ID: 1165709888

View in Genome Browser
Species Human (GRCh38)
Location 19:38003586-38003608
Sequence CTGTAAATACAGACGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165709878_1165709888 8 Left 1165709878 19:38003555-38003577 CCGAGTTTCCCGTGCCACCGCCA 0: 1
1: 0
2: 1
3: 5
4: 115
Right 1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
1165709880_1165709888 -1 Left 1165709880 19:38003564-38003586 CCGTGCCACCGCCAGTTCCCAGC 0: 1
1: 0
2: 3
3: 27
4: 324
Right 1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
1165709881_1165709888 -6 Left 1165709881 19:38003569-38003591 CCACCGCCAGTTCCCAGCTGTAA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
1165709879_1165709888 0 Left 1165709879 19:38003563-38003585 CCCGTGCCACCGCCAGTTCCCAG 0: 1
1: 0
2: 2
3: 19
4: 264
Right 1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
1165709877_1165709888 26 Left 1165709877 19:38003537-38003559 CCTGACTTGAGTTTATTTCCGAG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
1165709882_1165709888 -9 Left 1165709882 19:38003572-38003594 CCGCCAGTTCCCAGCTGTAAATA 0: 1
1: 0
2: 0
3: 15
4: 203
Right 1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165709888 Original CRISPR CTGTAAATACAGACGTGGCA GGG Intronic
900113028 1:1016964-1016986 CTATAAATACAGACAGGGCACGG - Intergenic
900237859 1:1601003-1601025 CTGTGTATGCAGACGTGGCCGGG + Intergenic
902372433 1:16014945-16014967 ATCTATATACAGATGTGGCATGG + Exonic
903377698 1:22876863-22876885 CTGTAACCCCAGGCGTGGCAAGG - Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905884462 1:41484373-41484395 CTGCAAATACAGAGGTGCCCAGG - Intronic
909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG + Intergenic
914509830 1:148321674-148321696 CTGAAAAGACACATGTGGCAGGG + Intergenic
915786579 1:158619783-158619805 CTAAAAATACATACGTAGCAAGG + Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920944372 1:210514858-210514880 CTCTAACTACAGGCCTGGCAAGG - Intronic
922358417 1:224798347-224798369 CTGTAAACCCAGAGCTGGCAGGG + Intergenic
923398606 1:233591970-233591992 ATGAAAAGACAGACCTGGCATGG - Intergenic
924068150 1:240247339-240247361 CTGTAAATACAAAATTGGCTGGG + Intronic
1063955435 10:11261258-11261280 CTGAAACTACTGATGTGGCAGGG - Intronic
1065914287 10:30339632-30339654 CTGTAAGTACAAATGGGGCATGG + Intronic
1066556539 10:36620566-36620588 CTGTAGACACAGGCTTGGCATGG - Intergenic
1072572579 10:96671743-96671765 CTTTAAATACAGTCATGGCCAGG + Intronic
1073401696 10:103262712-103262734 CTGTTACTGCAGACTTGGCATGG + Intergenic
1079629586 11:22657598-22657620 CTCTAAATACAAACAAGGCAAGG + Intronic
1080172389 11:29320925-29320947 TTGTAAATACAAAAGTGGAAAGG + Intergenic
1080310823 11:30889779-30889801 CTGTAAATAAAGAAATGGCATGG - Intronic
1082920753 11:58490802-58490824 CTGTAATTACACATGGGGCAGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085992857 11:81871552-81871574 TTCTAAATACAAACATGGCATGG - Intergenic
1088905668 11:114153958-114153980 CTTTTACTACAGAGGTGGCAGGG - Intronic
1089140347 11:116279251-116279273 CTGGAAAAACAGCCTTGGCAGGG + Intergenic
1089643724 11:119864439-119864461 CAATAAATACAAATGTGGCAGGG + Intergenic
1095884502 12:47174925-47174947 ATGTAGGTAAAGACGTGGCAAGG + Intronic
1097229556 12:57501522-57501544 CTGAAAATACAGAAATGGCTAGG + Intronic
1097835264 12:64266524-64266546 CTGTAATTCCAGAAGTGGCGTGG + Exonic
1098232196 12:68383248-68383270 CTGTCAATGGAGAGGTGGCATGG - Intergenic
1104676200 12:130714116-130714138 CCAAAAATACAAACGTGGCAGGG + Intronic
1105253686 13:18725237-18725259 CTGTAAAGGAAGACGTGACAGGG - Intergenic
1105562457 13:21506811-21506833 CTGAAAATACAGGAGTGACAGGG - Intronic
1105946982 13:25198471-25198493 GAGTAAAAACAGACCTGGCAAGG + Intergenic
1107306783 13:39030416-39030438 CTTAAAATTCAGAGGTGGCAAGG - Intronic
1125174084 15:36800286-36800308 CTGCAAATACAGACCTGGCAAGG + Intronic
1129827340 15:78642327-78642349 AAGTAAATAAAGACATGGCAAGG + Intronic
1130657937 15:85805416-85805438 GTGTAAATGAAGACTTGGCATGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134637225 16:15801658-15801680 CTCTAAAAACAGACCTGGGATGG + Intronic
1139329942 16:66179914-66179936 CTGCAAATATAGACCTTGCAGGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1150043862 17:61891966-61891988 CTCTAAATACAGATATGGTAGGG - Intronic
1150104410 17:62451599-62451621 CTAACAATACAGACCTGGCACGG + Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1152043495 17:77920418-77920440 CTAAAAATACAGATGTGGCCAGG + Intergenic
1152376403 17:79920982-79921004 CTGAGAAAACAGAGGTGGCAAGG - Intergenic
1153874811 18:9359875-9359897 CTGTAAATGCAAATATGGCAGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1158678536 18:59545469-59545491 CTGTATATACTGACGTGGAATGG - Intronic
1161132333 19:2598360-2598382 CTGAAAATACAGAATTGGCCGGG + Intronic
1161182451 19:2893425-2893447 CTGAAAATACAGAATTGGCCGGG + Intergenic
1161557763 19:4954253-4954275 CTGGAAACCCAGACCTGGCAAGG + Intronic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1164269235 19:23655964-23655986 CTGGCACTACAGACGTGCCATGG - Intronic
1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG + Intronic
925342807 2:3148615-3148637 CAGTAAATACAGAGGTTGCCTGG - Intergenic
933971773 2:87475586-87475608 CAATCAAGACAGACGTGGCAGGG + Intergenic
936321955 2:111474615-111474637 CAATCAAGACAGACGTGGCAGGG - Intergenic
943021699 2:182582150-182582172 CTTTAAATGCAAAGGTGGCAAGG + Intergenic
1169450851 20:5709654-5709676 CTAGAAAAACAGAGGTGGCATGG + Intergenic
1170573276 20:17644579-17644601 CTGTAGTTACAGACTGGGCAGGG + Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175803162 20:61812546-61812568 CTGAAAATACAGACCAGGTATGG - Intronic
1178203697 21:30438811-30438833 CTGTAAATAGATATATGGCACGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1185212201 22:49576642-49576664 CTGTGTAGACAGACGTGGCCGGG - Intronic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952321490 3:32281944-32281966 CTGTAAATACAAGAGTGCCAGGG + Intronic
954168387 3:48779488-48779510 TTATAAATATAGACCTGGCATGG + Intronic
961165429 3:124760239-124760261 CTGGAAATGCAGACAGGGCATGG - Intergenic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
967079473 3:186036140-186036162 CTGTGAAGACCCACGTGGCAAGG + Intergenic
967935761 3:194726129-194726151 GTGTAAATGCAGACTTGGGACGG - Intergenic
968012656 3:195295272-195295294 CTGTAAATAGCGACGAGGCCAGG - Intronic
970325044 4:14915275-14915297 ATGTAATTATAGACGTGGGAAGG + Intergenic
972092900 4:35310802-35310824 ATGTAAAAACATAAGTGGCAAGG + Intergenic
972800723 4:42473394-42473416 CCCTAAATAGAGAGGTGGCATGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975714059 4:77188745-77188767 GTATAAATATAGCCGTGGCAGGG + Intronic
976156364 4:82149203-82149225 TTGTAAAAACAAAAGTGGCATGG + Intergenic
976232069 4:82854856-82854878 CTGCATTTACATACGTGGCAGGG - Intronic
977708769 4:100100494-100100516 CTATAAATACAGCCCTGGCAGGG - Intergenic
980848004 4:138347284-138347306 CTGTACAAACAGACTTGCCACGG - Intergenic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
984339387 4:178435866-178435888 CTGTAAGTACAGATATGGGAAGG + Intergenic
984423290 4:179552387-179552409 CAGAAAATACAGACATGGCTTGG + Intergenic
985905464 5:2831588-2831610 CTGCAGGTGCAGACGTGGCAGGG + Intergenic
986668365 5:10122773-10122795 ATGGAAATACAGGCCTGGCATGG + Intergenic
987333668 5:16879348-16879370 CTTTAAACACAGAGTTGGCAGGG + Intronic
987361758 5:17113499-17113521 GTGTTAGTACTGACGTGGCATGG - Intronic
987837901 5:23185662-23185684 CGGTAAATACATAAGTAGCAAGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
990214747 5:53517883-53517905 ATGTAAATGCAGACATGACAGGG - Intergenic
990696953 5:58429097-58429119 CTGTAAATTAAGACCTAGCATGG + Intergenic
992147392 5:73864889-73864911 CTGTGAATATATATGTGGCATGG + Intronic
992181271 5:74200622-74200644 CTGTACATACAGTGGTGGCGAGG + Intergenic
992761548 5:79955179-79955201 GTGTAAATAGAGAAGAGGCAGGG - Intergenic
994263444 5:97686294-97686316 CTGTAAAAACACAGATGGCAGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
1000276077 5:159735852-159735874 CTGTAAAAACAGAGGAGCCAAGG - Intergenic
1004548249 6:16620709-16620731 CTGTAAATACACCTGTGCCATGG - Intronic
1005785174 6:29237563-29237585 CTGTAAAGACACATGTGGCCAGG - Intergenic
1010141403 6:72619280-72619302 CTTTGAATACAGACGTTGCTAGG - Intergenic
1016418926 6:143863928-143863950 CTGTAAATAGAAAAGTGGCCTGG + Intergenic
1016805699 6:148210235-148210257 CTGCAAAAACAGACCAGGCATGG + Intergenic
1019394311 7:808813-808835 CTGTAAAGAAAGACCTGGCCAGG + Intergenic
1022474445 7:30700852-30700874 CAGCAAATACAGCCATGGCAGGG + Intronic
1023981384 7:45072640-45072662 CTGTAAATACAGCAGTGGGCTGG + Intronic
1024491095 7:49986462-49986484 CTGTGGATACACACGTGGCAGGG - Intronic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026739440 7:72969591-72969613 CTGGAACTACAGAGGTCGCACGG - Intergenic
1027104291 7:75395482-75395504 CTGGAACTACAGAGGTCGCACGG + Intronic
1030794787 7:113774404-113774426 CTGGAAATACAGAAGTGTTATGG - Intergenic
1031383006 7:121111418-121111440 CTATAAAAACAGCCTTGGCAGGG + Intronic
1032076532 7:128838703-128838725 CTGCACATACAGACCTGCCATGG + Exonic
1033654698 7:143364834-143364856 CTTTAAATACATACTTGGCGGGG + Intergenic
1034756903 7:153630936-153630958 ATGTAAATAGAAACGTGACACGG + Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1043043587 8:75293387-75293409 ATGAAAATACAGAAGTGGCCGGG + Intergenic
1050298222 9:4228560-4228582 CTGCAAATACAGCCAGGGCAAGG + Intronic
1050630755 9:7555865-7555887 CTGTAAAAACTGAAGTGGGAGGG + Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1053366184 9:37524121-37524143 CTGTGAGAACAGACTTGGCATGG - Intronic
1058704270 9:107625691-107625713 CTAAAAATACAAACGTAGCAGGG + Intergenic
1059371889 9:113847754-113847776 CATTAAATCCAGATGTGGCATGG + Intergenic
1060711124 9:125865101-125865123 ATTTAAATACTGATGTGGCATGG - Intronic
1061376157 9:130226072-130226094 CTGTAACTCCACACGTGTCATGG - Intronic
1062085194 9:134644535-134644557 CTGGAAATGCAGGCGTGGCGGGG + Intronic
1062679739 9:137772509-137772531 GTGTAAATACAGAGCTGGCGAGG - Intronic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186785222 X:12950810-12950832 CTGGAAATACAGGCGTGGACAGG + Intergenic
1187009954 X:15268706-15268728 CTGTATATATAGGCGGGGCACGG - Intronic
1194047025 X:89020618-89020640 CTGTAAAGAGAGTCTTGGCATGG + Intergenic