ID: 1165711695

View in Genome Browser
Species Human (GRCh38)
Location 19:38015801-38015823
Sequence CTTCGAACACAGCAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165711695_1165711702 8 Left 1165711695 19:38015801-38015823 CCTTCTTTCTGCTGTGTTCGAAG No data
Right 1165711702 19:38015832-38015854 GGCTCTAATGGAGGGGCCTCTGG No data
1165711695_1165711703 9 Left 1165711695 19:38015801-38015823 CCTTCTTTCTGCTGTGTTCGAAG No data
Right 1165711703 19:38015833-38015855 GCTCTAATGGAGGGGCCTCTGGG No data
1165711695_1165711698 -1 Left 1165711695 19:38015801-38015823 CCTTCTTTCTGCTGTGTTCGAAG No data
Right 1165711698 19:38015823-38015845 GCAACTCCTGGCTCTAATGGAGG No data
1165711695_1165711700 1 Left 1165711695 19:38015801-38015823 CCTTCTTTCTGCTGTGTTCGAAG No data
Right 1165711700 19:38015825-38015847 AACTCCTGGCTCTAATGGAGGGG No data
1165711695_1165711699 0 Left 1165711695 19:38015801-38015823 CCTTCTTTCTGCTGTGTTCGAAG No data
Right 1165711699 19:38015824-38015846 CAACTCCTGGCTCTAATGGAGGG No data
1165711695_1165711697 -4 Left 1165711695 19:38015801-38015823 CCTTCTTTCTGCTGTGTTCGAAG No data
Right 1165711697 19:38015820-38015842 GAAGCAACTCCTGGCTCTAATGG No data
1165711695_1165711704 10 Left 1165711695 19:38015801-38015823 CCTTCTTTCTGCTGTGTTCGAAG No data
Right 1165711704 19:38015834-38015856 CTCTAATGGAGGGGCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165711695 Original CRISPR CTTCGAACACAGCAGAAAGA AGG (reversed) Intronic