ID: 1165719394

View in Genome Browser
Species Human (GRCh38)
Location 19:38068322-38068344
Sequence AAGAATCTGATTTTTCGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165719394_1165719397 13 Left 1165719394 19:38068322-38068344 CCCGGCCGAAAAATCAGATTCTT 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1165719397 19:38068358-38068380 CTGAGCTGTTGCTGACTTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165719394 Original CRISPR AAGAATCTGATTTTTCGGCC GGG (reversed) Intronic
900275403 1:1822945-1822967 AAAATTCTGATTTCTAGGCCGGG + Intronic
900330378 1:2131307-2131329 AAAAATCTGATTTGAAGGCCGGG + Intronic
900591161 1:3460632-3460654 AAGAAATGGATTTCTCGGCCGGG + Intronic
900663485 1:3798143-3798165 TAGAATTTTATTTTTTGGCCAGG - Intergenic
903229982 1:21915752-21915774 AAGAAACTGAATTTTTTGCCGGG + Intronic
905191749 1:36240909-36240931 AAGATTTTTACTTTTCGGCCGGG + Intronic
905675119 1:39819394-39819416 AGGAATCTGACTTCTGGGCCAGG - Intergenic
906406974 1:45550055-45550077 AAGAATATTCCTTTTCGGCCAGG + Intergenic
907232519 1:53013288-53013310 AAAAATTTTATTTTTAGGCCGGG + Intronic
909853200 1:80495584-80495606 AAAAAGCAGATTTTTGGGCCGGG - Intergenic
910193730 1:84620505-84620527 AAAAATCAGTTCTTTCGGCCGGG - Intergenic
912986907 1:114442858-114442880 AAGAATCTTATATTATGGCCTGG - Intronic
916067593 1:161148920-161148942 AATAAGGTGATTTTCCGGCCCGG + Intergenic
916504700 1:165417805-165417827 TAGAAGCTGATTTTGCAGCCGGG + Intronic
917620142 1:176787227-176787249 AAAAATCTGATTTTTATGACTGG - Intronic
917798531 1:178549985-178550007 AAGAATCTGATGTTGCGGAAGGG + Intergenic
917825674 1:178818062-178818084 GAGAAGCTGATTTTTCTGGCTGG + Intronic
918316003 1:183323225-183323247 AAGAATCTAGTTTTGTGGCCAGG - Intronic
918534359 1:185557895-185557917 AAAACTCTGGTTTTTCCGCCGGG + Intergenic
919215578 1:194549208-194549230 TAAAATCTTATTTTTTGGCCAGG - Intergenic
919651704 1:200155966-200155988 GAAAATTTGATTTTTGGGCCAGG - Intronic
920151949 1:203917351-203917373 AAAAATACGATTTTTAGGCCGGG + Intergenic
920165856 1:204035380-204035402 AAGAATTTTTTTTTTTGGCCAGG - Intergenic
923187327 1:231586867-231586889 AAAAAACTAATTTTTAGGCCTGG + Intronic
923450524 1:234112868-234112890 AAGAATGTGAATTATAGGCCGGG - Intronic
923451440 1:234121431-234121453 AAGAAAGTAATTTTTCGGCTGGG - Intronic
923721987 1:236474835-236474857 AATAATCTCATTTTTTGGCTGGG + Intronic
924518272 1:244783861-244783883 AAGAAACTGAGGTTTAGGCCAGG - Intergenic
1063228205 10:4036019-4036041 AAGAATGCCATTTTTAGGCCAGG + Intergenic
1063647338 10:7898249-7898271 AAGAATCTAACTCTTAGGCCGGG + Intronic
1065508213 10:26450989-26451011 CAGAATCTGAGTTCTAGGCCAGG - Intronic
1065976117 10:30843967-30843989 AAGAAAATGATTTTGCAGCCAGG + Intronic
1066317206 10:34259832-34259854 CAGAATCTCATTTATCGCCCAGG + Intronic
1066641132 10:37555388-37555410 AAGAAACTGCATTTTGGGCCAGG + Intergenic
1067691000 10:48502294-48502316 AGGACTCTGATTTTTCTCCCAGG + Intronic
1068289136 10:54979371-54979393 AAGAATTTTATTTTCCTGCCAGG + Intronic
1068844191 10:61652766-61652788 AATAATCTGTTTTCTCGGCCGGG - Intergenic
1070258740 10:74832827-74832849 AAAAATCACATTTTTTGGCCGGG + Intronic
1070571741 10:77645062-77645084 AAGAATGTGATTTTTTTTCCTGG - Intergenic
1070943075 10:80363641-80363663 AAAAATCAGATTTTTTGGCTGGG - Intronic
1071581708 10:86777716-86777738 AAAAATTTTATTTTTAGGCCAGG + Intronic
1072698742 10:97624029-97624051 AAGAATCCCATCTTGCGGCCAGG - Intronic
1072939246 10:99745044-99745066 AACTACCTGATTTTTTGGCCAGG - Intronic
1072969398 10:100003934-100003956 AAAAATATAATTTTTTGGCCAGG + Intronic
1073547022 10:104358774-104358796 AAGAAAATGATTTTTTAGCCTGG + Intronic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1075720299 10:124581805-124581827 CAGATTCTGCTTTGTCGGCCAGG + Intronic
1078470882 11:11585649-11585671 ATGAAAAAGATTTTTCGGCCGGG - Intronic
1079322385 11:19462102-19462124 AAGAAATTTATTTTTCGGCTGGG - Intronic
1080481493 11:32655970-32655992 AAGAATCTGATTTTCGGTCTCGG + Intronic
1081905395 11:46666166-46666188 AAGAATCTGATATATCTGCTGGG + Intronic
1081987366 11:47315768-47315790 AACAATCTGATAATTTGGCCGGG - Intronic
1083745223 11:64732218-64732240 AAGATGGTGATTTTTAGGCCGGG + Intronic
1086483999 11:87277424-87277446 AAAAATCTTGTTTTTGGGCCAGG - Intronic
1087993170 11:104770969-104770991 AAGAATTTGATTTATAGTCCTGG - Intergenic
1088120469 11:106362905-106362927 AAGAATGTCATTTTATGGCCAGG - Intergenic
1090864939 11:130691382-130691404 AAGAAACTGACTTTTGGGGCCGG - Intronic
1091056785 11:132426725-132426747 AAAAATCTAATGTTTAGGCCAGG - Intronic
1093507698 12:19887965-19887987 AAGATTTTGATTTCTGGGCCAGG + Intergenic
1094126397 12:27027220-27027242 AAGATTCTAATGATTCGGCCAGG - Intronic
1094725702 12:33113119-33113141 AAGAATAATGTTTTTCGGCCTGG - Intergenic
1095144899 12:38714917-38714939 AAGGAACTTATTTTTAGGCCTGG - Intronic
1095936228 12:47685081-47685103 AAAAATCAGATATTTTGGCCGGG + Intronic
1096382886 12:51173572-51173594 AAAAATGTGGTTTTTAGGCCGGG + Intergenic
1097634432 12:62105324-62105346 AAGAATTTGCTTTTTCCCCCTGG - Intronic
1097795679 12:63858996-63859018 AAAAATATAATTTATCGGCCAGG - Intronic
1098026368 12:66207173-66207195 AAAAATCTTCTATTTCGGCCAGG + Intronic
1098190737 12:67945725-67945747 AAGAAGCTGGATTTTTGGCCGGG - Intergenic
1098359447 12:69640643-69640665 AAGAATATGAGCTTTGGGCCGGG - Intergenic
1098746321 12:74241835-74241857 GAGAATGTACTTTTTCGGCCGGG + Intergenic
1099087636 12:78264879-78264901 CAGGATCTGATGTTTCAGCCAGG - Intergenic
1099092164 12:78325871-78325893 AAGATTCTGATGTTTAGGCTGGG + Intergenic
1099161231 12:79244178-79244200 AAGCATCTTAATTTTTGGCCAGG - Intronic
1100854799 12:98749400-98749422 AAAAATCTAAGTTTTGGGCCGGG - Intronic
1101091323 12:101289079-101289101 AAGAATCTGATGAATAGGCCAGG + Intronic
1103070866 12:117940788-117940810 AAGATTTTGATTTTTGAGCCAGG + Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103635525 12:122302058-122302080 AGAAATTTGATTTTTCCGCCTGG + Intronic
1104036849 12:125103691-125103713 AAGAATCTTCATTTTTGGCCAGG + Intronic
1105723393 13:23137882-23137904 AAGAATATCATTTTTCTGGCTGG - Intergenic
1105916317 13:24920065-24920087 TAGAAACTGATTTTTAGGCTGGG - Intronic
1106286863 13:28325517-28325539 AAGATTCTAATTATTAGGCCGGG + Intronic
1106750496 13:32760248-32760270 AAGAATATGCTTTTTTGGCCGGG - Intronic
1107895259 13:44955846-44955868 AAGAATCTCATATTTTGGCCGGG + Intronic
1109801297 13:67381785-67381807 AAGAATATGATGATTGGGCCGGG + Intergenic
1109966051 13:69698059-69698081 TAAAAACTGATTTTTTGGCCGGG + Intergenic
1110096424 13:71528674-71528696 TAAAATCTGTTTTTCCGGCCCGG - Intronic
1110250931 13:73379700-73379722 AAGAAACTGATTTTTTGGCTGGG + Intergenic
1110343788 13:74422952-74422974 AAGAATCAGATTTGTCAGCCTGG - Intergenic
1110534423 13:76634719-76634741 AAGAATCTGAGATTTGAGCCTGG - Intergenic
1111802585 13:92998574-92998596 AAAAATAGGATTTTTAGGCCAGG - Intergenic
1112220626 13:97486327-97486349 AAGAATTTGGCTTTTAGGCCAGG - Intergenic
1112982649 13:105404916-105404938 AAGCATCTGATTTTTAGGGAGGG - Intergenic
1113054197 13:106250669-106250691 GAAAATCTGATTTTGTGGCCAGG + Intergenic
1113255273 13:108498680-108498702 AATCATCTGCTTTTACGGCCTGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1116780280 14:49229178-49229200 AAGAATCTGCATTTTTGACCAGG + Intergenic
1116892776 14:50284950-50284972 AAGATTTTCATTTTGCGGCCGGG + Intronic
1117366819 14:55037430-55037452 AAAAATATGATTGTTAGGCCAGG - Intronic
1117715556 14:58576385-58576407 AAGAATGTCATTTTTAGGACAGG - Intergenic
1118189670 14:63569005-63569027 AAGAAAGTGTTTTTACGGCCGGG - Intergenic
1118880022 14:69817979-69818001 AAGAATTTGGATTTTAGGCCGGG - Intergenic
1120164392 14:81180592-81180614 AAGAAACCAATTTTTAGGCCAGG - Intronic
1120554124 14:85907876-85907898 AATAATCTGATTTTTATGGCAGG - Intergenic
1120976281 14:90251103-90251125 TAAAATTTAATTTTTCGGCCGGG - Intergenic
1121589225 14:95088319-95088341 AACAATCTGATTTTGGTGCCAGG + Exonic
1125250087 15:37691456-37691478 AAAAAGCTGAGTTTTTGGCCAGG + Intergenic
1125545882 15:40504610-40504632 AAAAACTTGATTTTTCGACCGGG + Intergenic
1125841548 15:42805966-42805988 AAGACACTGATTTTTAGGCCAGG + Intronic
1127199927 15:56634184-56634206 AAGATTCTGATTTTTACACCAGG + Intronic
1128125283 15:65187705-65187727 AAAAATCTCACTTCTCGGCCAGG + Intergenic
1128915336 15:71555083-71555105 AAGAATATGCTATTTGGGCCAGG + Intronic
1128962473 15:72022224-72022246 AAAAATCAAATTTTTTGGCCAGG + Intronic
1128974913 15:72144769-72144791 CAGAACTTGATTTTTCCGCCAGG - Intergenic
1128989154 15:72244245-72244267 AACAATCTGATTTCTCTGGCAGG + Intronic
1129086755 15:73102071-73102093 CAGAATCTGAATTTTAGTCCAGG + Intronic
1129494729 15:75967755-75967777 AAGAATCAGATTTTGCGGCCAGG - Intronic
1131624327 15:94101596-94101618 AAGAAACTTACTTGTCGGCCGGG + Intergenic
1131893503 15:97000265-97000287 AAGAATATGAGTTTTTGGCTTGG + Intergenic
1132268224 15:100498187-100498209 AACAATGTTATTTTTTGGCCGGG - Intronic
1133563882 16:6974638-6974660 AAGAATATGATTTATGGGCCAGG - Intronic
1135357851 16:21784808-21784830 AAAAATCTGGATTTTCAGCCAGG - Intergenic
1135456355 16:22600926-22600948 AAAAATCTGGATTTTCAGCCAGG - Intergenic
1135530501 16:23248991-23249013 AAAAATCTTATTTTTTGGCCAGG + Intergenic
1135557274 16:23447504-23447526 AAGAGTTTGATTTTAAGGCCAGG - Intronic
1135625355 16:23990161-23990183 AAGAAGCTTTTTTTTTGGCCAGG + Intronic
1138496951 16:57414691-57414713 AAGAATCTCTTTTTTCAGTCTGG - Intronic
1138959955 16:62017383-62017405 AAGAATATGACTTTCAGGCCGGG + Intronic
1139695872 16:68674435-68674457 AGGATTCTTCTTTTTCGGCCAGG + Intronic
1141496228 16:84411735-84411757 AAGAATTTAGTTTGTCGGCCGGG - Intronic
1142603043 17:1066322-1066344 AAGAATCTCAGTTTTCTGTCAGG + Intronic
1142750276 17:1983339-1983361 AAGAATGTGAGGTCTCGGCCAGG - Intronic
1145114372 17:20194797-20194819 AAGAATCTGTTTTCTTGGCTGGG - Intronic
1146251856 17:31353202-31353224 AAGAATCCTATCTTCCGGCCGGG - Intronic
1147888530 17:43700802-43700824 AAGAATATAATTATTAGGCCAGG + Intergenic
1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG + Intronic
1148573303 17:48688263-48688285 AAGAATCTGTTATATGGGCCAGG - Intergenic
1148852082 17:50560379-50560401 AAGAATCAGAGTATTCGGCGCGG - Intergenic
1150559229 17:66280696-66280718 AAGAATATTAATTTTTGGCCAGG - Intergenic
1152825341 17:82461314-82461336 AAGAATGTGATTTTACAGCCAGG + Intronic
1152834703 17:82521634-82521656 AAGAATGTTATTTTCAGGCCGGG + Intronic
1154259588 18:12818796-12818818 AAAAATATAAATTTTCGGCCGGG + Intronic
1155763986 18:29604839-29604861 ATTAATCTGATTTTTCTTCCCGG + Intergenic
1156875669 18:42007162-42007184 AAGAATATGATTTTTAAGGCCGG - Intronic
1156999157 18:43503629-43503651 AGGAGCCTGATTTTTCTGCCAGG - Intergenic
1157698210 18:49741752-49741774 TAAAATGTGAGTTTTCGGCCAGG + Intergenic
1158638126 18:59179172-59179194 CAGAAACTGATTTCTCAGCCAGG + Intergenic
1158954963 18:62528863-62528885 AAAAAGATGATTTTTTGGCCAGG + Intronic
1159783716 18:72689770-72689792 AAGAATCTGATTTTATGCTCAGG - Intergenic
1159814446 18:73055195-73055217 AAGAGACAGAGTTTTCGGCCGGG - Intergenic
1160104371 18:75958110-75958132 AAGACTCAGATTTTTCAGCCTGG + Intergenic
1161779836 19:6284457-6284479 AAAAATTTTATTTTTTGGCCAGG - Intergenic
1163156661 19:15443365-15443387 AAGAGTCTGGTTTTTAGGCCGGG - Intronic
1163574960 19:18105385-18105407 AAAAAACTGGTTTTTTGGCCAGG + Intronic
1163682808 19:18693093-18693115 AAGAAATTCATTTTTCGGCCGGG + Intronic
1164702988 19:30298964-30298986 AATAATCTGCATTTTAGGCCTGG + Intronic
1165611925 19:37162217-37162239 AAGAATCATACTTTTAGGCCGGG - Intronic
1165719394 19:38068322-38068344 AAGAATCTGATTTTTCGGCCGGG - Intronic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG + Intronic
927330343 2:21855269-21855291 AAGAATCTGAATTTCAGTCCAGG - Intergenic
927387670 2:22554266-22554288 AAGAATCAGATTTTTCTACTGGG - Intergenic
927684166 2:25159407-25159429 AAGAATCTGGCTTTCTGGCCAGG + Intergenic
928054669 2:28040593-28040615 AAGAATTCAGTTTTTCGGCCGGG - Intronic
929006200 2:37395246-37395268 AAGAGTCTGATGATTAGGCCAGG + Intergenic
929078009 2:38094571-38094593 AAGAGTGTGTTTTTTGGGCCGGG + Intronic
929811994 2:45197823-45197845 GAGAATCTGAATTATAGGCCCGG + Intergenic
930084241 2:47481862-47481884 AAGAATCTTATTTCACTGCCTGG + Intronic
930252201 2:49047373-49047395 AATAATCTGAGTTTTCCACCTGG + Intronic
930788758 2:55300804-55300826 AAGAAACCAATTTTTGGGCCAGG - Intronic
931787692 2:65635251-65635273 TAGAAAGTGATTTTTCGCCCAGG + Intergenic
933425691 2:82109542-82109564 AAGAATCTCAGCTTTTGGCCAGG - Intergenic
933700347 2:85250729-85250751 AAAAATCTCATTTTTCGGCTGGG - Intronic
934155276 2:89193509-89193531 AAGAATCTTCTTTTTCTGCTGGG - Intergenic
934212045 2:89989244-89989266 AAGAATCTTATTTTTCGGCTGGG + Intergenic
936436730 2:112514086-112514108 AAGAAACTCATTTTTAGGCCAGG + Intronic
938002674 2:127756784-127756806 AGAAATCTGAATCTTCGGCCAGG + Intronic
939147370 2:138432262-138432284 AAGAATCTAGGTTTTGGGCCAGG + Intergenic
939467776 2:142580702-142580724 AAGAGCCTGATTTGTCAGCCGGG - Intergenic
940294934 2:152112566-152112588 AAGAATTTGCATTTCCGGCCAGG - Intergenic
942684255 2:178514246-178514268 AAGACTTTGATTTTTCAGCTAGG + Exonic
943306843 2:186273411-186273433 AAGACACTCATTTTTCAGCCAGG + Intergenic
943590269 2:189787358-189787380 AAGCATTTGATTGTTCTGCCTGG + Intronic
943736462 2:191361243-191361265 AAGAATATGATTTTTCTGTTTGG + Intronic
944767221 2:202876640-202876662 AAAAATCTGTATTTTTGGCCAGG + Exonic
945085787 2:206130648-206130670 AAGAATGGGATTTTTTGGCCAGG - Intronic
947802553 2:232939700-232939722 AAGAATTTGGTGTCTCGGCCGGG + Intronic
948421239 2:237861550-237861572 AAGAATCTCATAATCCGGCCAGG + Intronic
948925548 2:241094531-241094553 AAGGAGCTGGTTTTTCAGCCGGG - Exonic
948925773 2:241096232-241096254 CAGAAGCTGAGTTTTTGGCCAGG - Exonic
1169462688 20:5809961-5809983 AAAAATTGGATTGTTCGGCCAGG + Intronic
1170079568 20:12457604-12457626 AAGCATCTGATTTTGCTGCTTGG - Intergenic
1171446695 20:25209403-25209425 AAGAATCCAACTTTACGGCCAGG - Intronic
1172414228 20:34751073-34751095 AAGAATGTGAAGTGTCGGCCGGG + Intronic
1172681751 20:36721233-36721255 AAGAAATAGATTTTTTGGCCTGG + Intronic
1172711178 20:36924861-36924883 AAAAATTAGATTTCTCGGCCGGG + Intronic
1173618371 20:44417674-44417696 AAGAATCTGTATTTTCAGGCCGG + Intronic
1173900543 20:46584427-46584449 AACAATCTGAGTTTCAGGCCAGG - Intronic
1174228472 20:49024266-49024288 AAGAATCTGATATGTAGGCCAGG - Intronic
1174587928 20:51623183-51623205 AAGAATATTATTTTTAGGACAGG - Intronic
1177079159 21:16616875-16616897 AAGATTCTGCTATTTTGGCCTGG - Intergenic
1177880433 21:26688012-26688034 AAGAATCTGAACTTTTGGGCAGG + Intergenic
1179525221 21:41971670-41971692 AAGACTCTGTTATTTTGGCCAGG + Intergenic
1183969553 22:41466693-41466715 AAAAATATGTTTTTTTGGCCAGG + Intronic
1184139070 22:42567367-42567389 AAAAGTTCGATTTTTCGGCCGGG + Intronic
950603845 3:14060353-14060375 AAAAATCTGTTTTTCAGGCCGGG + Intronic
950793415 3:15491762-15491784 AAGAAAGTGATTTATGGGCCAGG + Intronic
951589974 3:24254066-24254088 AAAAATCAGATTTACCGGCCGGG + Intronic
952088747 3:29858425-29858447 AAGAATCTTATTTATTGACCAGG - Intronic
955180149 3:56660155-56660177 AAGAATGTGATTATCAGGCCGGG - Intronic
955226819 3:57067154-57067176 AAGAATAACATTTGTCGGCCAGG + Intronic
956314217 3:67916075-67916097 AATAATTTGCTTTTTCTGCCTGG - Intergenic
956825500 3:72994126-72994148 AAGAATTGGATTTTTAGGCCAGG + Intronic
956856716 3:73282348-73282370 TAGAATCTAATTTGTTGGCCTGG + Intergenic
958464522 3:94442150-94442172 AAGAATGTGATCTTTCGGGATGG + Intergenic
959392408 3:105792614-105792636 AAGAATTTAATTTTTCTCCCAGG - Intronic
959980057 3:112506048-112506070 AAGAGTTTGAATTTTCAGCCTGG - Intergenic
960572896 3:119203045-119203067 AAAAATCTGATATCTAGGCCAGG + Intronic
960775997 3:121253946-121253968 AAGAATATTAATTTGCGGCCGGG - Intronic
963419984 3:145049834-145049856 AAGAATGTTAGTTTTTGGCCAGG - Intergenic
965103275 3:164329861-164329883 AAGAATCTGTTTTATGGGCCGGG - Intergenic
965536315 3:169827310-169827332 AAGAATGAGATTTTTTCGCCGGG + Intronic
965970948 3:174555593-174555615 AAAAAACTGAATTTTTGGCCAGG - Intronic
966424786 3:179769702-179769724 AAGAAACTCATTATTTGGCCAGG - Intronic
966601064 3:181775550-181775572 TAAAATTTGATTTTTCAGCCAGG - Intergenic
966759314 3:183402504-183402526 AAGAAAATGGTTTTTTGGCCAGG + Intronic
966831559 3:184014166-184014188 TAGAAACTTATTTTTTGGCCGGG - Intronic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
967468141 3:189831590-189831612 CAGACTCTGATTTTCTGGCCAGG + Intronic
967494132 3:190123860-190123882 AAGATTCTGATTTATTGGTCTGG + Intergenic
967687624 3:192436216-192436238 AAGTATCTAATTTTTGGCCCAGG - Intronic
968016996 3:195344813-195344835 AAGTACATGATTTTTGGGCCGGG - Intronic
969419824 4:7086432-7086454 AAGAATCTGTTTTCTGGGCTGGG - Intergenic
970736534 4:19176422-19176444 TGGAATCTGTTTTTTCAGCCAGG - Intergenic
971582806 4:28364559-28364581 AAGAAAGTGAGTTTTAGGCCGGG + Intronic
973627748 4:52789948-52789970 AAGAATCTGAGTTTTGGTCTGGG - Intergenic
973818608 4:54641980-54642002 AAAAATATGATATTTCTGCCTGG - Intergenic
974868485 4:67609089-67609111 AAGAAATTTATTTTTTGGCCAGG - Intergenic
976597331 4:86906430-86906452 AAGAATCAGCTTTTTAGGCCAGG + Intronic
977983535 4:103355089-103355111 AAGAATCTGAAATTTTGGCAGGG - Intergenic
979220774 4:118221061-118221083 GAGATTCTGATTTTTAGGTCTGG - Intronic
980298445 4:130955995-130956017 AAGAGTCTGTTTTTTCAGCCTGG + Intergenic
983675289 4:170285411-170285433 AAGAAGCTGATTTTTATTCCTGG + Intergenic
984482249 4:180320116-180320138 AAAAATCAAATTTTTCGGCCAGG - Intergenic
985857082 5:2436836-2436858 AAAAATCTGAAATTTAGGCCGGG - Intergenic
986001795 5:3636147-3636169 AAGAACCACAATTTTCGGCCAGG - Intergenic
987382567 5:17299485-17299507 AAAAATTTGTTTTTTAGGCCGGG + Intergenic
988487634 5:31679804-31679826 AAAAATCTGATATTCAGGCCAGG - Intronic
988955155 5:36308908-36308930 AAGAATGTGAGTTATCTGCCTGG + Intergenic
991552656 5:67858165-67858187 AATAATCTGATTTTGGTGCCAGG - Intergenic
992406646 5:76464169-76464191 AAGAAGCTGATTTTTGGTCATGG + Intronic
992860144 5:80901068-80901090 AAAAATCTGTGTTTTTGGCCGGG - Intergenic
992905436 5:81340653-81340675 AAGAATCATACTTTTGGGCCAGG - Intronic
993581333 5:89665006-89665028 AAGAATATCTTTTATCGGCCAGG - Intergenic
994340120 5:98617214-98617236 AAGAATCTTATGTTCTGGCCGGG + Intergenic
995036146 5:107536809-107536831 AAGAAGTAGATTTTTCGGCCGGG + Intronic
995077336 5:108001793-108001815 AAGAAACTAATTTTCCGGCTGGG - Intronic
995241708 5:109892194-109892216 AAAAATCTGAACTTTTGGCCAGG - Intergenic
995377174 5:111488131-111488153 TAGAATCTGATTTTGAGGCCTGG + Exonic
996228173 5:121028012-121028034 AAGAATCTGATTTTTAGTGTTGG + Intergenic
998244489 5:140486357-140486379 AAGAAAATGCTTTCTCGGCCGGG - Intronic
999868461 5:155727551-155727573 AAGAACCTCATTTTACGGCTAGG + Intergenic
1000136509 5:158357623-158357645 AATAATTAGAGTTTTCGGCCAGG - Intergenic
1000927084 5:167207134-167207156 AAGAATCTGAATTTTAGAACTGG - Intergenic
1001064502 5:168525427-168525449 AAGAATCTGAAATTTGGGCTGGG - Intergenic
1003070536 6:2942081-2942103 TAGAATTTTATTTTTGGGCCAGG + Intergenic
1003359295 6:5409153-5409175 AAGAATCTTAAATTTGGGCCAGG + Intronic
1003603163 6:7536823-7536845 AAGAATATGTTTTTTGGGCCGGG - Intergenic
1004016808 6:11738865-11738887 AAGAATCACATTTTCCGGTCGGG + Intronic
1004362062 6:14979897-14979919 AAGAATGTGAATTGTGGGCCAGG - Intergenic
1004493740 6:16143586-16143608 AAGCGTCTGATTTTTCTGCTAGG + Intronic
1004707304 6:18136512-18136534 AAAGATTTGATTTTTCAGCCAGG + Intronic
1004920989 6:20375392-20375414 AATAATGTAATTTTTCGGCTGGG - Intergenic
1006976423 6:38106443-38106465 AAGAATGTCATTTGTAGGCCGGG - Intronic
1008047918 6:46870453-46870475 AAGAATAAGATTTTTAGGCCAGG - Intronic
1009954402 6:70435398-70435420 AAGAATGTAATTTCTAGGCCGGG - Intronic
1010748797 6:79594988-79595010 AAGAATCTGCTGTTCAGGCCAGG + Intergenic
1011448858 6:87472347-87472369 AAAAATCAGATGTATCGGCCGGG - Intronic
1012462830 6:99483541-99483563 AAGAATGTTATCTTCCGGCCGGG + Intronic
1013133124 6:107254325-107254347 AAAAAAATTATTTTTCGGCCAGG - Intronic
1015716089 6:136193490-136193512 AACAAACTGATTTTACGGCCAGG - Exonic
1016949973 6:149569631-149569653 AAGACTTTTATTTTTCGGTCGGG - Intronic
1017130862 6:151107318-151107340 AAGAATTTCATTCTTTGGCCAGG - Intergenic
1017177302 6:151517038-151517060 AAGAAAATGATTTTGGGGCCGGG + Intronic
1018646961 6:165957899-165957921 AAGGAGCTGGATTTTCGGCCAGG - Intronic
1019688366 7:2395250-2395272 CAGAAACTCATTTTTTGGCCAGG - Intergenic
1024909887 7:54435306-54435328 TAGAATCTGAAATTTAGGCCTGG + Intergenic
1025805034 7:64823173-64823195 AAAAATTTAATTTTTCAGCCAGG - Intronic
1026118918 7:67519535-67519557 AAGAATCTGCTTCCTGGGCCAGG + Intergenic
1026154417 7:67814691-67814713 AAGAATCTCAGTTGTGGGCCAGG - Intergenic
1026375147 7:69742690-69742712 AAGAAACTGATTCTTAGGACAGG - Intronic
1026617670 7:71920628-71920650 AAAAAACTAATTTGTCGGCCGGG - Intronic
1026641620 7:72131238-72131260 AGGAAACTGATTTTTCAGCGGGG + Intronic
1028555188 7:92115974-92115996 AACAATCTGATTCTTTGGCCAGG + Intronic
1029143770 7:98430997-98431019 AAGAATCTGCATTTTTGGTCAGG - Intergenic
1031289940 7:119921865-119921887 AAAAATTTCATTTTTAGGCCAGG + Intergenic
1032585590 7:133143334-133143356 AAGAAGCTCTTTTTTTGGCCAGG + Intergenic
1032765440 7:134987067-134987089 AAGAAACTGAAGTTTCTGCCTGG - Intronic
1033099365 7:138457399-138457421 AAGAAAATCATTTTTCGGCCAGG - Intergenic
1033374639 7:140746472-140746494 AAGAATCTGATTTTTGAAGCTGG + Intronic
1033913055 7:146288017-146288039 AAGAATTTGTGTTTTGGGCCAGG + Intronic
1034397963 7:150841788-150841810 AAGAAGTTAATTTTTTGGCCGGG - Intronic
1034981311 7:155479389-155479411 AAGAAACTGGTTTCTTGGCCAGG + Intronic
1037866325 8:22446526-22446548 AAAAAGCTAATTTTTAGGCCAGG + Intronic
1040001741 8:42582826-42582848 AAGTATCTAATTTTTTTGCCTGG - Intergenic
1040476657 8:47783961-47783983 AAAAATGTTATTTCTCGGCCGGG + Intronic
1042305346 8:67325206-67325228 AAAAAGTGGATTTTTCGGCCTGG - Intronic
1042631724 8:70824436-70824458 AGGAATAGGATTTTTAGGCCAGG - Intergenic
1044696783 8:94931677-94931699 AAGAAAATTATTTTTAGGCCAGG + Intronic
1045001341 8:97880876-97880898 AAGAATAAGATTTTCAGGCCGGG - Intronic
1045109341 8:98925247-98925269 ACAATTCTGATTTTTCTGCCTGG + Intronic
1045151149 8:99409581-99409603 AATAATCAAATTTTTAGGCCTGG + Intronic
1045220704 8:100197161-100197183 AAGAATATAATTTTTAAGCCAGG + Intronic
1045353490 8:101363734-101363756 AAAAATCTTATTTTTGGGCTCGG + Intergenic
1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG + Intergenic
1047390698 8:124448434-124448456 AAGAACCTGTTTTTTGGGTCTGG - Intergenic
1051083506 9:13320402-13320424 AAGAATCTATTTCTTCTGCCAGG + Intergenic
1051607817 9:18933749-18933771 AATAATGTCATTTTTGGGCCGGG + Intronic
1052013264 9:23435814-23435836 AAAAATCTGACTTTCTGGCCAGG - Intergenic
1053370672 9:37559102-37559124 AAGATTTTCTTTTTTCGGCCAGG - Intronic
1053601278 9:39612315-39612337 AAAAATGATATTTTTCGGCCAGG + Intergenic
1054252259 9:62730123-62730145 AAAAATGATATTTTTCGGCCAGG - Intergenic
1054566374 9:66764622-66764644 AAAAATGATATTTTTCGGCCAGG - Intergenic
1054789872 9:69246386-69246408 AAGAACATGTGTTTTCGGCCAGG - Intronic
1054814492 9:69462022-69462044 AAAAATCTGATCTTTGGGACAGG + Intronic
1055923238 9:81483811-81483833 AAAAATCTCAATTTACGGCCGGG + Intergenic
1056217942 9:84422711-84422733 CAAAATCTGAAATTTCGGCCTGG + Intergenic
1056401703 9:86233787-86233809 AAAAATATCATATTTCGGCCGGG + Intronic
1056874068 9:90311253-90311275 AAGAATATCATTTCTAGGCCGGG + Intergenic
1057173892 9:92980674-92980696 AAGAATGTGTTGTTTAGGCCAGG + Intronic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058821939 9:108740136-108740158 AAGAATTTTATCTTCCGGCCGGG - Intergenic
1059481871 9:114597283-114597305 AAGAATCTGCTATATAGGCCGGG - Intronic
1059785318 9:117575798-117575820 ATGAAGCTGATTTTTCAGCAGGG + Intergenic
1059969636 9:119651995-119652017 AAAAATCTTATTTTTCCCCCTGG + Intergenic
1061356726 9:130111168-130111190 AAGAATCTCACTTTTAGGCCAGG + Intronic
1186429558 X:9493266-9493288 AGGATTCTGATTTTCCTGCCTGG + Intronic
1188858663 X:35230020-35230042 AAGAATCTATTTTCTCGGCCGGG + Intergenic
1189837100 X:45035992-45036014 AAAAATTTCATTTTTCGGACGGG - Intronic
1190473398 X:50805273-50805295 AAGAAACTGATTTTTCGTTTCGG - Intronic
1190484163 X:50908081-50908103 AAGAAAATGATTTTAAGGCCAGG - Intergenic
1191887116 X:65900123-65900145 ATGCTTCTGATTTTTGGGCCAGG + Intergenic
1192039354 X:67601716-67601738 AAGAATCTGTATTTTCTGACAGG - Intronic
1193086630 X:77452780-77452802 AAGAATTGCATTTTTGGGCCAGG + Intronic
1193121963 X:77832533-77832555 AAGAAAATCAATTTTCGGCCGGG + Intronic
1194050908 X:89067888-89067910 AAGAATATAAATTTTAGGCCAGG + Intergenic
1197791149 X:130255433-130255455 TTGAAAATGATTTTTCGGCCGGG - Intronic
1200110641 X:153739057-153739079 AAGAAAGTGCTTTTTGGGCCGGG + Intronic
1200850920 Y:7882419-7882441 AAAAATGTGACTTTTCTGCCTGG - Intergenic
1200865061 Y:8034691-8034713 AATAATGTGACTTTTCTGCCTGG + Intergenic
1200893380 Y:8347359-8347381 AATAATGTGACTTTTCTGCCTGG + Intergenic
1202013656 Y:20376865-20376887 GAGATTCTGATTGTTGGGCCTGG + Intergenic
1202020926 Y:20464069-20464091 GAGAGTCTGCTTTTTTGGCCTGG + Intergenic
1202253464 Y:22896239-22896261 AATAATGTGACTTTTCTGCCTGG - Intergenic
1202406454 Y:24529988-24530010 AATAATGTGACTTTTCTGCCTGG - Intergenic
1202464328 Y:25140093-25140115 AATAATGTGACTTTTCTGCCTGG + Intergenic