ID: 1165716101

View in Genome Browser
Species Human (GRCh38)
Location 19:38046715-38046737
Sequence GCTCCTCTGACCCCGCAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165716096_1165716101 -7 Left 1165716096 19:38046699-38046721 CCAGGTCCCCCGAGCAGCTCCTC 0: 1
1: 0
2: 3
3: 41
4: 270
Right 1165716101 19:38046715-38046737 GCTCCTCTGACCCCGCAACCCGG 0: 1
1: 0
2: 0
3: 15
4: 134
1165716095_1165716101 -6 Left 1165716095 19:38046698-38046720 CCCAGGTCCCCCGAGCAGCTCCT 0: 1
1: 0
2: 3
3: 13
4: 178
Right 1165716101 19:38046715-38046737 GCTCCTCTGACCCCGCAACCCGG 0: 1
1: 0
2: 0
3: 15
4: 134
1165716094_1165716101 9 Left 1165716094 19:38046683-38046705 CCGGGTGTGGAGGGGCCCAGGTC 0: 1
1: 0
2: 3
3: 26
4: 313
Right 1165716101 19:38046715-38046737 GCTCCTCTGACCCCGCAACCCGG 0: 1
1: 0
2: 0
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165716101 Original CRISPR GCTCCTCTGACCCCGCAACC CGG Intronic
900296806 1:1956012-1956034 GCTGCTGTGATCCCACAACCAGG - Intronic
901170460 1:7253265-7253287 GCTGCAGTGACCCCGGAACCAGG - Intronic
901202357 1:7473829-7473851 TCTCCACTGACGCCGGAACCTGG + Intronic
902385057 1:16071763-16071785 GGTCCTCTGACCCCACACCTGGG - Intronic
902790282 1:18763024-18763046 GCTCCTCTGACATCGCTACAAGG - Intergenic
903017120 1:20368416-20368438 GCTTCTCTGATCCAGCCACCAGG + Intergenic
905891522 1:41521389-41521411 TCTCCTCTGCCCCCGCCACGGGG + Intronic
906296791 1:44653625-44653647 GCTCCTCTGACCCCATTGCCTGG - Exonic
906847867 1:49213917-49213939 GTTCCTGTGGCCCCCCAACCTGG + Intronic
906951392 1:50336852-50336874 GCTTCTCTGACCACCCAGCCTGG + Intergenic
909209986 1:72810747-72810769 ACTCCTCTTAACCCACAACCTGG - Intergenic
912863042 1:113232103-113232125 GCTCCTCTGACCCCGAAGGTGGG + Intergenic
913111459 1:115660972-115660994 GCACCTCTGAACCCACATCCAGG - Intronic
917920274 1:179744392-179744414 GCTGCTGGGACCCCGCCACCCGG + Intronic
1065288799 10:24209960-24209982 CCTCCTCTGGCCACCCAACCCGG - Intronic
1066989101 10:42495439-42495461 GCTCCGGTGACCCTTCAACCTGG - Intergenic
1073032282 10:100536177-100536199 TCACCTCTGACCTCTCAACCGGG - Intronic
1078671127 11:13366738-13366760 CCTCCTCTGACACCGCACCCCGG + Exonic
1081017975 11:37906979-37907001 TCTCCCCTGACCCCCCAACTGGG - Intergenic
1081792966 11:45802073-45802095 GATCCACTGACCCCTGAACCTGG + Intergenic
1081807585 11:45898952-45898974 GCTCCTCTGAGCCCCCAAGAGGG + Intronic
1083663259 11:64261854-64261876 GCTCCTGTGACCCCCACACCCGG - Intronic
1084151936 11:67291705-67291727 GCTCCTCCGGCCCCGCTGCCAGG - Exonic
1084171677 11:67404101-67404123 CCCCCTCTGACCCCGCAGCCAGG + Intronic
1084621056 11:70270624-70270646 GCTCCTCGGGCCCCGCCCCCGGG + Intergenic
1088502990 11:110501719-110501741 GCTTCTCTGACCCCCAAACTAGG - Intergenic
1089310997 11:117558058-117558080 TCTCCTCTGATCCTGCCACCAGG - Intronic
1089800654 11:121024280-121024302 GCTCCACTCACCCCTCAGCCCGG - Exonic
1091237737 11:134033157-134033179 GCTCCTCTGACCCAAAAACCAGG - Intergenic
1092122913 12:6057068-6057090 GCTCCTCTCGCCCCACAGCCAGG - Exonic
1093544416 12:20329437-20329459 GCACCTGTGATCCCGCAACTTGG - Intergenic
1096230374 12:49893441-49893463 GCTCCTCTGACTTCCCACCCAGG + Intronic
1096490139 12:52008617-52008639 GCACCTCTGACCCCACATTCTGG + Intronic
1096834255 12:54338861-54338883 CCTCCTCTGCCCCCGCAAACAGG + Intronic
1097062227 12:56293963-56293985 GCTCCTCTCTCCCCAGAACCAGG + Intronic
1104634101 12:130426988-130427010 GCTCCTCCGTCCCCGCTCCCAGG - Intronic
1104952934 12:132450589-132450611 GCTCAGCTCACCCCGCAAGCAGG - Intergenic
1105896190 13:24718878-24718900 GCGCCTCTGACCCTGCACGCGGG + Intergenic
1105927681 13:25021926-25021948 GCTCCTGTGACCCCTCACCGTGG + Intergenic
1110611615 13:77494335-77494357 GCTCCTCTGAATCCACCACCTGG + Intergenic
1112376307 13:98844725-98844747 ACACCTCTGACCCAGCAACGTGG - Intronic
1118760896 14:68879634-68879656 GCTCCTCTGTCTCCACAGCCAGG + Intronic
1118815941 14:69313888-69313910 TCTCCTCTGACCCCGTTCCCAGG - Intronic
1119881577 14:78103962-78103984 GCCCCTCTGACCACTGAACCAGG + Intergenic
1122366683 14:101198593-101198615 GCTCCTCTGTGCCCCCAGCCTGG + Intergenic
1125551806 15:40550741-40550763 GCTCCTCTCACACCGCACCCAGG + Intronic
1128453920 15:67822378-67822400 GCCCCTCTTAGCCCGCACCCAGG - Intronic
1129107683 15:73320701-73320723 GTCCCTCTGACCCCTCAGCCTGG + Exonic
1129153516 15:73703637-73703659 GCCCCTCTGACCCCGCCCCCAGG + Exonic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1131968501 15:97870100-97870122 GCCCCTCTGACCTCTCATCCTGG + Intergenic
1132664521 16:1075584-1075606 GCTCCTCTGTCCCCTCCACCTGG + Intergenic
1132977569 16:2718260-2718282 GCTCCCCTCACCCCACAATCTGG + Intronic
1137442883 16:48511146-48511168 GCTCCTCTGGCCCAGCATCAGGG - Intergenic
1138179242 16:54931068-54931090 GCTCCTCTGGCCCCGGCTCCGGG - Exonic
1139844621 16:69911415-69911437 CCTCCACTGTCCCCCCAACCTGG - Intronic
1142795450 17:2303641-2303663 GCTACTCTGGCCCCGCAGGCCGG - Exonic
1144774533 17:17778611-17778633 GCTCCTCTCACCCCTGAAACCGG + Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145253826 17:21311936-21311958 GCTCCTCCGACCCAGCCAGCAGG - Intronic
1145322764 17:21776024-21776046 GCTCCTCTGACCCAGCCAGCAGG + Intergenic
1146002626 17:29140311-29140333 GTCCCTCTGACCCCCCACCCCGG - Intronic
1147250417 17:39149858-39149880 GCTCCTTTGAATCCTCAACCTGG - Intronic
1153672822 18:7428758-7428780 GGTCCTCTGACCCTGCTGCCTGG + Intergenic
1160071800 18:75635429-75635451 GCTCCTCTGCCCCCAGAAGCTGG - Intergenic
1160863834 19:1248788-1248810 GCCCCTCCCACCCCGCACCCCGG - Intronic
1163272746 19:16263846-16263868 GTTCCTCTAGCCCAGCAACCAGG - Intergenic
1163580428 19:18135609-18135631 CCTCCTCTGCCCCTGCAACGTGG - Intronic
1165716101 19:38046715-38046737 GCTCCTCTGACCCCGCAACCCGG + Intronic
1166382469 19:42362181-42362203 CATCCTCGGACCCTGCAACCTGG + Exonic
1167369343 19:49071606-49071628 CCTCCTCTGGCCCCTCAACCTGG + Intronic
1167917623 19:52755011-52755033 GCTCCGGTGACCCTTCAACCTGG + Intergenic
926114566 2:10204276-10204298 GCTCCTCTGATCCCACAGGCTGG - Intronic
927811034 2:26180226-26180248 GCTCCTCTAACCCTGCACCATGG + Intronic
927859195 2:26549926-26549948 GCTCCTCTGTCACCGTAACAGGG - Intronic
927991096 2:27447657-27447679 ACTCCTCTGACCCCTGAGCCAGG - Intronic
929847261 2:45542437-45542459 GCTCCTCTGCCCCACTAACCTGG + Intronic
932610051 2:73192061-73192083 GGCCCTCTGACCCTGCAAGCTGG + Intergenic
937846185 2:126581738-126581760 CCTCCCCTGACCCCGCCAACAGG - Intergenic
938899693 2:135789596-135789618 GCTTCCCTGACCCCGCTACAGGG - Exonic
940144898 2:150535586-150535608 CCTTCTGTGACCCCACAACCTGG - Intronic
942209674 2:173658058-173658080 GCTCCACTGACCCCTCAGCTAGG + Intergenic
1169266040 20:4167869-4167891 GCTCCTCCCACCCCTCAACCAGG - Intronic
1172032715 20:31993047-31993069 GATTCTCTGACCCCGCTGCCTGG - Intronic
1172057985 20:32167442-32167464 GCTCTTCTGATCCCACAAGCAGG + Intergenic
1172298031 20:33827570-33827592 GCTCCCCTGATCCTGCATCCAGG + Intronic
1174500063 20:50977734-50977756 GCTCCTCAGACCCAGTGACCTGG - Intergenic
1175633022 20:60557921-60557943 GCTCCCCTAACCCCACAACAGGG + Intergenic
1176145490 20:63563535-63563557 GCTGCTCTTCCCCAGCAACCGGG - Exonic
1179408406 21:41143685-41143707 GCGCCTCTGACCCTGGCACCTGG - Intergenic
1179812304 21:43879916-43879938 GCTCCCGTGTCCCCGCATCCTGG + Intronic
1179880399 21:44291219-44291241 GCACCTCTGCCAGCGCAACCAGG + Intronic
1182547417 22:31084221-31084243 GCTCCTCTGGCCCCTCCTCCAGG - Intronic
1184432714 22:44450706-44450728 GCTCCTGTCATCCCGCAGCCTGG - Intergenic
1185041653 22:48507399-48507421 GCTCCTGTGAACCCCCAACCCGG + Intronic
1185173191 22:49305235-49305257 GCCCCTCTGCCCCCTCAGCCAGG + Intergenic
950777312 3:15361932-15361954 GCTCCTCTGAGCCCACACACAGG + Intergenic
953250995 3:41245794-41245816 GCCCCTCTGACACAGTAACCTGG - Intronic
953398440 3:42591088-42591110 GCCCATCTCACCCCGCACCCCGG - Intronic
953998857 3:47540778-47540800 GCGCCACTGACACCGCACCCTGG + Intergenic
960788386 3:121399318-121399340 GCTCCAGTGACCCTTCAACCTGG + Intronic
962245502 3:133787979-133788001 GCTCCTCTGCACCACCAACCTGG - Intronic
963939701 3:151086323-151086345 GCCCCGCAGACCCCGCCACCTGG - Intronic
967041770 3:185700086-185700108 GTACCTCTGACCCCGCAAGGTGG - Intronic
968446154 4:653338-653360 GCAGCGCTGACCCAGCAACCAGG + Intronic
968547516 4:1206428-1206450 GGCCCTCTGGCCCCACAACCTGG - Intronic
968622572 4:1610494-1610516 GCTGCTCTGGCCCCGAAAACAGG - Intergenic
968870841 4:3241389-3241411 GCTCCTCTGGGCCTGCAAACAGG - Exonic
978271155 4:106892839-106892861 TCCCCTCCCACCCCGCAACCGGG + Intergenic
989260745 5:39417146-39417168 CCTCCCCTTACCCCCCAACCAGG - Intronic
993405816 5:87510871-87510893 GCTCCAGTGACCCTTCAACCTGG - Intergenic
994107259 5:95961487-95961509 GCTCCGCCGGCCCCGCACCCGGG + Intronic
996567177 5:124892488-124892510 GCTCCGCAGGCCCCGCACCCGGG + Intergenic
996717760 5:126601245-126601267 GCCCCTCGGCCCCCGCAGCCCGG - Intronic
997415827 5:133727833-133727855 GCTCCCCTGACGCTGCATCCTGG - Intergenic
997825181 5:137099945-137099967 GCTCCTCTCTCCCTACAACCAGG + Intronic
998047943 5:139004971-139004993 ACTCCCCTGCCCCAGCAACCTGG - Intronic
999385125 5:151148721-151148743 GATCCTCTGACCCCTCCACCTGG - Intronic
1002773479 6:308885-308907 GCTCATCTGACCCACCCACCTGG - Intronic
1005278960 6:24250278-24250300 TCTCCTTTGGCCCTGCAACCTGG - Intronic
1005348994 6:24915940-24915962 GCTCTTCTCACCCTGCATCCAGG + Intronic
1006984461 6:38167746-38167768 TCTCCTGTGACCCCACAACTGGG - Intergenic
1007987747 6:46224192-46224214 CCTCCTCTTACCCCACCACCTGG - Intronic
1013624214 6:111920723-111920745 GCTCCCCTGACCCCGAATCCAGG - Intergenic
1015994133 6:138980540-138980562 CCTCCCCTGACCCCCCATCCAGG + Intronic
1016911407 6:149202734-149202756 GCTCCTCTGAGCCCACAGCTAGG + Intergenic
1018919514 6:168161550-168161572 GCTCCCCTTACCCCCCAGCCTGG + Intergenic
1019853354 7:3581507-3581529 GCTCCCCTTTCCCCACAACCTGG - Intronic
1026552874 7:71382619-71382641 GAGCCTCTGACCCCACACCCAGG - Intronic
1032195029 7:129783483-129783505 CATCCTCCGACCCCGCAGCCGGG - Intergenic
1040528968 8:48249956-48249978 GCTCCAGTGACCCTTCAACCTGG + Intergenic
1046828373 8:118716930-118716952 GCTCTTTTGACTCTGCAACCTGG + Intergenic
1049812408 8:144581432-144581454 GCTCCTGAGCACCCGCAACCGGG + Intronic
1049857434 8:144871591-144871613 GCTCCAGTGACCCTTCAACCTGG - Intergenic
1052603353 9:30668904-30668926 GCCCCTCTCACCCCGGAACTGGG - Intergenic
1053364427 9:37512498-37512520 GCTCCTCTGAGCACCCATCCAGG + Exonic
1057429415 9:94980248-94980270 GGTCCTCTGACCGCGCATCTGGG - Intronic
1060201027 9:121651846-121651868 GCTCCTCTGTCGCTGCAGCCGGG - Intronic
1060230440 9:121821663-121821685 GCTCCCCTGACCCTGGCACCAGG + Intergenic
1060700495 9:125746608-125746630 GCTCCTCAGACCCCGCCCCCGGG - Intergenic
1061087219 9:128406095-128406117 GCTCCTCTGGCCCCACAGCCAGG + Intergenic
1061293721 9:129666180-129666202 GCTCCCCGGACCCCGCGCCCCGG - Intronic
1061860007 9:133463207-133463229 GCTCCTCTGAGCCCTGAAACGGG + Intronic
1061897002 9:133653458-133653480 GCACCTCTGCCTCCTCAACCTGG - Intronic
1062370041 9:136234008-136234030 CCTCCTCTGCCGCTGCAACCTGG + Intronic
1188137277 X:26505113-26505135 CCTCCTCTGCCCCCTCTACCTGG + Intergenic
1195165451 X:102215269-102215291 GCCCCTCTGCCTCCCCAACCTGG - Intergenic
1195193407 X:102471822-102471844 GCCCCTCTGCCTCCCCAACCTGG + Intergenic
1198806657 X:140501375-140501397 TCTCCCCTGGCCCCTCAACCCGG - Intergenic
1199265262 X:145820626-145820648 GCTCCCCTGCCCCTGCAGCCTGG + Exonic