ID: 1165715967

View in Genome Browser
Species Human (GRCh38)
Location 19:38046137-38046159
Sequence GGAGCTTTCTATAGACGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165715960_1165715967 11 Left 1165715960 19:38046103-38046125 CCGTCATCTGGCCACTCAGTCGG No data
Right 1165715967 19:38046137-38046159 GGAGCTTTCTATAGACGAGAAGG No data
1165715958_1165715967 26 Left 1165715958 19:38046088-38046110 CCTTGAAGCTTTTTGCCGTCATC No data
Right 1165715967 19:38046137-38046159 GGAGCTTTCTATAGACGAGAAGG No data
1165715965_1165715967 0 Left 1165715965 19:38046114-38046136 CCACTCAGTCGGCGGGGTTGAGA No data
Right 1165715967 19:38046137-38046159 GGAGCTTTCTATAGACGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165715967 Original CRISPR GGAGCTTTCTATAGACGAGA AGG Intronic