ID: 1165711524

View in Genome Browser
Species Human (GRCh38)
Location 19:38014438-38014460
Sequence CTGCCCCCAGAACCTTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165711524 Original CRISPR CTGCCCCCAGAACCTTCAGC TGG (reversed) Intronic
900570281 1:3354930-3354952 CTGACCCCACTCCCTTCAGCAGG - Intronic
901050599 1:6424225-6424247 CTGCCCCCAGAGGTTCCAGCGGG - Intronic
901635025 1:10666507-10666529 CAGCCCCCAGGAGCTCCAGCAGG + Intronic
903005991 1:20299244-20299266 CTTCCCTCTTAACCTTCAGCTGG + Intronic
903608427 1:24591911-24591933 CTGCCACCAGAGCCCTGAGCTGG + Intronic
904082773 1:27882440-27882462 CAGGCCCCAGCACCTCCAGCCGG - Exonic
904303472 1:29571422-29571444 CTGCCCCGAGAGCATTCAGGTGG + Intergenic
911367320 1:96954291-96954313 TTTCCCCCAGAGCCTTCAGAGGG - Intergenic
912449214 1:109759075-109759097 CTTCCTCCAGAGCCTTCTGCAGG + Exonic
913965863 1:143377156-143377178 CAGCCCCCATAAGCTTCATCAGG - Intergenic
914060237 1:144202764-144202786 CAGCCCCCATAAGCTTCATCAGG - Intergenic
914118913 1:144763605-144763627 CAGCCCCCATAAGCTTCATCAGG + Intergenic
915456063 1:156041627-156041649 CGGACCCCAGCACCCTCAGCAGG - Exonic
916292770 1:163184798-163184820 TTTCCCCCAGAACCTCCAGGAGG + Intronic
918992453 1:191715255-191715277 TTTCCCCTAGAACCTTCAGATGG - Intergenic
919465543 1:197919038-197919060 CTTCCCCACGAAACTTCAGCGGG - Intronic
920543659 1:206798081-206798103 CTGTCCCCATGACCTACAGCAGG - Intergenic
920863098 1:209727254-209727276 CTCCCCCCAAAACCTATAGCAGG - Intronic
921077969 1:211715029-211715051 CTGCCTCCCAGACCTTCAGCAGG + Intergenic
922182293 1:223244741-223244763 GTGCCCAAAGTACCTTCAGCAGG + Intronic
922363943 1:224846316-224846338 GTGCCCCCAGCAATTTCAGCAGG - Intergenic
923276853 1:232403967-232403989 CTGTCTCCAGAACCTTCTCCGGG - Intronic
924647721 1:245894614-245894636 GTGCCCCCATAAGCTTTAGCAGG + Intronic
1062921693 10:1285203-1285225 CTGCCAAGAGACCCTTCAGCAGG - Intronic
1063064996 10:2599584-2599606 CTCCACCCAGAACTTTCAACAGG + Intergenic
1066194866 10:33089354-33089376 CTGCACCCAGAAGCCTCAGCAGG - Intergenic
1068674488 10:59755892-59755914 CCTCCCCCAGAGCCTTCAGAGGG + Intergenic
1072039991 10:91597794-91597816 CTGCCCCCTGGACCTACAGCTGG - Intergenic
1073175863 10:101557108-101557130 CTTCCCCGAGAGCTTTCAGCTGG + Exonic
1074777681 10:116778331-116778353 TTCCCCCCAAAACCTCCAGCTGG + Intergenic
1080999106 11:37645467-37645489 ATACCCCAAGAACCTTCAGAGGG - Intergenic
1082287499 11:50333577-50333599 CTTCCCCCCGAAACTTCAGTTGG + Intergenic
1084535449 11:69753695-69753717 GTGCCCCCAGAATCTGCATCTGG + Intergenic
1084888371 11:72224646-72224668 CTGCCCCCAGCTCCTCCTGCGGG - Intronic
1084978569 11:72816429-72816451 CTTCCCTCAGGACCCTCAGCGGG + Intronic
1086498168 11:87425304-87425326 CTTCCCTCAGAACCCTCAGAAGG + Intergenic
1089864812 11:121622554-121622576 CTTCCCGCAGAAGCTGCAGCTGG + Intronic
1090077899 11:123590975-123590997 CTGCCTCCCGGACCTCCAGCTGG + Intronic
1090334060 11:125951039-125951061 CTGCCCCCAGCAACGTCACCTGG + Intergenic
1090412946 11:126521396-126521418 CTGCCCTCAGGATCTTCAGGTGG + Exonic
1091073027 11:132586931-132586953 CTGCCTCCAGAGCCTGCAGAGGG - Intronic
1091281010 11:134381690-134381712 CTGCCACCAGACTCTTCAGAGGG - Exonic
1091600535 12:1915306-1915328 CCGGCCCCACAACCCTCAGCAGG - Intronic
1093852584 12:24058870-24058892 CTGCCACCAGAAGCAGCAGCTGG - Intergenic
1094794299 12:33952751-33952773 CTGCCCCCAGACCCTTCTGGGGG + Intergenic
1095106149 12:38235361-38235383 CTGCCCCCAGACCCTTCTGGGGG + Intergenic
1095559591 12:43550736-43550758 CTGCCACCAGAGCCTTCCGAAGG + Intronic
1095565851 12:43622138-43622160 CTGCACCCAGAAGCTTCTTCTGG + Intergenic
1096096648 12:48939894-48939916 CTGCCCCCAGGAGCTGCAGCAGG + Intronic
1096226455 12:49869587-49869609 CCTCCCCCAGAACATCCAGCCGG + Exonic
1096620605 12:52862318-52862340 CTTCACCCACAAGCTTCAGCTGG - Intergenic
1096991407 12:55807035-55807057 CTCCCACCCGAACCTCCAGCTGG + Intronic
1097187803 12:57204919-57204941 CAGCCCCCAGAGCCTTCCCCAGG - Intronic
1099580026 12:84434450-84434472 AAGGCCCAAGAACCTTCAGCAGG + Intergenic
1099953296 12:89327665-89327687 CCGCCCCCAAAACCTTTATCAGG - Intergenic
1100277603 12:93085584-93085606 TCTCCCTCAGAACCTTCAGCGGG + Intergenic
1102617451 12:114166954-114166976 CTGACCCCAGCACCTGTAGCTGG - Intergenic
1102691580 12:114765595-114765617 CTGCTTCCAGAACCTTCCTCAGG - Intergenic
1103524322 12:121557685-121557707 CTGCCCCTAGAGACTTCAGGGGG + Intronic
1104187736 12:126448853-126448875 GGGCCCCCAGGACCTACAGCAGG + Intergenic
1108173127 13:47764356-47764378 CTGCTCTCAGAAACTTCAGGAGG - Intergenic
1108691811 13:52865874-52865896 CTGCACCCAGAAGCAACAGCAGG - Intergenic
1112012546 13:95304023-95304045 CTCCCACCTGAACCTCCAGCTGG - Intergenic
1112310459 13:98313468-98313490 ATTCTCCCAGAACCTTCAGGAGG + Intronic
1112880983 13:104106232-104106254 CAGCCGCCAGTTCCTTCAGCAGG - Intergenic
1113566778 13:111324092-111324114 GCACCCCCAGGACCTTCAGCGGG - Intronic
1113610488 13:111641547-111641569 CTGCCAGCAGCACCTCCAGCAGG - Intronic
1113952985 13:114082084-114082106 CTGCACCCAGAACCACCTGCAGG - Intronic
1117391561 14:55267468-55267490 TTGCCCTCAGAACATTCAGAAGG - Intergenic
1117444085 14:55787160-55787182 CTTCCCCCAGAGCCCTCAGAGGG - Intergenic
1118220727 14:63853006-63853028 CTGCGCCCAGAGCCTTCGGCCGG + Exonic
1121407389 14:93727507-93727529 CTGCCCACAGAATCCCCAGCAGG - Intronic
1122204772 14:100142987-100143009 CAGCCCCCACAACCTTCTCCTGG + Intronic
1122479536 14:102037888-102037910 CTGTCCCCAGAACTTTCTGCAGG + Intronic
1122503306 14:102216080-102216102 CTGCCTCCAGCACGTTCATCGGG + Intronic
1122762340 14:104038488-104038510 CAGCCTCCAAATCCTTCAGCTGG - Intronic
1122859275 14:104575265-104575287 CAGAGCCCAGAACCTTCAGCAGG + Intronic
1122929638 14:104927402-104927424 CTGTCCCCAGCACCTCCAGCAGG - Intronic
1123203649 14:106691899-106691921 CGGCCCTCAGAACCTGCAGGGGG - Intergenic
1123449462 15:20350906-20350928 CTTCCCCCTGATCTTTCAGCAGG - Intergenic
1127720688 15:61695804-61695826 CTGTCCCTAGAAACTTCAGAGGG + Intergenic
1127773195 15:62246625-62246647 CTGCCCCCGGAGCCTCCAGCAGG - Intergenic
1129217159 15:74107047-74107069 CTCCCCCCAGTCCCTCCAGCAGG - Intronic
1129470688 15:75751810-75751832 CTCCCCCCAGTCCCTCCAGCAGG + Intergenic
1129726777 15:77905524-77905546 CTGCCCCAAGTACCTCCAGAGGG + Intergenic
1130259680 15:82345396-82345418 CTGGCCCCAGAGCCCCCAGCAGG - Exonic
1130274812 15:82470864-82470886 CTGCCCCAAGTACCTCCAGAGGG + Intergenic
1130281555 15:82523613-82523635 CTGGCCCCAGAGCCCCCAGCAGG + Intergenic
1130417806 15:83710472-83710494 CTCCCCCCACCACCTTCAACAGG + Intronic
1130467161 15:84198233-84198255 CTGCCCCAAGTACCTCCAGAGGG + Intergenic
1130472928 15:84239796-84239818 CTGGCCCCAGAGCCCCCAGCAGG + Exonic
1130486452 15:84400952-84400974 CTGCCCCAAGTACCTCCAGAGGG - Intergenic
1130491350 15:84433762-84433784 CTGGCCCCAGAGCCCCCAGCAGG - Intergenic
1130497103 15:84475303-84475325 CTGCCCCAAGTACCTCCAGAGGG - Intergenic
1130502966 15:84512803-84512825 CTGGCCCCAGAGCCCCCAGCAGG - Intergenic
1130589456 15:85202831-85202853 CTGCCCCAAGTACCTCCAGAGGG + Intergenic
1130595220 15:85244432-85244454 CTGGCCCCAGAGCCCCCAGCAGG + Intergenic
1131021620 15:89104105-89104127 TTGCCCCCAGAACCTTCTCTTGG + Intronic
1132421044 15:101669091-101669113 CTGCCCCTGGAACCTTCCACTGG + Intronic
1132614719 16:834841-834863 CTCCACCCAGCACCCTCAGCCGG + Intergenic
1132766211 16:1535624-1535646 CCGCGCTCAGAACCCTCAGCGGG + Intronic
1135482494 16:22832705-22832727 CTCACCCCAGGACCTTCAGTTGG - Intronic
1138247068 16:55475646-55475668 CTTCCCCCAGAGGCTTCAGAGGG - Intronic
1141760004 16:86022088-86022110 CTCCAGACAGAACCTTCAGCTGG - Intergenic
1141842654 16:86584060-86584082 CTGCCCCCTCAGCCTGCAGCAGG + Intergenic
1142133566 16:88441727-88441749 ATGCCCCCAGCCCCTGCAGCTGG - Intergenic
1143158554 17:4853994-4854016 CTGCCTCCAGAACCTTCTAAGGG - Intronic
1143513642 17:7408570-7408592 CTGCCCGCAGAACCTGCACGGGG + Exonic
1146677364 17:34782678-34782700 CAGCCCCCAGAACCACCACCTGG + Intergenic
1147055655 17:37832854-37832876 CTGGACCCATGACCTTCAGCAGG - Intergenic
1147242815 17:39101674-39101696 TTGCTCCCAGAACCATAAGCCGG + Intronic
1147700847 17:42393847-42393869 CTTCCCCAAGAACATACAGCTGG + Intergenic
1148632374 17:49121202-49121224 CTGCTCCCAGAGCCTTGCGCAGG - Intergenic
1149009868 17:51845102-51845124 CCTCCCCTAGAACCTTCAGAGGG + Intronic
1149420527 17:56506500-56506522 CTCCCCCTAGAACCTCCAGAGGG + Intronic
1150296162 17:64008745-64008767 CAGGCCCCAGAACCTTCCTCTGG - Intronic
1150715808 17:67571852-67571874 TGCCCCCCAGAACCTTCAGAGGG - Intronic
1150721793 17:67619772-67619794 CTGCCCCCAGTGCCATCTGCAGG + Intronic
1151539615 17:74758343-74758365 CTGCCCCCACACCCTTCTCCCGG - Intronic
1152253366 17:79223418-79223440 CTGCACGCAGAACCTTCCCCTGG + Intronic
1152328381 17:79655984-79656006 ATGGCCCCAGAGCCTTCTGCAGG + Intergenic
1152504206 17:80736713-80736735 CTACAACCACAACCTTCAGCAGG - Intronic
1152749075 17:82054310-82054332 CTGCCCCAGGAGCCTACAGCCGG - Intronic
1154197381 18:12276590-12276612 CTGCCCCCAGCACCCACAACAGG - Intronic
1155153805 18:23142104-23142126 ATGCCCCCAGACCCTGCAGCAGG - Intronic
1159132845 18:64300295-64300317 CTGCCCGTATAACCTTAAGCAGG + Intergenic
1160322398 18:77908236-77908258 CCACCCCCAGAACCTTCACCTGG + Intergenic
1160345563 18:78129155-78129177 CTTCCCCTAGGACCTTCAGAGGG + Intergenic
1160701066 19:507659-507681 GCGCCTCCAGCACCTTCAGCAGG - Exonic
1162063249 19:8109590-8109612 CTGACCCCAGAACCCTGATCTGG + Intronic
1163220283 19:15913897-15913919 TTGCCCCCAGAAACTGCATCGGG - Exonic
1163518057 19:17776668-17776690 CTGCCCCCAGAACCAGCAGGTGG + Exonic
1163762493 19:19145369-19145391 CTGTCCCCAGAACCCCCCGCGGG + Intergenic
1164857309 19:31535048-31535070 CTGCCCTCAGAAACTTTTGCGGG + Intergenic
1165711524 19:38014438-38014460 CTGCCCCCAGAACCTTCAGCTGG - Intronic
1165743250 19:38216107-38216129 CGGCCCCCAGAAACCTCAGGTGG + Intronic
1166098073 19:40554137-40554159 CTGCCCCCAGGGCCTGCGGCGGG + Exonic
1166160502 19:40949227-40949249 CTTCCCTCAGCCCCTTCAGCGGG - Intergenic
1166169381 19:41016820-41016842 CTTCCCTCAGCCCCTTCAGCGGG - Exonic
1166707212 19:44914672-44914694 CTGCCCGCAGGACCTTTATCAGG - Exonic
1166709317 19:44926768-44926790 CTGCCCGCAGGACCTTTATCAGG - Intergenic
1168705642 19:58468820-58468842 CTGCCCCCACCATCTTCAGATGG - Intronic
1168708053 19:58480793-58480815 CTGCCTCCAGAGTCTTCTGCTGG - Exonic
1202699641 1_KI270712v1_random:154649-154671 CAGCCCCCATAAGCTTCATCAGG - Intergenic
925027827 2:623525-623547 CTGGCCCCAGCGCCTGCAGCTGG - Intergenic
925317880 2:2939273-2939295 CTGCCTGCAGAACCTGGAGCGGG - Intergenic
926050829 2:9743716-9743738 CCTCCCCTAGAGCCTTCAGCAGG + Intergenic
927444350 2:23144646-23144668 CTGCCCAGAGAAACTTCAGAGGG + Intergenic
927841743 2:26449433-26449455 CTGCCCTCTGAACCTGCAGCTGG + Intronic
928833017 2:35511652-35511674 CTGCCTCCTTAACCTTCACCAGG + Intergenic
930055775 2:47250942-47250964 CTGCCCCCCGACCCGTCATCAGG + Intergenic
931177483 2:59868582-59868604 CTGCTCCCAGAACCCTGTGCAGG + Intergenic
935741712 2:106154580-106154602 CTCCCCTCAGAGCCTTCAGAGGG + Intronic
936087588 2:109479849-109479871 CTGCCCTCAGAGCCTTCATACGG + Intronic
937322697 2:120970450-120970472 CTGACCCCAGACCCCTCTGCTGG - Exonic
938762595 2:134439342-134439364 CTGCCCACAGAGCCTTCGGTGGG + Intronic
940188451 2:151012460-151012482 CGTTGCCCAGAACCTTCAGCTGG + Intronic
940224144 2:151384170-151384192 CTGCCCCCAGACCCTTTAGGAGG + Intergenic
942354714 2:175097852-175097874 CTCCTCCAAGAACCTACAGCTGG + Intronic
943700750 2:190986234-190986256 CTGGGCCCAGAACCTGCAGGAGG - Intronic
945325538 2:208478349-208478371 CTCCCCCCAGCACCTCCAGAAGG - Intronic
945943230 2:215970290-215970312 CTTCCCTCAGAGCCCTCAGCAGG + Intronic
946254958 2:218435499-218435521 CTACACCCAGAGCCTACAGCAGG + Intronic
947588787 2:231372819-231372841 CTGCCCACAGACCCTTCAATGGG + Intronic
947613373 2:231537890-231537912 CTGCTCCCAGACCCTCCAGTGGG + Intergenic
947715715 2:232338000-232338022 CTGTCCCCAGAACCTTCTCCTGG + Intronic
947721249 2:232370377-232370399 CTGTCCCCAGAACCTTCTCCTGG + Intergenic
947734744 2:232448760-232448782 CTGTCCCCAGAACCTTCTCCTGG + Intergenic
948384426 2:237572814-237572836 CAGCCACCAGAACCTGCAGGAGG + Intergenic
948719321 2:239888487-239888509 CAGCCTCCAGAACTGTCAGCTGG + Intergenic
948892108 2:240912531-240912553 CTGCCCCCTGTACCTTGACCTGG - Intergenic
948913715 2:241019472-241019494 CTGCCCCCAGGACCACCAGTGGG - Intronic
1170562213 20:17568201-17568223 CTTCCTCCATAACCCTCAGCAGG - Intronic
1172107120 20:32523399-32523421 CTCCCCCTGCAACCTTCAGCAGG + Intronic
1172616065 20:36285659-36285681 CTGACTCCAGAACCTTCTGTGGG - Intergenic
1173941562 20:46915277-46915299 CTGCCTCCAAAAACCTCAGCCGG + Intronic
1174385679 20:50187447-50187469 CTGCCCTCAGAACCTAGAGCCGG - Intergenic
1174459021 20:50669794-50669816 CTACTCCCAGACCCTTCTGCAGG - Intronic
1175113935 20:56668428-56668450 CCTCCCCCAGAGCCTTCAGAGGG + Intergenic
1175221092 20:57416888-57416910 CTGCCCTCCTAACCTGCAGCTGG + Intergenic
1176042301 20:63072156-63072178 CGTCCCCCAGAGCCTGCAGCGGG + Intergenic
1176134909 20:63518301-63518323 CTGCCCCCATTTCCTACAGCCGG + Intergenic
1178181008 21:30161560-30161582 CTTCCCTCACAACCTTCAGAAGG - Intergenic
1179016124 21:37595659-37595681 CTGACCCAAGCACCATCAGCGGG - Intergenic
1179444919 21:41424469-41424491 CTGACCCCAGGACCTAAAGCTGG + Intronic
1180055588 21:45357622-45357644 CTGCCCTCAGCTCCTGCAGCTGG + Intergenic
1180224997 21:46386957-46386979 CTGGACCCAGAAGCCTCAGCGGG - Intronic
1181010349 22:20036688-20036710 CTGCCCTCCGAACCTGCAACAGG - Intronic
1181349409 22:22244564-22244586 CTGGCCCCAGAGTCTCCAGCAGG + Intergenic
1181387536 22:22557235-22557257 CAACCCCCAGCACCTTCAGAGGG + Exonic
1181408899 22:22704378-22704400 CTGCCCCCAGACCCTGCCCCAGG + Intergenic
1181624735 22:24115587-24115609 CTGCTCCCAGAACTATCTGCTGG - Intronic
1181911635 22:26242970-26242992 TTGCCCTCAGAACCTCCAGAAGG - Intronic
1182003413 22:26939625-26939647 CTGCCCCCTAAACCCTCTGCTGG + Intergenic
1182094865 22:27619296-27619318 CTGACCCCAGAACCATCTACAGG - Intergenic
1182351757 22:29703660-29703682 CTGCCCCCACCACCTTCTGAGGG - Intergenic
1182476147 22:30577420-30577442 ATGCCACTAGAACCTTCACCAGG + Intronic
1182515990 22:30859436-30859458 CTGACCCCACAACCATCAGCAGG + Intronic
1184738535 22:46413044-46413066 CTGACCCCAGAACTATCAGGAGG - Intronic
1184849521 22:47112305-47112327 CTGCACCCAGAGCCCTCTGCTGG - Intronic
1185410472 22:50678958-50678980 CTGCCCCCAGCCCCATCACCAGG - Intergenic
950695871 3:14700891-14700913 CTGGCCCCAGAACTGTCAGCAGG - Intronic
953920074 3:46945439-46945461 CTCCTCCCAGAGCCTTCAGCAGG + Intronic
955339587 3:58115194-58115216 CAACCCTCAGAACCATCAGCAGG - Intronic
956867044 3:73380078-73380100 CTTCCACCAGATCCTTCAGTGGG + Intergenic
961696194 3:128706777-128706799 CTGCCCCCAGAACTCTTACCAGG + Intergenic
963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG + Intergenic
963732320 3:148986156-148986178 CGGACCCCAGCACCCTCAGCAGG - Intergenic
964311801 3:155401915-155401937 TTGCCCCAAGAACCTTCATCTGG - Intronic
965449454 3:168819643-168819665 CTGTCCCTAGCACCTTCAGGGGG - Intergenic
966380021 3:179335658-179335680 CTTCCCCCACAACCCTCAGAAGG - Intergenic
966872913 3:184303310-184303332 CTGCCCCCAAACCCTGCAACAGG - Exonic
967521758 3:190440361-190440383 CTGCCACCAAAACCAGCAGCAGG + Exonic
968127450 3:196170186-196170208 CTGGCCTCTGAACCTTCTGCTGG - Intergenic
968599462 4:1502168-1502190 GTGCCCCCAGCTCCTGCAGCTGG - Intergenic
969029214 4:4197744-4197766 CAGCCCCCATAAGCATCAGCAGG + Exonic
969058849 4:4419317-4419339 CTGCCCCCAGAACAGGCAGGGGG - Exonic
969176016 4:5399668-5399690 CTGGCCCAAGGACATTCAGCTGG - Intronic
969363676 4:6681417-6681439 CTGCCCCCAGTGCATTCAGCAGG + Intergenic
969452860 4:7284832-7284854 CTTCCCCCAGAGCCTTCAGAGGG - Intronic
970328819 4:14957524-14957546 CTTCCCTCACAACCTTCAGAAGG + Intergenic
970756103 4:19428801-19428823 CTGCCCCCAGATGCTGCCGCAGG - Intergenic
970800655 4:19969573-19969595 AGGCCCCCAGAATCTCCAGCTGG - Intergenic
971278158 4:25217399-25217421 TTTCCCCCAGAGCCTTCAGAGGG + Intronic
971772197 4:30911151-30911173 TTGCCCCCACAACCTCCAACAGG - Intronic
971996420 4:33971360-33971382 GTGCCCACAAGACCTTCAGCTGG - Intergenic
986256432 5:6104675-6104697 CCTCCCCTAGAACCTTCAGTGGG + Intergenic
986449476 5:7850721-7850743 CCGCCCCAAGACCCTTCCGCTGG + Intronic
986613843 5:9596908-9596930 CTCCCCCCAGCACCTAGAGCAGG + Intergenic
987493525 5:18613484-18613506 CTTCCCTCACAGCCTTCAGCAGG - Intergenic
987709612 5:21491430-21491452 TGGCACCCAGCACCTTCAGCTGG - Intergenic
988750001 5:34182736-34182758 TGGCACCCAGCACCTTCAGCTGG + Intergenic
989161307 5:38394172-38394194 CTGTGCCCATAAACTTCAGCTGG - Intronic
990285506 5:54297294-54297316 CTGCCCCAGGAACCTGAAGCTGG - Intronic
991405378 5:66296102-66296124 CTGCCCCCTGCATCCTCAGCAGG + Intergenic
991738261 5:69645938-69645960 TGGCACCCAGCACCTTCAGCTGG + Intergenic
991759932 5:69910484-69910506 TGGCACCCAGCACCTTCAGCTGG - Intergenic
991787399 5:70207614-70207636 TGGCACCCAGCACCTTCAGCTGG + Intergenic
991789837 5:70225664-70225686 TGGCACCCAGCACCTTCAGCTGG + Intergenic
991814586 5:70500772-70500794 TTGGCACCAGCACCTTCAGCTGG + Intergenic
991817721 5:70522057-70522079 TGGCACCCAGCACCTTCAGCTGG + Intergenic
991839162 5:70785547-70785569 TGGCACCCAGCACCTTCAGCTGG - Intergenic
991879845 5:71207999-71208021 TGGCACCCAGCACCTTCAGCTGG + Intergenic
991882285 5:71226023-71226045 TGGCACCCAGCACCTTCAGCTGG + Intergenic
994164685 5:96596389-96596411 CTCCCCTCAGAACCTCCAGAAGG + Intronic
994461107 5:100067823-100067845 TGGCACCCAGCACCTTCAGCTGG + Intergenic
994485256 5:100381267-100381289 TGGCACCCAGCACCTTCAGCTGG + Intergenic
998371479 5:141664787-141664809 TTGCCTCCAGAAACTGCAGCTGG - Intronic
999288300 5:150407179-150407201 CACCTCCCAGAACCTGCAGCTGG - Exonic
999610656 5:153365739-153365761 CTGCCACCTCAATCTTCAGCAGG + Intergenic
999936065 5:156486762-156486784 CAGTCCCCAGATCCTTCAGGAGG - Intronic
1000045923 5:157521899-157521921 GTGCACACAGAACCATCAGCTGG - Intronic
1000343560 5:160295764-160295786 CTTCCCCTAGAGCCTTCAGAGGG + Intronic
1001137204 5:169112487-169112509 CTGACCCCAGAGCCTCCAGATGG - Intronic
1001559441 5:172659653-172659675 CAGCCCCCAGAACCTTCTGGAGG + Intronic
1002050554 5:176568331-176568353 CTGCACCCAGATGCTGCAGCTGG + Intronic
1002169633 5:177367777-177367799 CGGCCCCCAGGACCCTCAACGGG - Exonic
1002298375 5:178243852-178243874 CTGGGCCCAGAGCCTGCAGCTGG + Intronic
1002589199 5:180277310-180277332 CTCCCCCCAGAGCCTGCAGAAGG - Intronic
1003429019 6:6022140-6022162 CTCCCCCCACAACCCTCAGAAGG + Intergenic
1003925792 6:10876589-10876611 CTGACCCCAGACCCTTCTGAAGG + Intronic
1004558150 6:16720085-16720107 CTGGCCTCAGAGCCTTCACCTGG + Intronic
1005548065 6:26889066-26889088 TGGCACCCAGCACCTTCAGCTGG + Intergenic
1005844559 6:29767317-29767339 CTGCCCCCATAAGCTGCAGGAGG + Intergenic
1006202821 6:32311932-32311954 CTGCCCACTGAACCCTCAGGAGG - Intronic
1006416721 6:33908683-33908705 TTGCCCCCAAAACCCGCAGCAGG - Intergenic
1006581415 6:35079738-35079760 CAGCCCCCAGCATCTTCCGCTGG - Intronic
1007410532 6:41658736-41658758 CTGCCCCCACAGCCCACAGCGGG - Intergenic
1009018825 6:57930160-57930182 TGGCACCCAGCACCTTCAGCTGG + Intergenic
1011292366 6:85790118-85790140 CTTCCCTCAGAGCCTTCAGAAGG + Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013289776 6:108709953-108709975 CCGCCCGCTGAACCTCCAGCAGG + Intergenic
1013413694 6:109905534-109905556 CTACCCCTACCACCTTCAGCTGG - Intergenic
1013933223 6:115560865-115560887 ATGTTCACAGAACCTTCAGCAGG - Intergenic
1016314350 6:142770253-142770275 CCGCCCCCAGAAACCCCAGCTGG - Exonic
1018742972 6:166744421-166744443 CTACCCCCAGAGGCCTCAGCGGG - Intronic
1018932754 6:168252615-168252637 CTGGCTCCAGGTCCTTCAGCAGG + Intergenic
1018995935 6:168710405-168710427 CAGCCCACAGACCATTCAGCCGG - Intergenic
1019376044 7:692725-692747 CTGCCTCCCCAACCTTCAGGAGG - Intronic
1019556575 7:1634412-1634434 CTGCCCCGGGTACCTTCTGCAGG + Intergenic
1020194508 7:6026599-6026621 CCGCCTCCAGAACCATCATCTGG + Intronic
1023119212 7:36892494-36892516 CTGCCCCCAGCACCTTGAGCAGG + Intronic
1023120146 7:36900923-36900945 CTTCCCCCAGACCCCTCTGCAGG - Intronic
1023911560 7:44560247-44560269 CTTCCATCAGAACCTGCAGCTGG - Intergenic
1025731582 7:64113197-64113219 CTGTACCCGGTACCTTCAGCTGG - Intronic
1027741674 7:82015868-82015890 CTGCCCCCAAAACGTACATCAGG + Intronic
1029538839 7:101171516-101171538 CTGGCACCAGAAGCTTGAGCAGG + Exonic
1032591183 7:133193821-133193843 CTGCCCACAGAACAGTCAGCAGG - Intergenic
1034052826 7:148000888-148000910 CCTCCCCCAGATCCTTCAGAGGG - Intronic
1034404820 7:150896373-150896395 CTGGCCCCAGGAGCATCAGCAGG + Intergenic
1034975009 7:155443164-155443186 CCTCCCCCAGAGCCTTCAGAGGG + Intergenic
1035159896 7:156942949-156942971 CGGCCCGCCGCACCTTCAGCTGG - Intergenic
1035281973 7:157784341-157784363 CAGCCCCTCGAACCTTCACCCGG + Intronic
1037698393 8:21248786-21248808 CTGTCCCCAGAACTCTCAGAAGG + Intergenic
1037717374 8:21411733-21411755 CTGTCCCCAGCTCCTCCAGCTGG - Intergenic
1038364180 8:26914438-26914460 CTTCCCCTAGAGCCTTCAGAGGG + Intergenic
1038477005 8:27875605-27875627 GTGCCCCGAGAACCACCAGCAGG + Intronic
1044063406 8:87667492-87667514 CTGCTCTCAGAACTGTCAGCTGG + Intergenic
1044533994 8:93338991-93339013 CCTCCCCCAAAACCTTCAGAGGG - Intergenic
1045260783 8:100571556-100571578 CTTCTCCCAGCACCTGCAGCTGG + Intergenic
1048393792 8:133993618-133993640 CTGACTCCAGAACTTTCAGCTGG - Intergenic
1049172015 8:141167343-141167365 CTGCCCTCGGAACCTTCCCCTGG + Intronic
1049233155 8:141494645-141494667 TTACCCCCAGCCCCTTCAGCGGG - Intergenic
1049801658 8:144520544-144520566 CTGCATCCAGAAGCTGCAGCAGG - Exonic
1049814209 8:144590664-144590686 CTGCCCCCCCAGCCTTCTGCAGG - Intronic
1053016008 9:34662563-34662585 CTGAGCCCAGACCCTACAGCAGG - Exonic
1054143601 9:61547465-61547487 ATGCCTCCAGGACCCTCAGCAGG + Intergenic
1055535947 9:77244509-77244531 CTGCCCCTAGAACCCTCCTCAGG - Intronic
1055835888 9:80441279-80441301 CTGCTCCCAAATACTTCAGCAGG - Intergenic
1056665970 9:88581064-88581086 CTGCACACAGCACCTTCACCAGG - Intronic
1057029971 9:91768148-91768170 CTGTCCCCAGAGCCTTCAGAAGG + Intronic
1057231418 9:93323872-93323894 CAGCTCACAGAACCTTGAGCTGG - Intronic
1057236678 9:93366751-93366773 CAGCTCACAGAACCTTGAGCTGG + Intergenic
1060087595 9:120715537-120715559 GTGCCCCCAGAGCCTCCGGCTGG + Intergenic
1060532485 9:124356019-124356041 CTGCACCCAGATGCTGCAGCTGG + Intronic
1061063139 9:128260772-128260794 CCGCCCCCAGAGCCCCCAGCAGG - Exonic
1061229579 9:129307058-129307080 GTGTCCCAAGAACCTACAGCAGG - Intergenic
1061485822 9:130920033-130920055 CTGTGCCCAGAACCTGCAGGTGG - Intronic
1062495212 9:136828292-136828314 CTGCCTCCAGAGCCTACAGAGGG + Intronic
1062622223 9:137428282-137428304 CTGCCACCAGAACCTCCTGCGGG - Intronic
1185831119 X:3303881-3303903 CCTCCCCTAGAACCTTCAGAAGG + Intergenic
1186534566 X:10332984-10333006 ATGCCAACAGAACTTTCAGCAGG - Intergenic
1189324756 X:40105636-40105658 CTGCTCCCAGGCCCTGCAGCTGG + Intronic
1192321338 X:70092900-70092922 CTGAGACCAAAACCTTCAGCTGG + Intergenic
1194055435 X:89126766-89126788 CTGCACCCACAATTTTCAGCAGG - Intergenic
1194965629 X:100285566-100285588 CTGGCTCCAGAACCTACACCTGG - Intergenic
1196058047 X:111377336-111377358 CAGCACAAAGAACCTTCAGCTGG - Intronic
1198960524 X:142177554-142177576 CTGCCCTCACAGCCCTCAGCAGG - Intergenic
1200086969 X:153611717-153611739 CTGCCTTCAGAAACCTCAGCAGG + Intergenic
1202366944 Y:24172109-24172131 CTGGCCCCAGAGCCCCCAGCAGG + Intergenic
1202373462 Y:24213374-24213396 CTGGCCCCAGAGCCCCCAGCAGG - Intergenic
1202497319 Y:25456746-25456768 CTGGCCCCAGAGCCCCCAGCAGG + Intergenic
1202503838 Y:25498014-25498036 CTGGCCCCAGAGCCCCCAGCAGG - Intergenic