ID: 1165717748

View in Genome Browser
Species Human (GRCh38)
Location 19:38057517-38057539
Sequence ACTCCTGGTGTTGCTCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165717745_1165717748 5 Left 1165717745 19:38057489-38057511 CCTAGGGGTTGATAATTTCTTTA 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG 0: 1
1: 0
2: 1
3: 12
4: 103
1165717741_1165717748 23 Left 1165717741 19:38057471-38057493 CCTATAGATGTTTACTGTCCTAG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG 0: 1
1: 0
2: 1
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165717748 Original CRISPR ACTCCTGGTGTTGCTCATTG AGG Intronic
900022772 1:196078-196100 ACTCCTGGAATTGCACAGTGAGG + Intergenic
900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG + Exonic
901315223 1:8302579-8302601 ACTCCCGGCGTTACTCACTGTGG - Intergenic
904968914 1:34403500-34403522 ACTCCAGGTGTGGCTCAAGGGGG - Intergenic
907030505 1:51166417-51166439 TCTTCTGATGTTCCTCATTGAGG + Intergenic
908341900 1:63189933-63189955 CCCCCTGGTGTTGTTCAATGTGG - Intergenic
913333540 1:117686838-117686860 ATTCCTTGTTTTGCTTATTGAGG - Intergenic
915591486 1:156873603-156873625 CCTCCTGCTGTTGCTCTTTCTGG + Intronic
917835997 1:178942022-178942044 CCTCCAGCTGTTGCTCATGGTGG - Intergenic
922386172 1:225086084-225086106 ACACGTGGGGTTGCTCAGTGAGG - Intronic
922740390 1:228011059-228011081 AGTCCTGGTGGGCCTCATTGTGG + Intronic
1063216034 10:3926427-3926449 ACTGTTGGTGTTGTTCTTTGTGG + Intergenic
1064816412 10:19270022-19270044 ACTGCTGGTTTTGCTGAGTGTGG + Intronic
1070443811 10:76474408-76474430 ACTCCTGATGATGTTCTTTGAGG - Intronic
1074616076 10:115069451-115069473 ACTCATGCTGTTTTTCATTGGGG + Intergenic
1077184231 11:1229183-1229205 ACTCCTGGTGCTGCATGTTGAGG - Exonic
1077587476 11:3464810-3464832 CCTCCTGGTGTTATTCGTTGTGG - Intergenic
1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG + Intergenic
1088307036 11:108421732-108421754 ATTCCTGGTGTGGCTTTTTGGGG - Intronic
1089316422 11:117594233-117594255 TCTCCTGTTGTTTCTCAGTGGGG + Intronic
1091094305 11:132804445-132804467 ACTGCTTGTCTTGCTCAGTGGGG - Intronic
1091376470 12:27616-27638 ACTCCTGGAATTGCACAGTGAGG + Intergenic
1092413722 12:8273563-8273585 CCTCCTGGTGTTATTCATTGTGG - Intergenic
1093436870 12:19145643-19145665 ACTCCTGTTGTTGGACATCGAGG + Intronic
1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG + Intronic
1104750662 12:131236114-131236136 AGTCCTGGTGGTCCTCAGTGAGG - Intergenic
1104782061 12:131428346-131428368 AGTCCTGGTGGTCCTCAGTGAGG + Intergenic
1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG + Exonic
1107348880 13:39493056-39493078 ACTCCTGCTGTTGGTCATTCAGG + Intronic
1117619752 14:57573305-57573327 ACTCCTGCTGTTTTTCATTAAGG - Intronic
1118014139 14:61641058-61641080 ACTACTTGTGTTTCTCCTTGTGG + Intronic
1119407722 14:74409277-74409299 TCTCCTTGTGTTGCTCATGCTGG + Intronic
1122802124 14:104236682-104236704 ACTCCTGGTGCTGCCCTGTGTGG - Intergenic
1124687980 15:31798618-31798640 ACTCCTGGTTATCCTCAGTGAGG - Intronic
1128212758 15:65913857-65913879 GCTCCTGTTATTCCTCATTGTGG - Exonic
1132095942 15:98984966-98984988 ATTCCTGGTAGTGCTCCTTGCGG + Intronic
1135028920 16:19021672-19021694 ATTCCTGGTGTTGCTGAATTTGG + Exonic
1137264042 16:46854138-46854160 ACTGGTGTTGTTGCTCACTGAGG + Intergenic
1138311668 16:56029055-56029077 ATACCTGGTGTCTCTCATTGAGG - Intergenic
1140354859 16:74296950-74296972 CCCCCTGGTGCTGCTCAGTGTGG + Exonic
1140474228 16:75230746-75230768 CCTATTGGTTTTGCTCATTGTGG - Intronic
1141377348 16:83543891-83543913 AGTCTTGGTCTTGCCCATTGAGG - Intronic
1147149729 17:38507740-38507762 CCTTCTGGTGTTGTGCATTGTGG + Intronic
1148991541 17:51670672-51670694 AGTGGTGGTGTTACTCATTGTGG - Intronic
1149440056 17:56666334-56666356 ACTCCATGTGTTTCTCATTGGGG - Intergenic
1149980582 17:61308169-61308191 ACTCCTGGTGTTGTTGTTTATGG + Intronic
1151500519 17:74485426-74485448 ACTCCTGGAGTTGTGCAATGTGG + Intergenic
1161171893 19:2816268-2816290 TCAGCCGGTGTTGCTCATTGGGG - Intergenic
1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
925807107 2:7661285-7661307 ACTCCATGTGATGCTCATTGTGG - Intergenic
926053473 2:9759459-9759481 ACCCCTGGTTTTGCCCCTTGTGG - Intergenic
927021568 2:19022386-19022408 AATCCAGGTGTTGTTCTTTGAGG + Intergenic
927101063 2:19788216-19788238 ACTCCTGGTGCTGGGCATGGTGG + Intergenic
936566675 2:113587866-113587888 ACTCCTGGAATTGCACAGTGAGG - Intergenic
937671847 2:124546560-124546582 ACCCCTTGGGCTGCTCATTGTGG + Intronic
937736061 2:125291624-125291646 ACTGCTGGTGCTGCTAATGGTGG - Intergenic
940347476 2:152642601-152642623 GCTCCTGGTCTTGCTCAGGGTGG - Intronic
947058195 2:226131845-226131867 ATTGCTGGTGTTGCTGAATGGGG - Intergenic
948752622 2:240141303-240141325 CCTCCTGGTCCTGCTCCTTGGGG + Intronic
1181581005 22:23827980-23828002 ACTCCTGGTCTAGCTCTCTGTGG - Intronic
1181833119 22:25578992-25579014 ACTGCTGGTGGTGATCAATGAGG - Intronic
1183854749 22:40623903-40623925 TCTCTTTGTGTTGCCCATTGTGG - Intronic
950400023 3:12762785-12762807 ACTCCTGGAGTTTCTGATTCAGG - Intronic
950515015 3:13459470-13459492 TCTCTTGGTGTTGGTCATTCTGG - Intergenic
950543270 3:13624846-13624868 CCTCCTGGTGCTGCACCTTGTGG - Intronic
950866419 3:16192994-16193016 ATTCCTGGTTTTGCTCATTGTGG + Intronic
957058757 3:75464414-75464436 CCTCCTGGTGTTATTCACTGTGG - Intergenic
957447683 3:80336630-80336652 ACTCCTGTTGTTTATGATTGTGG + Intergenic
957745093 3:84330345-84330367 ACTCCTGGTGTAGCTATTTTTGG + Intergenic
958069104 3:88586235-88586257 TCTCTTGGTGTTTCTCACTGTGG - Intergenic
958621320 3:96566313-96566335 AATCCTGGAGTTGAGCATTGTGG - Intergenic
958809543 3:98844732-98844754 ACTGCTGGTGTTACTGAGTGAGG - Intronic
961294686 3:125875286-125875308 CCTCCTGGTGTTATTCATTGTGG + Intergenic
961891275 3:130132195-130132217 CCTCCTGGTGTTATTCATTGTGG - Intergenic
962897005 3:139724613-139724635 AGACCTGGTGGTGTTCATTGCGG + Intergenic
964087673 3:152836298-152836320 CGTGCTGGTGTGGCTCATTGTGG + Exonic
969002667 4:3994636-3994658 CCTCCTGGTGTTATTCATTGTGG - Intergenic
969751355 4:9113892-9113914 CCTCCTGGTGTTATTCATTGTGG + Intergenic
969811264 4:9650176-9650198 CCTCCTGGTGTTATTCATTGTGG + Intergenic
971075130 4:23139333-23139355 ACTCCAGGTGTGCCTCGTTGAGG + Intergenic
972463648 4:39330537-39330559 ACTCCTGGTCTAGCTGATTGTGG - Intronic
977646511 4:99418729-99418751 ACTACTGGTGTCTCTCATTCAGG + Intronic
979495413 4:121377711-121377733 AATCCTGTTTTTGCTCATTTTGG + Intronic
979669367 4:123346097-123346119 AATGCTGGAGTTGCTTATTGTGG + Intergenic
981920368 4:150079023-150079045 ACTCCTGGTGCTGGCCATCGCGG - Exonic
985104820 4:186489989-186490011 ACTCCTGGTTTTGATCAGTCAGG + Intronic
995287559 5:110408706-110408728 ACTCCTGATGTTACTTATTTGGG - Intronic
999218959 5:149959503-149959525 ACTCCTGATGCTGCCCCTTGTGG - Intergenic
1002278371 5:178117227-178117249 ACTCCTGTTGCTGCTTCTTGGGG - Intronic
1011327952 6:86171879-86171901 ACTCCTAGTGCTGCTTATAGGGG - Intergenic
1020321613 7:6942757-6942779 CCTCCTGGTGTTATTCATTGTGG - Intergenic
1023272532 7:38480264-38480286 ACTCCTGGCGCTGGTCACTGGGG - Intronic
1023301844 7:38781416-38781438 TATCTTGGTGTTGCTCATTATGG + Intronic
1026381059 7:69799791-69799813 CCTCCTGGTGCTGTTCCTTGAGG + Intronic
1032282243 7:130513450-130513472 TCTTCTGGTGTTCCTCATTCTGG - Intronic
1036374561 8:8189306-8189328 CCTCCTGGTGTTATTCACTGTGG + Intergenic
1036854981 8:12233841-12233863 CCTCCTGGTGTTATTCACTGTGG - Intergenic
1036876340 8:12476329-12476351 CCTCCTGGTGTTATTCACTGTGG - Intergenic
1038454753 8:27665849-27665871 GCTCCTTGTGTTACTCATCGAGG + Intronic
1044099462 8:88115273-88115295 ACTCATATTGTTACTCATTGTGG - Intronic
1051812913 9:21070509-21070531 ACTCCTGGTTTTGCTCCAAGTGG - Intergenic
1053157945 9:35792993-35793015 ACACCTGGTGCTGCACACTGAGG - Exonic
1054745225 9:68847386-68847408 ACTGCTGTTGTTGCTGATTTAGG - Intronic
1055753109 9:79528794-79528816 ACTCCTTGAGTTCCTCACTGTGG + Intergenic
1056713522 9:89010372-89010394 TCTCATGGGGGTGCTCATTGTGG - Intergenic
1058324019 9:103672581-103672603 ACTCCTGGAGTTTCTGATTCAGG + Intergenic
1186870665 X:13768191-13768213 ACTCCTGGTCTTGCTCCTGCTGG - Exonic
1186976817 X:14916467-14916489 AGACCTGGTGTTGCTCAAGGAGG + Intronic
1187062306 X:15798863-15798885 ACTCCCGGTGATGCTAACTGTGG + Intronic
1187807581 X:23137785-23137807 TCTCCTTGTGTTGTTGATTGAGG - Intergenic
1191682141 X:63851977-63851999 ACTCCTGTTATTGGTCACTGAGG + Intergenic
1193087473 X:77459817-77459839 ACTCTTGGTGTTGAACTTTGAGG + Intergenic
1196459360 X:115913876-115913898 AGTCTTGGTGTTTGTCATTGTGG - Intergenic
1197964894 X:132049652-132049674 ACTCCTGGTGTTCCCACTTGAGG + Intergenic
1198836251 X:140807580-140807602 ACTCCTGTTGTTTCTCACTCTGG + Intergenic