ID: 1165711697

View in Genome Browser
Species Human (GRCh38)
Location 19:38015820-38015842
Sequence GAAGCAACTCCTGGCTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165711695_1165711697 -4 Left 1165711695 19:38015801-38015823 CCTTCTTTCTGCTGTGTTCGAAG No data
Right 1165711697 19:38015820-38015842 GAAGCAACTCCTGGCTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165711697 Original CRISPR GAAGCAACTCCTGGCTCTAA TGG Intronic