ID: 1165712656

View in Genome Browser
Species Human (GRCh38)
Location 19:38023226-38023248
Sequence CCTCACCCTCTCCAGAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28375
Summary {0: 1, 1: 0, 2: 22, 3: 1367, 4: 26985}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165712656_1165712665 -8 Left 1165712656 19:38023226-38023248 CCTATCTTCTGGAGAGGGTGAGG 0: 1
1: 0
2: 22
3: 1367
4: 26985
Right 1165712665 19:38023241-38023263 GGGTGAGGCGGTGGGGCCGGGGG 0: 1
1: 0
2: 4
3: 109
4: 1080
1165712656_1165712667 -2 Left 1165712656 19:38023226-38023248 CCTATCTTCTGGAGAGGGTGAGG 0: 1
1: 0
2: 22
3: 1367
4: 26985
Right 1165712667 19:38023247-38023269 GGCGGTGGGGCCGGGGGTCAGGG 0: 1
1: 0
2: 1
3: 82
4: 811
1165712656_1165712670 6 Left 1165712656 19:38023226-38023248 CCTATCTTCTGGAGAGGGTGAGG 0: 1
1: 0
2: 22
3: 1367
4: 26985
Right 1165712670 19:38023255-38023277 GGCCGGGGGTCAGGGGGTACAGG 0: 1
1: 0
2: 3
3: 28
4: 396
1165712656_1165712663 -10 Left 1165712656 19:38023226-38023248 CCTATCTTCTGGAGAGGGTGAGG 0: 1
1: 0
2: 22
3: 1367
4: 26985
Right 1165712663 19:38023239-38023261 GAGGGTGAGGCGGTGGGGCCGGG 0: 1
1: 1
2: 1
3: 84
4: 974
1165712656_1165712669 0 Left 1165712656 19:38023226-38023248 CCTATCTTCTGGAGAGGGTGAGG 0: 1
1: 0
2: 22
3: 1367
4: 26985
Right 1165712669 19:38023249-38023271 CGGTGGGGCCGGGGGTCAGGGGG 0: 1
1: 1
2: 4
3: 62
4: 608
1165712656_1165712666 -3 Left 1165712656 19:38023226-38023248 CCTATCTTCTGGAGAGGGTGAGG 0: 1
1: 0
2: 22
3: 1367
4: 26985
Right 1165712666 19:38023246-38023268 AGGCGGTGGGGCCGGGGGTCAGG 0: 1
1: 1
2: 4
3: 78
4: 917
1165712656_1165712664 -9 Left 1165712656 19:38023226-38023248 CCTATCTTCTGGAGAGGGTGAGG 0: 1
1: 0
2: 22
3: 1367
4: 26985
Right 1165712664 19:38023240-38023262 AGGGTGAGGCGGTGGGGCCGGGG 0: 1
1: 0
2: 2
3: 64
4: 681
1165712656_1165712668 -1 Left 1165712656 19:38023226-38023248 CCTATCTTCTGGAGAGGGTGAGG 0: 1
1: 0
2: 22
3: 1367
4: 26985
Right 1165712668 19:38023248-38023270 GCGGTGGGGCCGGGGGTCAGGGG 0: 1
1: 0
2: 2
3: 65
4: 736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165712656 Original CRISPR CCTCACCCTCTCCAGAAGAT AGG (reversed) Intronic
Too many off-targets to display for this crispr