTGAGCCATGG + Intronic
1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG + Intronic
1083487625 11:62993447-62993469 CTCTGGCAAGGGCTGATTCAGGG + Exonic
1087672411 11:101123363-101123385 CTGCGTGATGAGCTGGTTCAAGG - Intronic
1088090179 11:106029057-106029079 CTGTGCCAAGCACTGATTTATGG + Intergenic
1089295003 11:117462060-117462082 CTGGGCCAAGGCCTGGTTCTAGG + Intronic
1089692587 11:120196109-120196131 CTGTGCAAAGAGCTGGTCGGGGG - Intergenic
1089951009 11:122526204-122526226 CTGAGGCATGAGCTGGTTCAGGG - Intergenic
1091623919 12:2108370-2108392 CTGTGCCAAGGGCTGGCTCTGGG + Intronic
1093749535 12:22782274-22782296 GTGTGCCATGAGCAGGTTCATGG - Intergenic
1098701430 12:73632760-73632782 CTCTGCCAGCAGCTGGGTCAAGG - Intergenic
1100888073 12:99094601-99094623 CTGTGAGAAGAGCTGTTACAAGG + Intronic
1100969103 12:100047587-100047609 CAGTTACAGGAGCTGGTTCAAGG + Exonic
1102733430 12:115135716-115135738 CTGTGCCAAGGGCTTTTTTAAGG - Intergenic
1102748245 12:115268974-115268996 TTGTGCCAAGTTCTGGTTCCAGG - Intergenic
1104223802 12:126811791-126811813 ATGTGCCAGGATCTGGCTCAGGG - Intergenic
1104643005 12:130479402-130479424 GTGTGCCCAGCACTGGTTCAGGG + Intronic
1106684648 13:32045330-32045352 CTCTGCCAAGGCCTGGTTCCAGG + Intronic
1109478870 13:62920591-62920613 CTGAGCAGAGAGCTGGCTCAGGG - Intergenic
1111664488 13:91249847-91249869 CTGTGCCAGGGGCTGGTGCTGGG - Intergenic
1113071577 13:106426607-106426629 CTGTGCCAGGGGCTTGTTGAGGG - Intergenic
1116692376 14:48125832-48125854 CTGTGTGGACAGCTGGTTCAGGG + Intergenic
1117863766 14:60122751-60122773 CTGTGCCAGGCACTGTTTCAGGG - Intronic
1121695873 14:95911418-95911440 CTGGGCCATGAGCTCGTTGAGGG + Intergenic
1125993872 15:44137206-44137228 CTGTGCCAAGTGCTGGCTACAGG + Intronic
1127070266 15:55282024-55282046 CTGTGCCAGCTGCTGGTTAAAGG - Intronic
1128385999 15:67148927-67148949 CTGTGCCAGGAGCTCCTTGAGGG - Intronic
1131506056 15:93020293-93020315 CTTTGCCAGGAGCTGTTTCTAGG + Intronic
1134075336 16:11286958-11286980 CTGTTCCAAGATCCAGTTCAGGG + Intronic
1135423760 16:22322264-22322286 CTGTGGCTGGAGCTGGGTCAGGG + Intronic
1135770259 16:25212812-25212834 ATGTGGCAAGAGATGATTCAGGG + Intergenic
1137802426 16:51273497-51273519 CTGAGACAAGAGCTGGTGCAGGG - Intergenic
1140041649 16:71412294-71412316 CTGTGCCAGGTGCAGGGTCAAGG - Intergenic
1140995438 16:80254360-80254382 CGCTGCTAAGAGCTGGTTCCTGG + Intergenic
1142854139 17:2720702-2720724 ATGAGCCAGGAGGTGGTTCAGGG - Intergenic
1143375342 17:6463847-6463869 CTGTGCCATGAGCTACCTCACGG - Exonic
1143849833 17:9802580-9802602 CTCGGCCATGAGCAGGTTCACGG - Exonic
1144730569 17:17523564-17523586 CAGTGCCAACAGCTGGTTGAGGG - Intronic
1148867898 17:50638631-50638653 CTCTACCAAGAGCTGCTTCTAGG - Intronic
1149664763 17:58357897-58357919 CTGGGCCAGGGGCTGGCTCAGGG + Exonic
1151556010 17:74847133-74847155 CTGGGGCAAGAGATGGCTCAGGG - Intronic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152571551 17:81123358-81123380 CTGTGCCCAGCCCTGGCTCACGG - Intronic
1153710621 18:7795086-7795108 ATGTACTAAGAGCTGATTCACGG + Intronic
1153715932 18:7847956-7847978 CTGTGTAGAGAGCTGTTTCAGGG + Intronic
1154367394 18:13723931-13723953 CTGTGAAGAGAGGTGGTTCATGG - Intronic
1156405361 18:36778040-36778062 CTGTTCCAAGTGCTGATTCCTGG + Intronic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1157480994 18:48053804-48053826 GAGTGCTAAGTGCTGGTTCATGG + Intronic
1157817696 18:50742045-50742067 CGGTGCCAACAGCTGCTTCTGGG + Intergenic
1163311064 19:16514836-16514858 CTGTGGCAAAAGCTGGTACAGGG + Intronic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1166105640 19:40596932-40596954 CTGTTCCACGAGAAGGTTCACGG + Intronic
1166424882 19:42668902-42668924 CCATGCCGAGAGCTGGTTCTTGG + Intronic
1167490439 19:49789928-49789950 CTGTGCTAGGAGCTGGGTTATGG + Intronic
1168145895 19:54420149-54420171 CTGTGCTCAGAGCTCGTTCTTGG - Intronic
1168459455 19:56541178-56541200 CTGTGGGAGGAGCTGGTTTATGG - Intronic
925922045 2:8644902-8644924 CTCCTCCAAGAGCTGGTTCTTGG - Intergenic
925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG + Intronic
927247098 2:20965849-20965871 CAGTGCCCAGAGCTGGTGCTGGG + Intergenic
930866064 2:56123219-56123241 CTTGGCCAAGAGCTGGGGCAAGG - Intergenic
932240197 2:70150386-70150408 CAGTTCCAAGGGCTGGTCCAAGG + Exonic
934893734 2:98093244-98093266 CTGTGACAAAATCTGTTTCAAGG - Exonic
936568647 2:113598239-113598261 CAGTGCCCAGTGCTGGGTCAGGG + Intergenic
942445212 2:176072978-176073000 CTTTGGCAGGAGCTGATTCAGGG - Intergenic
943679657 2:190755084-190755106 CTGTGCCAAAATCTGCTCCAAGG - Intergenic
945769261 2:214019983-214020005 CTGTCTCAAGAGCTGATTGATGG + Intronic
948721959 2:239906078-239906100 CTGTGGCCAGGGCTGCTTCAAGG - Intronic
1169926815 20:10792606-10792628 CTGAGCTGAGAGCTGGTTCATGG - Intergenic
1169965009 20:11207590-11207612 CTTTGTCAAGAGCTGATTTAAGG + Intergenic
1170498526 20:16950686-16950708 CTGTGCCACCAGCTGATGCAGGG - Intergenic
1173089382 20:39955717-39955739 CAGAGCCAAGGGCTGATTCAGGG - Intergenic
1174542882 20:51303769-51303791 CTGTTCCAAAAGCTGGCACAGGG + Intergenic
1175263137 20:57687270-57687292 CTGTGCCTGGGGCTGGTCCAAGG + Intronic
1176331148 21:5549381-5549403 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG + Intergenic
1176440548 21:6717534-6717556 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176464810 21:7044603-7044625 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176488371 21:7426382-7426404 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1177842255 21:26247870-26247892 CAGTGCCAATACCTGGTTTAGGG + Intergenic
1179034185 21:37745742-37745764 CTGTGCTAAGAGCTGGGTACAGG + Intronic
1179399368 21:41069970-41069992 CGGTGCCCAGGGCTGGTTCCTGG + Intergenic
1179909531 21:44440691-44440713 CTGTGCTCAGAGCTGGGTCAGGG + Intronic
1180053385 21:45344178-45344200 CTGAGCCAAGACTGGGTTCACGG - Intergenic
1180635360 22:17259107-17259129 GTGTGCCAGGAGCTGGGTGATGG + Intergenic
1181730868 22:24845431-24845453 TTGTGAGCAGAGCTGGTTCAAGG - Intronic
1181922703 22:26333186-26333208 ATGTGCCCAGAGCAGGGTCAAGG + Intronic
1182886477 22:33777999-33778021 CTTTGCCCAGAATTGGTTCAGGG + Intronic
1184652832 22:45926940-45926962 CTGTGCCAAGACGTGGGACATGG + Intronic
1184710770 22:46248113-46248135 CTGTGCCCAGTGCTGGTTGGTGG - Intronic
1184958479 22:47909563-47909585 CTTTGACAAGAGCTGTTTTAAGG - Intergenic
949411617 3:3771706-3771728 CTGAGCCAAAAACTGATTCAAGG + Intronic
949493976 3:4614428-4614450 CTGTGCCAGGATCTGTTTGAAGG + Intronic
949938709 3:9136856-9136878 CAGTGCCAAAAGCTGGATCTGGG + Intronic
950002434 3:9667602-9667624 CTGGGGCAAGAGCTGGTTTGTGG - Intronic
950713673 3:14832288-14832310 CTGTGACAACACCTGGTGCAGGG - Intronic
950748365 3:15108580-15108602 CTGTGGGAAGAGCAGGTTTAGGG - Intergenic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953334947 3:42086834-42086856 CTTTGCTTAGAGCTGCTTCAAGG + Intronic
953793909 3:45968287-45968309 CTGTGCCAAGGGCTGCAGCATGG + Exonic
954241445 3:49296915-49296937 CTGTGCCAAGGGCTAGAACATGG - Intronic
954439374 3:50513312-50513334 CTGTGCCAAGAACAGGCTTAGGG - Intergenic
955794143 3:62618034-62618056 CTGGGCCATGGACTGGTTCATGG + Intronic
956722263 3:72128523-72128545 CTGTCCCAAGATCTGCTTTAGGG + Intergenic
962629784 3:137264174-137264196 CTGTGCTAAGAGCTCACTCAGGG - Intergenic
963888820 3:150610892-150610914 CTGTGACAAAAGCAGGTTAATGG + Intronic
967196211 3:187028036-187028058 CTCTGACAAGATCAGGTTCATGG + Intronic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG + Intronic
970276411 4:14405750-14405772 CTGTGGAAAGAGCTGGCACATGG + Intergenic
975721394 4:77251918-77251940 CTGTGCCAAGTGCTTCTACATGG - Intronic
975724621 4:77279902-77279924 CTGTGCCAAGTGCTTCTACATGG - Intronic
976999109 4:91473316-91473338 CTGTGCAAAGAGCTGCTTCATGG - Intronic
981529320 4:145736434-145736456 CTGTGACCTGAGCTGGGTCAAGG + Intronic
982277966 4:153656214-153656236 CTGTGCCAGGAACTGGTACAGGG - Intergenic
983269277 4:165542461-165542483 CTTTGCCTAGAGCTGTTTCTTGG - Intergenic
984856659 4:184201285-184201307 CTGTGCCAAAAGTGGGTTAAAGG - Intronic
984983610 4:185306069-185306091 CTCTGGCATGAGCTGGGTCACGG + Intronic
986141350 5:5033506-5033528 CAGGGACAGGAGCTGGTTCATGG - Intergenic
986257342 5:6111158-6111180 GTGTGCCAAGATCTGGGTGAAGG + Intergenic
988425760 5:31061918-31061940 CTGTGACAGGAGCTTATTCAAGG - Intergenic
992611482 5:78511887-78511909 CTGTGCCAAGCACTGGGTAAGGG + Intronic
997439244 5:133897631-133897653 GTCTGCCAGCAGCTGGTTCACGG + Intergenic
1001791179 5:174459179-174459201 CATTGCCCAGAGCTCGTTCAGGG + Intergenic
1002853975 6:1021447-1021469 CTGTGCCTAGTGTTGGTTCGTGG + Intergenic
1003447469 6:6197856-6197878 CTCTGCTAAGAGCAGCTTCAAGG + Intronic
1003505159 6:6734608-6734630 GTGTGATAAGAGCTGGTTAATGG - Intergenic
1003635613 6:7828941-7828963 CTGTGCCAAGCCCTGGGACACGG - Intronic
1004306484 6:14506102-14506124 GTGGTCCAAGAGCTGGTTCTTGG + Intergenic
1005375757 6:25180767-25180789 TTGTACCATGAGCTGCTTCATGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007545535 6:42690842-42690864 CTTTGCCAAGAGCAGGTAAAAGG - Intronic
1007607331 6:43126433-43126455 GTGGGGCAAGAACTGGTTCACGG - Intronic
1011345538 6:86366040-86366062 CTGGGACAAGAGAGGGTTCAGGG - Intergenic
1013015822 6:106159789-106159811 CAGTGCCAAGTGCTGGCCCATGG + Intergenic
1013662153 6:112308754-112308776 CAGTGTCAAGAGCTGCTTCATGG + Intergenic
1016023220 6:139257473-139257495 TTGTGCAAAGAGCTGATTCTTGG + Intronic
1018690441 6:166339983-166340005 CTGTGGGAGGAGCAGGTTCAGGG - Intronic
1018758749 6:166872253-166872275 CTGGGCCAGGAGCTTGTACAGGG - Intronic
1019831565 7:3336043-3336065 CTGTGCCTACTGGTGGTTCAGGG - Intronic
1023319697 7:38980894-38980916 CTGTGTCCTGAGCTGGATCATGG - Intronic
1023970008 7:44983946-44983968 TTGTGCCATGTGCTGGGTCAGGG + Intergenic
1024359966 7:48458217-48458239 CTGTGCCAAGATTTAGATCATGG - Intronic
1025016222 7:55440919-55440941 CTGTGCCAAAACCATGTTCAGGG + Intronic
1025025848 7:55515426-55515448 CTGTGCCCAGAGGTGGCTGATGG - Intronic
1027202880 7:76074085-76074107 ATGAGGCAAGAGCTGGTTCCAGG + Intergenic
1027967190 7:85027162-85027184 CAGGGCCCAGAGCTGGTTCAGGG + Intronic
1030076722 7:105743267-105743289 CTGTGCCAAGAACTGGGGCCAGG + Intronic
1030902540 7:115142055-115142077 CTGTGCCAAGACCTGTTCCAAGG + Intergenic
1031956156 7:127944578-127944600 CTGCCCCAAGAACCGGTTCAGGG - Intronic
1035053263 7:156016704-156016726 CTGTTCCTAGAGATGCTTCACGG + Intergenic
1036815246 8:11897521-11897543 CTTTGCCAATAGCTGGTTTGTGG + Intergenic
1038100001 8:24362546-24362568 TAGTGCCAATTGCTGGTTCAAGG + Intergenic
1039372896 8:37004557-37004579 TTGTGAGGAGAGCTGGTTCAGGG + Intergenic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1040106901 8:43546580-43546602 CTCTGCCAAGATCTGGCGCAGGG + Intergenic
1040522356 8:48189170-48189192 CTGTGCCAAGACATGGTGCTGGG - Intergenic
1040587267 8:48755929-48755951 CTGTGCCATGAGATACTTCAAGG - Intergenic
1043733095 8:83710145-83710167 CTCTTCTAGGAGCTGGTTCACGG - Intergenic
1043885682 8:85597091-85597113 CTGTGACAATAGCTGGGTCTTGG - Intergenic
1045036045 8:98177169-98177191 CAGTGCCAAGTGCTGGGGCAGGG - Intergenic
1045049011 8:98306065-98306087 CTGGGCCAAAAGCTGTTTCTGGG - Intergenic
1045508221 8:102793756-102793778 CTGTGGAAAGAGATGGGTCAGGG - Intergenic
1047794368 8:128239107-128239129 TTGTGCCAAGAGATTGTGCAAGG - Intergenic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1057220530 9:93255382-93255404 CAGTGCCCAGAGCTGGTAGACGG + Intronic
1060215632 9:121736796-121736818 CTGTGCCAGGCTCTGGTTCGAGG + Intronic
1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG + Intergenic
1061852437 9:133424017-133424039 CTGTGCCCAGAGCAGGGTCCAGG + Intronic
1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG + Intergenic
1203435557 Un_GL000195v1:133682-133704 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1186473190 X:9837060-9837082 CGGTGCCAAGTGCTGGTCCTTGG + Intronic
1187601730 X:20839093-20839115 CTGTGCCCTGAGCTTGATCAAGG - Intergenic
1189609144 X:42713622-42713644 CTGTGGTAAGAGTAGGTTCAGGG + Intergenic
1190782298 X:53609737-53609759 CTGTGCCCAAATCTGTTTCAAGG - Intronic
1192054940 X:67763804-67763826 CTGTGCCAGGCCCTGTTTCAGGG + Intergenic
1192090070 X:68144793-68144815 CTGTGCCAAGCCCTGTTTCAAGG + Intronic
1192205302 X:69091838-69091860 CTGTGCCAAGCACTGTTTCAAGG + Intergenic
1192219204 X:69185701-69185723 ATGTGCCAAGTACTGCTTCAGGG - Intergenic
1193551098 X:82893599-82893621 CTGTGCAGAGATCTGGTGCAGGG + Intergenic
1197923500 X:131621558-131621580 CTGTGCCAAGGGCTGTTATAAGG - Intergenic
1199858861 X:151781645-151781667 CTGAGCCAAGAGTGGGTTGAGGG - Intergenic
1200155404 X:153972290-153972312 CTGTCCCCAGTGCTGGTTAAAGG - Intergenic
1201458315 Y:14194893-14194915 CCCTGTCAAGAGCTGGTTCAAGG + Intergenic