ID: 1165719574

View in Genome Browser
Species Human (GRCh38)
Location 19:38069503-38069525
Sequence CAGAGAGAGCAGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1783
Summary {0: 1, 1: 1, 2: 15, 3: 238, 4: 1528}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165719574 Original CRISPR CAGAGAGAGCAGAGAGAAGA GGG (reversed) Intronic
900034400 1:394946-394968 CACAATGAGCAGAGACAAGACGG - Intergenic
900055232 1:624834-624856 CACAATGAGCAGAGACAAGACGG - Intergenic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900342078 1:2194213-2194235 CAGAGAGAGCGGGGAGATGGGGG + Intronic
900504389 1:3022034-3022056 CAGGGAGAACCGTGAGAAGATGG + Exonic
900911987 1:5603722-5603744 TAGAGATAGGAGAGAGATGAGGG - Intergenic
900964957 1:5951506-5951528 CAGATGGAGTAGGGAGAAGAGGG - Intronic
901142807 1:7046081-7046103 CTGAGAGAGGTCAGAGAAGAGGG - Intronic
901158979 1:7160549-7160571 CACAAAGAGAAGAGAGAAGGTGG - Intronic
901204801 1:7488042-7488064 GAGAGACTGCAGAGAGTAGATGG - Intronic
901370879 1:8796582-8796604 CAAATACAGCAGTGAGAAGAGGG + Intronic
901372881 1:8815712-8815734 TTGGGAGAGAAGAGAGAAGATGG - Intronic
901770316 1:11526888-11526910 GAGAGAGAAAAGAGAGAAAAGGG - Intronic
901879999 1:12188296-12188318 TAGAGAGAGCCGAGAGGAGGAGG + Intronic
902450125 1:16491419-16491441 GGGAGGGAGGAGAGAGAAGAGGG + Intergenic
902502713 1:16921728-16921750 AGGAGGGAGGAGAGAGAAGAGGG - Intronic
902801466 1:18832720-18832742 GAGAGAGATGAGAGAGAAGAAGG - Intergenic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903214256 1:21834595-21834617 CAGAGCGGGCAGGCAGAAGATGG + Intronic
903315229 1:22498479-22498501 AAGAAAGAGCAGAGAGAGCAGGG + Intronic
903353305 1:22731035-22731057 CAGAGGGGGCGGAGAGAAAATGG + Intronic
903777964 1:25805345-25805367 CACAGAGGGCAGAGGAAAGATGG - Intronic
903974805 1:27142446-27142468 CAGAGTGAGAACAGAGAACAGGG + Intronic
904146237 1:28394322-28394344 GAGACAGAGCAGAGAGAGAAAGG + Intronic
904199566 1:28811263-28811285 CAGTGCGAGCAGATAGAAGGGGG - Intergenic
904265019 1:29313168-29313190 GGGAGAAAGCAGAGAGAGGAGGG - Intronic
904724514 1:32536979-32537001 GAGAGAGACAAGAGATAAGATGG - Intronic
905005735 1:34708814-34708836 TGGGGAGAGCAGATAGAAGAGGG + Intergenic
905121203 1:35683291-35683313 GAGAGAGAGCGGGGAGAGGAGGG - Intergenic
905176393 1:36138343-36138365 CAGACAGAGGACAGAGAAGTGGG - Intronic
905276062 1:36819012-36819034 CAGAGACAGCAGGGAGCAGGAGG - Intronic
905282734 1:36859526-36859548 CCGAGAAGGCAGAAAGAAGAAGG - Intronic
905366222 1:37453003-37453025 GACAGACAGCAGAGAGGAGAGGG - Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905750402 1:40457588-40457610 CAGAGAGACTAATGAGAAGATGG - Intronic
905776832 1:40673409-40673431 CAGAGGGAACATTGAGAAGAAGG - Intergenic
905867963 1:41386551-41386573 GTGAGAGAGAAGAGAGAAGACGG - Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
905977020 1:42183261-42183283 AAGAGAGAGGAGAGCGGAGAGGG + Intronic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906084448 1:43119494-43119516 CTTTGAGAGCTGAGAGAAGAAGG - Intergenic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
906283662 1:44571198-44571220 TAGAGAGAGCAGATGGAAGAGGG - Intronic
906391846 1:45424289-45424311 CAGAGAGGCCAGGCAGAAGAGGG + Intronic
906541811 1:46592627-46592649 CAGGGAGAGCAGGGAGAGCAAGG + Intronic
906764794 1:48418833-48418855 GAGAGAGAGAGGAGAGGAGAGGG + Intronic
906804772 1:48770073-48770095 CAGAGAGAGCAGACAAATAATGG - Intronic
907022234 1:51079475-51079497 CACAGGGAAAAGAGAGAAGAAGG - Intergenic
907049993 1:51323517-51323539 CTAACAGAGAAGAGAGAAGAAGG - Intronic
907239801 1:53075109-53075131 CAGAGAGTTCAGAGAGAGAAGGG - Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907303694 1:53502701-53502723 CAGAGAGAGGAGAGTGGGGAGGG + Intergenic
907304013 1:53503831-53503853 GAGACAGAGCAGAGACAAGTAGG - Intergenic
907451046 1:54546087-54546109 TAGAAAGCGCAGAGAGGAGAGGG + Intronic
907466303 1:54640077-54640099 AAAAGGGAGCAGAGACAAGATGG + Intergenic
907563560 1:55413365-55413387 GAAAGAGAGCAGAGAGAGGTAGG - Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908259298 1:62327336-62327358 GGGAGAGAACGGAGAGAAGAAGG - Intergenic
908482095 1:64551249-64551271 CACAGAGAACTGAAAGAAGATGG - Intronic
908697487 1:66860061-66860083 CACAGAAAGTAGAGAGATGAAGG + Intronic
908720109 1:67116446-67116468 CAGGGAGAGCAAACAGAAGAAGG - Intronic
908806867 1:67940734-67940756 CTGAGAGAGCAGAAAGCATAGGG - Intergenic
909016518 1:70385780-70385802 GAGAGAGAGCACAGAGAAAACGG + Intergenic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
910005774 1:82395141-82395163 TAAAGAGAACATAGAGAAGAGGG - Intergenic
910706258 1:90132712-90132734 AAGAGAGAGAAGAGAGAAAAAGG + Intergenic
910830210 1:91453509-91453531 TAAAGAGAACAGAGAGTAGAGGG - Intergenic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911164618 1:94713725-94713747 CTGGGAGAACAGAGAGAATAAGG - Intergenic
911198236 1:95017625-95017647 AAGAGACAGAAGAGAGAGGAGGG + Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
911753900 1:101530608-101530630 CAGAAAGAGCTGAGAGGAAAAGG + Intergenic
912210404 1:107550825-107550847 CAGAGAGAGAAGAGACACAAGGG + Intergenic
912314175 1:108651726-108651748 AAGAGAGAGAAGAGAAGAGAGGG + Intronic
912328338 1:108791443-108791465 GAAAGAGAGAAGAGAGAGGATGG - Intronic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
912685997 1:111765422-111765444 GAGAGGGAGGAGAGAAAAGATGG + Intronic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912794878 1:112686936-112686958 CAGGGAGACCAGTTAGAAGAAGG - Intronic
912942918 1:114060986-114061008 CAAAGAGAGGGGAGAGATGATGG + Intergenic
913051895 1:115124322-115124344 CAGAGAGAGAGGAGAGAGAAAGG + Intergenic
913064753 1:115240347-115240369 CACAGTGAGCACAGAGAGGAAGG - Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913266072 1:117046019-117046041 CAAAGGCAGCAGAAAGAAGATGG + Intergenic
913612600 1:120523179-120523201 GAGTGAGAGCTGAGAGGAGAGGG + Intergenic
914215988 1:145628980-145629002 AAGAGAGAGGAGACAGATGATGG + Intronic
914468555 1:147951612-147951634 AAGAGAGAGGAGACAGATGATGG + Intronic
914576828 1:148979499-148979521 AAGAAAAAGCAGAGAGAAGCTGG - Intronic
914578591 1:148999069-148999091 GAGTGAGAGCTGAGAGGAGAGGG - Intronic
914677986 1:149918297-149918319 TAGAGAAAGCAGAGATAACAAGG + Intergenic
914858394 1:151368391-151368413 CAGAGTCAGCAGATAGAAGTAGG - Intronic
915169778 1:153969509-153969531 CAGACAGAGCAAAGGGATGAGGG + Intronic
915444691 1:155967923-155967945 CAGAGGGGGCAGACAGAAGTGGG + Intronic
915454324 1:156029368-156029390 TAGAGAGAGCATGGAGAAAAAGG + Intergenic
915495077 1:156276549-156276571 CAGAGAGAGCAGAGAGAGCTGGG + Intronic
915496628 1:156286441-156286463 CAAAGAGACCAGTGAGCAGAGGG - Exonic
915674676 1:157519147-157519169 CAGAGAGATCAGTGACCAGAAGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916181261 1:162085730-162085752 CAGAGAGAGATGAGACAAGATGG + Intronic
916183293 1:162106273-162106295 CACAGACAGCAAAGAGAAGCAGG - Intronic
916452152 1:164931104-164931126 GAGTGAGAGCAGAGAGAGTAGGG - Intergenic
916970392 1:170007269-170007291 CAGAAAGAGGAGAGAATAGAAGG + Intronic
917008518 1:170444249-170444271 CAGACTGAGCACAGAGCAGATGG + Intergenic
917048994 1:170897000-170897022 TAGATGGAGCAGAGAAAAGAAGG - Intergenic
917130617 1:171738728-171738750 ATGAAAGAGCAGAGAGTAGAGGG + Intronic
917217739 1:172695583-172695605 CAGAGAGTGTAGGGAAAAGATGG + Intergenic
917507401 1:175640258-175640280 CATATAGAGGAAAGAGAAGAAGG - Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
918095031 1:181327344-181327366 CAGAGAAAGCAGGGAGTTGACGG + Intergenic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
918126092 1:181585276-181585298 CATGGAGAGGAGAGAGTAGAGGG + Intronic
918179494 1:182074114-182074136 GAGAGAGAGAAAAAAGAAGAAGG + Intergenic
918179504 1:182074157-182074179 AAGAAAGAGGAAAGAGAAGAGGG + Intergenic
918625437 1:186651714-186651736 CTGAGAGTTCAGAAAGAAGATGG - Intergenic
918781888 1:188710109-188710131 CAGATACAGCAGAGACATGAGGG + Intergenic
918940033 1:190981807-190981829 CAAAAAAAGCAGACAGAAGAAGG - Intergenic
919430057 1:197481359-197481381 CAGTGAGTGCAAAGAGAAGCAGG + Intergenic
919665276 1:200285559-200285581 GAGAGAGAGAAGAGAGAGGAAGG + Intergenic
919781455 1:201223978-201224000 CACGGAAAGCAGAGAGAACAAGG - Intronic
919823038 1:201484793-201484815 CAGAGAGAGGAGAGAGATAAGGG + Intronic
920154241 1:203935391-203935413 CCCAGAGAGGTGAGAGAAGATGG + Intergenic
920202041 1:204265671-204265693 CAGAGGCACCAGAGAGCAGAAGG - Intronic
920523085 1:206643802-206643824 CAGCAAGAGAAGAGAGAAAAGGG + Intronic
920783756 1:209020553-209020575 CAGTGAAAGCAGCCAGAAGAGGG + Intergenic
920868762 1:209775574-209775596 GAGGGAGATCAGAGAGGAGAGGG - Intronic
920926093 1:210343226-210343248 CAGAAAGAGCAGGGAGGAGGAGG - Intronic
921030404 1:211331045-211331067 CAGAGAGAACAGAGAGAAAGAGG - Intronic
921305689 1:213794354-213794376 GAGAAAGGGCAGAGAGGAGAAGG - Intergenic
921348341 1:214209664-214209686 GAGAGGAAGCAGAGAGAAAAGGG + Intergenic
921365213 1:214367345-214367367 CACTGAAAGCAGAGAGTAGAAGG - Intronic
921487319 1:215730446-215730468 GAGAGAGAGCTGAAAGAGGAGGG - Intronic
921557551 1:216616704-216616726 TAGAGATAATAGAGAGAAGAGGG - Intronic
921559090 1:216635207-216635229 GAGAAAGAGCAGAGAAGAGAGGG + Intronic
921626099 1:217379510-217379532 CAGAGAGGGCAAACAGAAGCAGG + Intergenic
921684753 1:218076991-218077013 CAGTGAGAACAGATATAAGAAGG - Intergenic
921818440 1:219590033-219590055 AAGAGAAAGCATAGAGAAAATGG - Intergenic
922017263 1:221662947-221662969 AAGAGAGAAGAGAGAGAAAATGG - Intergenic
922059330 1:222072766-222072788 CAGATATACCAGAGAGAAGCTGG - Intergenic
922088861 1:222376639-222376661 CAGGGAGAGCTGTGAGAAGATGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922578522 1:226679940-226679962 CGGAGAGGGCAGGGAGAAAAGGG + Intronic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923244601 1:232119384-232119406 AAGAGAGAGTAGAGAAATGAAGG - Intergenic
923332451 1:232937879-232937901 CAGCCAGAGCAGAGAGACAAAGG - Intergenic
923438079 1:233987713-233987735 GAGAGAGAGAAGAGGGAAAATGG - Intronic
923482572 1:234397724-234397746 GAGAGGGAGGAGGGAGAAGAGGG + Intronic
924033567 1:239912162-239912184 GAGAGAGAGAAGGAAGAAGAGGG - Exonic
924048621 1:240058228-240058250 CAAAGAGCGCAGTCAGAAGATGG - Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
924337953 1:243001969-243001991 CACAATGAGCAGAGACAAGACGG - Intergenic
924446760 1:244140066-244140088 CAGAGAGAGCGGAGAGACCTTGG - Intergenic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924571906 1:245244648-245244670 AAGAGAGAGGACAGAGAAGACGG - Intronic
924679944 1:246220978-246221000 CTGAGAGAACAGACAGATGATGG + Intronic
924750927 1:246888906-246888928 CAGAGAGAGAGGAGAGAATTGGG + Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1062987478 10:1782487-1782509 GAGAGAGAGGAGGGAGAGGAGGG + Intergenic
1063078590 10:2742255-2742277 CGGAGAGAGTGCAGAGAAGAGGG - Intergenic
1063099283 10:2935425-2935447 GAGAGAGAGAAGAGAGGAAAAGG + Intergenic
1063367704 10:5501029-5501051 CAGGCAGAGCAGTGAGAGGAGGG + Intergenic
1063614493 10:7590173-7590195 GACAGAGAGCAGCGAGGAGAGGG - Intronic
1063687778 10:8254958-8254980 CAAAGAGGGGAGAGGGAAGATGG - Intergenic
1063688607 10:8262065-8262087 GAGACAGAAGAGAGAGAAGAGGG + Intergenic
1063711419 10:8482728-8482750 GAGAGAGAAGAGAGAGAGGAGGG - Intergenic
1063795923 10:9514059-9514081 AAGAGAAAGACGAGAGAAGAAGG + Intergenic
1063985911 10:11501682-11501704 CTGAGAGACCAGTGAGAAGGTGG - Intronic
1064003658 10:11683583-11683605 GAGAGAGAGAGGAGAGAGGAGGG - Intergenic
1064106885 10:12507897-12507919 AAGAGAGGGATGAGAGAAGAGGG - Intronic
1064146108 10:12827644-12827666 GGGAGAGAGGAGAGAGGAGAGGG - Intronic
1064319315 10:14287772-14287794 CAGAGAGAGCAGTCTTAAGAAGG - Intronic
1064503603 10:16004220-16004242 AAGAGAGAAAAGAGAGAATAAGG + Intergenic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1065266209 10:23978889-23978911 CAGAGCCACCAGAGAGAACATGG - Intronic
1065578978 10:27152722-27152744 ATGAGAGATCAGAGAGATGATGG - Intronic
1065638271 10:27753104-27753126 GAGAGAGAGTAAAGAAAAGAAGG - Intergenic
1065679186 10:28211792-28211814 CAGAGGGAGCAAGAAGAAGAGGG + Intronic
1065699231 10:28408843-28408865 CAGAGAGAGAGGAGAGAGGGAGG - Intergenic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1065775677 10:29117574-29117596 CAGAGAGAGAAGAAAGTAAATGG + Intergenic
1065916630 10:30358677-30358699 GAGAGAAAGCAGAGAGAAAACGG - Intronic
1066078529 10:31906066-31906088 CAGATGGAGCAGAGAGAACGTGG - Intronic
1066223954 10:33364050-33364072 CAGAGAGAGCAGACAGACAAAGG - Intergenic
1066465223 10:35643817-35643839 GTGAGAGAGCGGAGAGAAAAGGG - Intergenic
1066661106 10:37738877-37738899 CAGAGAGACCACAGAGATGCAGG + Intergenic
1067012973 10:42731775-42731797 CAGAAACAGCAGACAGCAGAGGG - Intergenic
1067224904 10:44369283-44369305 CAGAGGGAGCAGAGAGTGAATGG + Intergenic
1067290146 10:44934324-44934346 GATAGGGAGCAGAGAGGAGAAGG - Intronic
1067432053 10:46251389-46251411 CAGACAGAGGACAGAGCAGAGGG - Intergenic
1067441181 10:46309959-46309981 CAGACAGAGAACAGAGCAGAAGG + Intronic
1067797053 10:49328243-49328265 CACAGAGACCTCAGAGAAGAGGG - Intergenic
1067824411 10:49559606-49559628 CAGACAGAGGAAAGAGAAAAAGG + Intergenic
1068255535 10:54504814-54504836 GAGAGAGTACAGAGAGAAAATGG - Intronic
1068303465 10:55175781-55175803 AAGAAAGAGGAGAGAGAAAAAGG + Intronic
1068613184 10:59083213-59083235 CACAAAGAGCACAGAGAAAATGG - Intergenic
1069070652 10:63987803-63987825 AACAGAGAGAAAAGAGAAGAAGG - Intergenic
1069216321 10:65825832-65825854 GAGAGAGAGAAGAGAGAAAGAGG + Intergenic
1069408624 10:68128978-68129000 GAGAGAGAGGAGAGAGAATCTGG - Intronic
1069678295 10:70265385-70265407 ATGAGAGAGTAGAGAGTAGATGG + Intronic
1069802092 10:71088044-71088066 CAGAGAGATCTGTGAGAAGCTGG + Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070045751 10:72834550-72834572 CAGAGAGAGAAAGGAGGAGAAGG + Intronic
1070146067 10:73774094-73774116 CAGACAGGGGAGAGAGAAAATGG + Intronic
1070191263 10:74113941-74113963 AAGAGAGAGGAGAGAGGAGGGGG - Intronic
1070191265 10:74113943-74113965 CAAAGAGAGAGGAGAGAGGAGGG - Intronic
1070312541 10:75284149-75284171 CAGAGAGGGGAGGGAGAAGAAGG + Intergenic
1070690097 10:78517988-78518010 CAGAGAGAGAAGAGCAGAGAGGG + Intergenic
1070960756 10:80498682-80498704 CAGACAGAGCAGAGATGTGAGGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071501392 10:86206654-86206676 AAGAGAGAAGAGAGAGAGGAAGG + Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071886029 10:89951654-89951676 CAGAGACAACAGAGAGAGAATGG - Intergenic
1071888131 10:89972722-89972744 CAATGGGAGCAGAGAGGAGAAGG + Intergenic
1071944594 10:90628711-90628733 GAGAGAGAGCAGAGAAAATAAGG + Intergenic
1072455043 10:95568086-95568108 GAGAGAGAGGAGGAAGAAGAAGG + Intergenic
1072591322 10:96831391-96831413 GAGAACGAGAAGAGAGAAGATGG - Intergenic
1073036063 10:100564997-100565019 CAGAGAGAGCAGACACTTGAAGG + Intergenic
1073103302 10:101018376-101018398 CAGAGAGAAGGGAGAGGAGAGGG + Intronic
1073103419 10:101018906-101018928 CAGAGAGCGCAGAGTCAAGGCGG + Exonic
1073148287 10:101294639-101294661 CAGAGAGACCAGGTAGAAGGTGG + Intergenic
1073243538 10:102073845-102073867 CAGAGAGATGAGGAAGAAGATGG + Intergenic
1073258453 10:102170637-102170659 AAGAGAGAGGAGAGAGGAGAAGG - Intergenic
1073418950 10:103408282-103408304 CAGACAGAGGAGACAGCAGAAGG - Intronic
1073616730 10:105003980-105004002 AAGAGAGAGAAGAGAAAAAAAGG - Intronic
1073649893 10:105347177-105347199 CAGAGACAACAGAGAGAAATGGG - Intergenic
1073864399 10:107785291-107785313 CAGAGAAAGCAGTGCTAAGAAGG - Intergenic
1074161653 10:110840959-110840981 CAGAGATATCAGAGAGCAAATGG - Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074230745 10:111532437-111532459 GAAAGAGAGGAGAGAGAAGAGGG + Intergenic
1074232168 10:111548551-111548573 CAGAGAGGCCAGAGAGAAAAGGG - Intergenic
1074395771 10:113096875-113096897 CAGAGAAAGAAGAAATAAGAGGG + Intronic
1074418289 10:113286407-113286429 CAGAGGGACCAGATACAAGAGGG - Intergenic
1074467147 10:113693336-113693358 CAGAAGGAGCAAAGAGAAAAGGG - Intronic
1074489812 10:113929562-113929584 CAAAGAGGGGTGAGAGAAGAGGG + Intergenic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1074765090 10:116694676-116694698 CAGAGAGTGCAGAGCGCACAGGG - Intronic
1074786681 10:116848284-116848306 GTAAGAGAGCAGAGAGAACACGG + Intergenic
1074800382 10:116994507-116994529 CAGAGAGAGAAGGGGAAAGAGGG + Intronic
1074876856 10:117620421-117620443 CAGGGAGAGCATAGAGACCAGGG + Intergenic
1075074848 10:119343807-119343829 GGGAGAGAGCAGAGAGCAAAGGG + Intronic
1075415846 10:122263315-122263337 CAGAAAGAGAAGAGAGAAAAGGG - Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076388139 10:130074153-130074175 CAAAAAGAGCAGAAAGCAGAGGG + Intergenic
1076591771 10:131588466-131588488 CAGAGAGAGCCCAGGGAACAGGG + Intergenic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1076811166 10:132887177-132887199 GAGAGAGGAGAGAGAGAAGAGGG - Intronic
1076811176 10:132887236-132887258 GCGAGAGAGGAGAGAGAAGAGGG - Intronic
1076811187 10:132887302-132887324 AGGAGAGAGGGGAGAGAAGAGGG - Intronic
1076811201 10:132887373-132887395 GAGAGAGGAGAGAGAGAAGAGGG - Intronic
1076811212 10:132887441-132887463 AGGGGAGAGGAGAGAGAAGAGGG - Intronic
1076992537 11:282945-282967 CACACAGAGCAGAGGGAGGAGGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077163290 11:1123296-1123318 CAGAGAGAGGAGGCAGAAGGAGG - Intergenic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077497340 11:2892576-2892598 CAGGGGGAGCAGAGAGGAAATGG - Intronic
1077553912 11:3217009-3217031 GAGAGAGAGAAAAGAAAAGAAGG - Intergenic
1077770279 11:5210645-5210667 GAGAGAGTGCATAGAGGAGAGGG - Intergenic
1077802543 11:5555426-5555448 GAGAGAAGGGAGAGAGAAGAAGG + Intronic
1077871753 11:6268797-6268819 CAGAGAAAGAGGAGAGTAGAAGG + Intronic
1078170129 11:8923492-8923514 TAGAGAGGGCATAAAGAAGATGG - Intronic
1078306035 11:10187296-10187318 GAGAGAGAGAGGAGAGAAAAAGG - Intronic
1078329743 11:10409525-10409547 CAGAGACAGCAGGAAGCAGAGGG + Intronic
1078361306 11:10669951-10669973 AAAAGAGAGCAGAGGAAAGAGGG + Intronic
1078366987 11:10715095-10715117 CAGAGAGCACAGAGAAAAGCAGG + Intergenic
1078461015 11:11515443-11515465 CAGAGAGAGCAGGGGGAATCGGG - Intronic
1078470504 11:11582269-11582291 CAGAGAGTGGAGGGAGAAAAGGG + Intronic
1078492630 11:11783586-11783608 TGGAGGGAGCAAAGAGAAGAGGG - Intergenic
1078526774 11:12107440-12107462 GAGAGAGAGAAAAAAGAAGAAGG - Intronic
1078671153 11:13366887-13366909 CAGAAAGAGGACAGAGAAGTAGG - Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1078882955 11:15471262-15471284 GAGAGAGTGCAGAGAAGAGAGGG - Intergenic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079222265 11:18573565-18573587 CAGAGATTGCAGAGTGAAGTAGG - Intronic
1079257651 11:18846463-18846485 AAGAGAAAGAAGAGAGAATAAGG - Intergenic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1079641918 11:22816203-22816225 GAGAGAGAGGAGAGAAAAGTGGG - Intronic
1079645602 11:22860723-22860745 GAGAGAGACTAGAGAGATGAAGG - Intergenic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1080574714 11:33587761-33587783 CAGAGGGAGGAGAGAGAAAGTGG + Intronic
1080922327 11:36721463-36721485 CAGTGAGAGCAGTGAGAGAAGGG - Intergenic
1080928407 11:36782636-36782658 CAGAGAGGTGAGACAGAAGAGGG + Intergenic
1081206842 11:40285388-40285410 CAGAGAGATCAAACACAAGAAGG + Intronic
1081521917 11:43890019-43890041 CCCAGAGATCAGAGAGAACATGG + Intronic
1081633122 11:44702759-44702781 TAGAAACAGCAGAGAGATGAGGG + Intergenic
1081757605 11:45555809-45555831 TAGAGGGACAAGAGAGAAGATGG + Intergenic
1082728118 11:56761371-56761393 CAGAAGGAGAAGAGAGTAGATGG - Intergenic
1082749119 11:56998943-56998965 CAGTTGGAGCACAGAGAAGAAGG + Intergenic
1082751722 11:57026114-57026136 CAGAGAGAGCTGAGAGAAAATGG - Intergenic
1082758091 11:57097817-57097839 CAGCCAGAGGACAGAGAAGATGG + Intergenic
1082893896 11:58169808-58169830 TACAGAGAACAGTGAGAAGAGGG - Intronic
1083007546 11:59361772-59361794 GAGAGAGAGGACAGAGAAAAAGG - Intergenic
1083250543 11:61464008-61464030 AGGAGAGAGGAGAGGGAAGAGGG - Intronic
1083655073 11:64225661-64225683 CAGAGAGAGCCCAGAGAGAAAGG + Intronic
1083738996 11:64697825-64697847 CAGAGAGAGAAGAAAAAGGAGGG + Intronic
1083740633 11:64709493-64709515 CAGAGTGGGGAGAGAAAAGAAGG + Intronic
1083874799 11:65516319-65516341 CAGAGAGAGGAGAGAGAGAAAGG + Intergenic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084279306 11:68076771-68076793 CAGAAAGGACATAGAGAAGAGGG + Intronic
1084656995 11:70525512-70525534 AAGAGAGAGGTGAGAGAAAAGGG + Intronic
1084665204 11:70572545-70572567 CTAAGGGAGGAGAGAGAAGAGGG + Intronic
1084873444 11:72113085-72113107 CTGAGAGAGCACAGATAGGAGGG - Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085381077 11:76119305-76119327 AAGAGAGTACAGAGAGAAAAAGG - Intronic
1085415034 11:76314040-76314062 CAGAGAGATGAGAGCTAAGATGG + Intergenic
1085446336 11:76603551-76603573 GAGAGAGGGGAGAGAGAGGAAGG + Intergenic
1085801202 11:79591326-79591348 CAGACAGTGCAGGGAGAAGAAGG + Intergenic
1085878859 11:80441709-80441731 TAGAGAGAGTAGAGAAAGGATGG - Intergenic
1086248053 11:84778846-84778868 TAGAGAAAGCAGGCAGAAGAAGG + Intronic
1086454850 11:86951182-86951204 AAGAGAGAGAAGAGAGGAAATGG - Exonic
1086520501 11:87663297-87663319 GACAGAGAGCAGAAAGAGGAAGG + Intergenic
1086970626 11:93076923-93076945 CAGAGAGTGCAGAGACAAGCTGG - Intergenic
1087430011 11:98041631-98041653 AAGAAAGAGCAGGCAGAAGAAGG - Intergenic
1087575725 11:99986665-99986687 CAAGGAGAGCAGAGAAAAAAAGG - Intronic
1087910482 11:103747568-103747590 GAGAGGGAGCATAGAGAAGGAGG - Intergenic
1088020783 11:105116019-105116041 CAGAGTGATCAGACAGCAGAAGG + Intergenic
1088184118 11:107144336-107144358 AATACAGAGCAGAGAAAAGAAGG + Intergenic
1088312714 11:108477015-108477037 AAAAGAGAGCACTGAGAAGATGG + Intronic
1088548086 11:110981860-110981882 GAGAAAGAGAAAAGAGAAGAGGG + Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088596410 11:111444246-111444268 CAGAGAGAGAGGAGAGGAGAGGG + Intronic
1088928015 11:114321753-114321775 CTGATAAAGCAGAGAGAACATGG - Intergenic
1089113017 11:116072065-116072087 CAGAGAGAACAGATAGAGGCAGG - Intergenic
1089119809 11:116125548-116125570 CAGACAGAGCAGATAAAGGAAGG - Intergenic
1089268838 11:117287268-117287290 CAGAGGGAGAAGGGAGAACAGGG - Exonic
1089472232 11:118730661-118730683 AAGAGAGAGTAGAGACATGAAGG + Intergenic
1089534624 11:119153398-119153420 CAGAGAGAGCGCAAAGAAGAAGG + Intronic
1089558518 11:119330438-119330460 GAGAGAGAGGAGGGGGAAGAAGG - Intergenic
1089709001 11:120301718-120301740 GAGAGAGGGCTGAGAGAGGAGGG - Intronic
1089969580 11:122682013-122682035 CAGGGAGAACAGACAGGAGATGG - Intronic
1090026888 11:123175303-123175325 AAGAGAGAGAAGAGCAAAGAAGG + Intronic
1090213716 11:124941836-124941858 GAGAGAGAGCAGTTAGAAGAGGG - Intergenic
1090245389 11:125212622-125212644 CAGAGAGGGAAGAGAGGAGAGGG + Intronic
1090310668 11:125734412-125734434 CAGAAAGAGTAGAGAGAAAAGGG - Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090514609 11:127412077-127412099 CAGAGATGACAGAGAGACGATGG - Intergenic
1090531198 11:127592689-127592711 AGAAGAGAGTAGAGAGAAGAGGG + Intergenic
1090560770 11:127929777-127929799 CAGAGAGAAAAGAGAGAGCATGG + Intergenic
1090580426 11:128153019-128153041 AAGAGAGAGAAAAGAAAAGAAGG + Intergenic
1090968287 11:131617209-131617231 CAGAGAGTGCTGAGAGTGGAGGG + Intronic
1091015334 11:132045835-132045857 CAGAAAGAGCTCAGAGAAAAGGG - Intronic
1091025816 11:132140211-132140233 CCGGGAGAGCAAAGAGAATAGGG - Intronic
1091166934 11:133486840-133486862 GAGAGAGAGAAGAGAGAAGGGGG - Intronic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1091299389 11:134497859-134497881 AAGAGAGAGGTGAGAGAGGAGGG + Intergenic
1091446370 12:546169-546191 AAGAGGGAGCAGTGAGAAGTGGG + Intronic
1091544833 12:1494688-1494710 CAGAGAAAGAAGAGAGGAGGTGG - Exonic
1092019207 12:5186467-5186489 CACATAGAGGAGAGGGAAGAAGG - Intergenic
1092167837 12:6353972-6353994 CAGAGATAGAAGAGAGAGGGAGG + Intronic
1092278617 12:7081931-7081953 AGGAGAGAGAGGAGAGAAGAGGG - Intronic
1092331837 12:7592474-7592496 CAGAGAGAGAAGAGAAATGCAGG + Intergenic
1092791970 12:12078263-12078285 GAGAGAGAGGAGAGAGAAGCCGG + Intronic
1092929265 12:13299889-13299911 GAGACAGATGAGAGAGAAGAGGG - Intergenic
1093149188 12:15601698-15601720 GAGAGAGACAAGAAAGAAGAGGG - Intergenic
1093226335 12:16488352-16488374 CAGAGAGGGGAGAGAGATGAGGG - Intronic
1093282594 12:17212565-17212587 GAGAGAGAGGAAAGGGAAGAGGG - Intergenic
1095173724 12:39065486-39065508 AAGAGAGAGCAGAGAGAGAAAGG - Intergenic
1095283685 12:40385331-40385353 GAGAGAGAAGAGAGAGAAAAAGG + Intergenic
1095486168 12:42686845-42686867 GAGAGAGAGAGGAGAGAGGAGGG + Intergenic
1096558956 12:52422414-52422436 TCGAGAGAGCAGACAGAGGAAGG - Intergenic
1096608808 12:52787703-52787725 CAGAGAGAGGGTGGAGAAGAGGG - Intergenic
1096621677 12:52869366-52869388 CAGAGGGGGAACAGAGAAGAGGG + Intergenic
1096718769 12:53506176-53506198 CAGAAAGAGCAGGGAGCAAAGGG - Exonic
1096738582 12:53675686-53675708 AAGAGAAAGCAGAGATAGGAGGG + Intronic
1096848680 12:54421454-54421476 CAGAAAGAGCCAAGAGAGGAGGG - Intergenic
1096960489 12:55571910-55571932 AATAGACAGCTGAGAGAAGAGGG - Intergenic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097492823 12:60291561-60291583 GAGAGAGACCAGAGAGCACAGGG - Intergenic
1097864697 12:64550297-64550319 GAAAGGGAGAAGAGAGAAGAGGG + Intergenic
1098098801 12:66990478-66990500 AAGAGAGAAAAGAGGGAAGAAGG + Intergenic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098491062 12:71079093-71079115 AAGAGAGAAAAGAGAGAAAAAGG + Intronic
1098674287 12:73269199-73269221 CAGATAAAGCAGTGATAAGAAGG + Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1098995736 12:77117401-77117423 CTTAGAGAGCAGGGGGAAGATGG - Intergenic
1099163943 12:79278505-79278527 CAGCAAGAGCAGAGCTAAGAGGG + Intronic
1099198127 12:79643195-79643217 CAGAGGGAGGAAAGAAAAGAAGG + Intronic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1099272322 12:80526128-80526150 CAGAGAAAGCACAGATAGGATGG - Intronic
1099393543 12:82110070-82110092 AAGAGAGAGAGGAGAGAAGAAGG + Intergenic
1099421874 12:82471936-82471958 GAGAGAGAGAATAGATAAGAGGG + Intronic
1099650194 12:85416861-85416883 CAGAGGGAGAAGAGAGATGCAGG + Intergenic
1100123546 12:91396121-91396143 AAGAGAGAGAAGAATGAAGAAGG - Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1100283050 12:93137039-93137061 CAGTGAGAGAAGAGACAAAACGG + Intergenic
1100376628 12:94022432-94022454 CGGGGAGACCAGTGAGAAGATGG + Intergenic
1100660591 12:96694329-96694351 GAAAGAGAGCAGAGAGAACAAGG - Intronic
1100703558 12:97175920-97175942 CAGAGAGATGAAAGGGAAGAAGG - Intergenic
1100730879 12:97467019-97467041 CAGAGAAAGCTGAGAAAAGAAGG + Intergenic
1100979600 12:100154060-100154082 GAGAGAAAGCAGAGAGAAAACGG - Intergenic
1101562805 12:105875142-105875164 CACAGAGATAAGTGAGAAGAAGG + Intergenic
1101632056 12:106504728-106504750 CAGAGAGAGTACAGACAAGGGGG - Intronic
1102012772 12:109628781-109628803 CAGAGAGAAAAGAAAGAAAAAGG - Intergenic
1102082444 12:110109483-110109505 GAGAGAGAGAGGAGAGGAGAGGG - Intergenic
1102459078 12:113089185-113089207 GAGAAAGAGCAGAGAGACCAGGG + Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102560250 12:113756953-113756975 CAGAGATGGGAGGGAGAAGAGGG - Intergenic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1102904254 12:116662278-116662300 CCGAGGTGGCAGAGAGAAGAGGG - Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103460779 12:121103246-121103268 CAGAAGCAGCAAAGAGAAGAGGG + Intergenic
1103611875 12:122129104-122129126 GACAGAGAGCAGAGTGAAGAGGG - Intronic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1103982470 12:124745681-124745703 TAGAGAGAGGAGAGAGATTAGGG + Intergenic
1104059476 12:125255305-125255327 AAGAGAGAGAAGAGAGGAGGGGG - Intronic
1104140205 12:125980683-125980705 CAGGGAGTAGAGAGAGAAGATGG - Intergenic
1104145216 12:126026735-126026757 CAGAGATATCAAGGAGAAGAAGG + Intergenic
1104225064 12:126823530-126823552 CGGAGAGAGGAGAGGGAACAAGG - Intergenic
1104399651 12:128464971-128464993 CACAGAGAGGGGAGAGAAGGAGG + Intronic
1104612876 12:130243898-130243920 CATAGAGAGGGGAGAGAGGATGG - Intergenic
1104917011 12:132270913-132270935 CAGAGAGAGCAAGGAGGAGATGG + Intronic
1104939425 12:132387906-132387928 CAGAGAGGGGAGAGAGATGCGGG + Intergenic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105683317 13:22752122-22752144 GAGAGGGAGCAGGGAGAAGATGG - Intergenic
1105696758 13:22897242-22897264 GAGAGAGAGGAGAGAGAGAAAGG + Intergenic
1105757844 13:23485792-23485814 AAGAGAGAGCAGTGAAATGAAGG + Intergenic
1105778124 13:23681489-23681511 AAGAGGGAGCAGAGAGAATGAGG - Intergenic
1106079128 13:26486016-26486038 CAGAAGGAACAGAGAGAACAGGG + Intergenic
1106576285 13:30978874-30978896 CAAAGAGAGCAGAGAGATGATGG - Intergenic
1106949169 13:34863562-34863584 GAGAGAGAGCAGAGCAGAGAGGG - Intergenic
1107075431 13:36317650-36317672 AAGAGAGAGCAGAGAAACGGAGG - Intronic
1107129369 13:36879150-36879172 GAGAGAGAGAAGAGAGGAGAGGG - Intronic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1107346885 13:39471437-39471459 AAGTGAGAGCAGAAACAAGAGGG + Intronic
1107442736 13:40442721-40442743 CAGAGAGAGCTGGGTAAAGATGG + Intergenic
1107587521 13:41867455-41867477 CAGAGACAGCAGCTAGGAGATGG - Intronic
1108146516 13:47483274-47483296 CAGAGAAAGAAGAGAGAAGTGGG + Intergenic
1108327010 13:49343618-49343640 AAGAGAGAGGAGAGAGGAGAGGG + Intronic
1108579571 13:51817213-51817235 GAGAAAGAGGAGAGAGAGGAAGG + Intergenic
1108677102 13:52746510-52746532 CAGAGATGAGAGAGAGAAGAAGG + Intergenic
1108758825 13:53537716-53537738 CAGAAAGAAAAGAGAGAAGGGGG - Intergenic
1109098312 13:58145404-58145426 CAGGCAGAGCTGTGAGAAGAGGG + Intergenic
1109314461 13:60734038-60734060 AAGACAGAGCAGAAAGATGAGGG - Intergenic
1109333243 13:60958360-60958382 TAGAAAAAGCAGACAGAAGAAGG + Intergenic
1109622052 13:64923969-64923991 GAGAGAGAGAAAAGAGAAAAAGG + Intergenic
1109801796 13:67389217-67389239 GGTAGAGAGCAAAGAGAAGAAGG - Intergenic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110292181 13:73819983-73820005 CAGAGAGAGGAGGCAGAGGAGGG + Intronic
1110311062 13:74049732-74049754 TAAAGAGAGAAGAGAGAAAATGG + Intronic
1110397731 13:75051211-75051233 AAGGGAGAGGAGAGAAAAGAAGG - Intergenic
1110537117 13:76664181-76664203 CAGAGACAGCAAACAGAGGAAGG + Intergenic
1110859034 13:80327624-80327646 CTGAGAGAGTAGTGAGGAGAAGG - Intergenic
1111031304 13:82603019-82603041 CAGAGAAAGAAGACAGAAGAGGG - Intergenic
1111037588 13:82698699-82698721 CAGAGAGAAAAGAGAGAAAAAGG + Intergenic
1111211043 13:85080780-85080802 CAGAGAGATGGGAGAGAAGGAGG + Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1111420178 13:88000715-88000737 CATAGGGAGCAGAGAGATGAAGG - Intergenic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1111845829 13:93507286-93507308 GAGAGAAAGGAGAGAGAAGGTGG - Intronic
1111915048 13:94351939-94351961 CAAGGAGAGGAGAGAGAAGAAGG + Intronic
1112067209 13:95806002-95806024 CAGAGAGAACAGAGATAAGGGGG + Intronic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112563924 13:100536319-100536341 CAGAAAGAGAACAGAGAGGAAGG - Intronic
1112642051 13:101286400-101286422 CCCAGAGAGCAGGAAGAAGAAGG - Intronic
1112798355 13:103082620-103082642 GAGAGAGAGAAGAGAGAACCAGG - Intergenic
1113258041 13:108528781-108528803 AAGAGAGAGAAGAGAGAAGAGGG - Intergenic
1113283037 13:108811642-108811664 ATGAGAGAGGAGAGAGAAGTAGG - Intronic
1113491970 13:110699329-110699351 CACAAAAAGCAGAGAGAACAGGG + Intronic
1113502860 13:110792221-110792243 GTGAGAGTGCAGTGAGAAGATGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618067 13:111695046-111695068 CAGAGAGCAGAGAGAGGAGAGGG - Intergenic
1113618075 13:111695109-111695131 CAGAGAGCGGAGAGAGTGGAGGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623600 13:111780307-111780329 CAGAGAGCAGAGAGAGGAGAGGG - Intergenic
1113623608 13:111780370-111780392 CAGAGAGCGGAGAGAGTGGAGGG - Intergenic
1113818186 13:113190114-113190136 CAGAAAGAGAAGAGAAAAAATGG + Intronic
1114461983 14:22892319-22892341 CAGAGAAAGAAGAGGGAACAAGG + Intergenic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1114693697 14:24607751-24607773 CACAGAGAGCAGAGTGAGGATGG + Intronic
1114696641 14:24632463-24632485 CACAGAGAGCAGAGTGAGGATGG + Intronic
1114798106 14:25739864-25739886 CTGATAGAGCTGTGAGAAGAGGG - Intergenic
1114832131 14:26157309-26157331 CAGAAGGAGAAGAGAGATGAAGG - Intergenic
1115026777 14:28756056-28756078 GAGAGAGAGGAAAGAGAAAAGGG + Intergenic
1116131427 14:40859412-40859434 CAAAGAGGGCAGAGTGATGATGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116293536 14:43074181-43074203 CTGATAGAGCTGTGAGAAGAGGG + Intergenic
1116457695 14:45137920-45137942 GAAAGAGATTAGAGAGAAGAAGG + Intronic
1116530636 14:45968457-45968479 TAGAGAGTGAAGAAAGAAGATGG - Intergenic
1116564257 14:46425188-46425210 TAGAGAGGACAGAGAAAAGAAGG + Intergenic
1116944651 14:50825130-50825152 CAGAGAAAGCTGATACAAGAGGG + Intronic
1117088480 14:52225596-52225618 CAAAGAGAGCAATGAGCAGAAGG - Intergenic
1117327069 14:54678999-54679021 AAGAGATAGCAGGGAGAAGTGGG + Intronic
1117366958 14:55038621-55038643 CAGACACAGCAGAGGGTAGAGGG - Intronic
1117467271 14:56005991-56006013 GGAAGAGAGCAGAGAGAAAAGGG - Intergenic
1117616203 14:57536191-57536213 CAGAGAGTGAAGAGAGGGGAAGG - Intergenic
1117662311 14:58020364-58020386 CCGAGGGAACAGAGAGGAGAAGG - Intronic
1117732603 14:58738796-58738818 CAGAAAGAACGGACAGAAGAAGG + Intergenic
1117798224 14:59416513-59416535 CCAAGGGAGGAGAGAGAAGATGG + Intergenic
1117904382 14:60569102-60569124 CAGGGATGGCAGAGAGCAGAAGG + Intergenic
1117987614 14:61403985-61404007 CAAAGAGAGCAGAGAGATAAGGG - Intronic
1118137100 14:63042146-63042168 CACACAGAGCAGAGAGAAAGGGG - Intronic
1118159920 14:63277836-63277858 CAGAGAGAAAAGAGAGAAGTGGG + Intronic
1118333344 14:64831345-64831367 GAAAGAAAGGAGAGAGAAGATGG - Intronic
1118464760 14:66020929-66020951 CAGAGAGAGAATATAGAAAATGG + Intergenic
1118475135 14:66109471-66109493 GACAGAGAGCAGAGAGAAAGAGG + Intergenic
1118538336 14:66793327-66793349 CAGGGAAAGCACAAAGAAGATGG + Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118838459 14:69493675-69493697 CAGGGAGAGCCGAGTTAAGAAGG - Intronic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1118857732 14:69637169-69637191 CAGACAGAGCAGAAAGAGGTGGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118911225 14:70063639-70063661 CAGAGAGAGGACAGAGGAGAGGG + Intronic
1118937458 14:70300696-70300718 AAGAGAGAGTAGAGACAAGGAGG + Intergenic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119201609 14:72756997-72757019 GAGGGAGAGAGGAGAGAAGAGGG + Intronic
1119709831 14:76813460-76813482 CAAAGAGAGGAGAGAGAGAAGGG + Intronic
1119866225 14:77977415-77977437 CTGAGAGAGGGGAGAGAAGTGGG + Intergenic
1119995154 14:79245398-79245420 GAGAGAGAGAAGAGAGGAGTAGG + Intronic
1120221848 14:81743170-81743192 CATCAAGAGCAAAGAGAAGATGG - Intergenic
1120285962 14:82501915-82501937 CAGAGAGATCAGAAAGAATATGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1120722753 14:87905928-87905950 CAGGGACTGGAGAGAGAAGATGG - Intronic
1120824904 14:88946271-88946293 GAGAGGGAAGAGAGAGAAGAAGG + Intergenic
1120871382 14:89340078-89340100 AAGAGAGAGGAAAGAGAAGAAGG + Intronic
1121090330 14:91176942-91176964 GAGAGAAAGAAGAAAGAAGAAGG - Intronic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121209830 14:92199898-92199920 CAAGAAGAGCAGAGAGGAGAGGG + Intergenic
1121216525 14:92252811-92252833 GAGAGAGAGAAAACAGAAGAAGG + Intergenic
1121575261 14:94979843-94979865 CAGAGCAAGCAGAGTGCAGATGG + Intergenic
1121706683 14:96001700-96001722 CACGGAGAGCAAAGAGAAGCAGG + Intergenic
1121724663 14:96138375-96138397 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1121782567 14:96631344-96631366 CTGAGAGGACAGAGAGCAGATGG + Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122089080 14:99326265-99326287 CAGGCAGAGGAGAGAGGAGAGGG - Intergenic
1122563340 14:102632778-102632800 ACGAGAGAGGAGAGAGGAGAGGG - Intronic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1122761744 14:104033733-104033755 GAGGGAGTGGAGAGAGAAGAGGG + Intronic
1123050811 14:105541112-105541134 CAAACAGAGCAGAAAGGAGACGG - Intergenic
1123144910 14:106119662-106119684 AAGAAAGAGCAGTGAGAAGGAGG + Intergenic
1123675658 15:22708637-22708659 GAGAGAGAGGAGAAAGAAGAGGG + Intergenic
1124042903 15:26121194-26121216 AAAAGAATGCAGAGAGAAGATGG + Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124327652 15:28781583-28781605 GAGAGAGAGGAGAAAGAAGAGGG + Intergenic
1124952333 15:34335605-34335627 AAGAGAGAGAAGAGAGAAAATGG - Intronic
1125085896 15:35728809-35728831 CAGAGATAGCAGAGAAAAAGAGG + Intergenic
1125137291 15:36358276-36358298 AAGAGAGAGGAGAGAAAAGAAGG - Intergenic
1125200613 15:37098268-37098290 GAAAAAGAGCAGGGAGAAGAGGG + Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125550458 15:40540870-40540892 CAGAGAGCCCAGTGAGAAGCTGG + Intronic
1125698098 15:41656332-41656354 GAGAGAGAGAAGAGAGGAGAGGG - Intronic
1125770668 15:42163552-42163574 CAGAGAGATGAGAGTTAAGAAGG - Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1126764941 15:52002400-52002422 CTGAGAAAGCACAGATAAGATGG - Intronic
1126880279 15:53087329-53087351 CACAGCAAGCAGACAGAAGAAGG - Intergenic
1127108934 15:55646904-55646926 TAGGGACAGCAGGGAGAAGATGG - Intronic
1127293244 15:57588895-57588917 CAGAGATATAAGAGTGAAGAGGG + Intergenic
1127849413 15:62900010-62900032 CAGGGAGAGCACTCAGAAGACGG - Intergenic
1128034073 15:64507775-64507797 AATAGAGAGCAGAGGGAAGATGG + Intronic
1128143988 15:65322182-65322204 GAGAGGGAGCAGGGAGAAGAAGG - Intergenic
1128349133 15:66877488-66877510 CAGAGACAGGAGAAAGAAGCAGG + Intergenic
1129000019 15:72325026-72325048 GAGAGAGAGGAGAGGGGAGATGG - Intronic
1129210467 15:74065136-74065158 GAGAGAAAGCAAAGAGAAAACGG - Intergenic
1129231826 15:74201339-74201361 CAGACAGAGCAGGGAGATAAGGG + Intronic
1129237566 15:74232962-74232984 CAGAGAGGGGATAGAGAAGAGGG - Intergenic
1129403546 15:75300237-75300259 GAGAGAAAGCAGAGAGAAAATGG + Intergenic
1129452747 15:75659915-75659937 CAGAAAGAAAAGAGAGAGGAGGG - Exonic
1129568103 15:76646279-76646301 CAGAGAGAGGAATGAGAGGATGG - Intronic
1129910534 15:79222578-79222600 TAGAGAGAGCTGAGGAAAGAGGG - Intergenic
1130219534 15:82007601-82007623 CAAAGAGATCAGAGAAAGGAAGG - Intergenic
1130258681 15:82337787-82337809 GAGAGAAAGCAGAGAGAAAACGG - Intergenic
1130270004 15:82441297-82441319 GAGAGAAAGCAGAGAGAAAACGG + Intergenic
1130366439 15:83243972-83243994 CTGAGAGAGCAGAAAGCTGAGGG + Intergenic
1130384808 15:83401759-83401781 CAGAGAGAGCCAGGAGAGGAGGG + Intergenic
1130462337 15:84168610-84168632 GAGAGAAAGCAGAGAGAAAACGG + Intergenic
1130473958 15:84247532-84247554 GAGAGAAAGCAGAGAGAAAACGG + Intergenic
1130481370 15:84361600-84361622 GAGAGAAAGCAGAGAGAAAACGG + Intergenic
1130490335 15:84426175-84426197 GAGAGAAAGCAGAGAGAAAACGG - Intergenic
1130501927 15:84504933-84504955 GAGAGAAAGCAGAGAGAAAACGG - Intergenic
1130596239 15:85252172-85252194 GAGAGAAAGCAGAGAGAAAACGG + Intergenic
1130624912 15:85504274-85504296 CTGGGAGAGGAGAGAGGAGAGGG + Intronic
1130716035 15:86335472-86335494 CATAGAGAGTAGGAAGAAGAGGG + Intronic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1131035902 15:89221864-89221886 GAAAGAGGGCAGAGAAAAGAGGG - Intergenic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131603282 15:93872201-93872223 GTGAGAGAGCAGAGAGAAGAGGG - Intergenic
1131643931 15:94321627-94321649 TAGAGAGAGCACAGAGAAATTGG - Intronic
1131646273 15:94348466-94348488 CAGAGAGAGAGGAGAGAGAAAGG - Intronic
1131794973 15:96007006-96007028 GACAGAGAACAGAGAGATGAGGG - Intergenic
1131966266 15:97847231-97847253 GAGAGAGAACAGAGAGATGGAGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132185301 15:99798192-99798214 GAGAGAAAGCAGAGAGAAGCAGG + Intergenic
1132230778 15:100182249-100182271 AAGAGAGAGAAGAGCGAAGGCGG + Intronic
1132230970 15:100184007-100184029 CAGAGACAGCAGGGAGACAAGGG + Intronic
1132388857 15:101423732-101423754 CACAGAGAGTAGAAAGAAAATGG + Intronic
1132388966 15:101424921-101424943 CAGAGAGACGAAAGAGATGAGGG + Intronic
1132431686 15:101766370-101766392 GAGAGAAAGCAGAGAGAAGCAGG - Intergenic
1132500195 16:281588-281610 GAGAGCGAGCAGAGAGAGCAGGG - Intronic
1132541995 16:514523-514545 CTGAAAGGGCATAGAGAAGATGG + Intronic
1132635320 16:942466-942488 CAGAGAGAGGACACAGAAAATGG - Intronic
1133070611 16:3244298-3244320 GAAAGGGAGCAGAGAGAAGCTGG + Intronic
1133207597 16:4242621-4242643 GAGAGAGAGCACAGACCAGAGGG + Intergenic
1133364055 16:5197065-5197087 GAGAGAGAGCACAGAGAACACGG - Intergenic
1133440743 16:5819020-5819042 GAGAGAAAGCAGAGACAAGGAGG - Intergenic
1133554426 16:6891475-6891497 GAGAGAGAGAGGAGAGGAGAGGG + Intronic
1133668122 16:7990744-7990766 CACAGAGATAAGAGAGTAGAAGG - Intergenic
1135870619 16:26146665-26146687 CAGAGAGATCAAGTAGAAGAGGG - Intergenic
1135880519 16:26251259-26251281 CTGAGGGAGCAGAGAAAAGAAGG - Intergenic
1136083725 16:27869547-27869569 CAGAGAGGAGAGAGAGATGAAGG - Intronic
1136083783 16:27870101-27870123 CAGAGAGAGGAGAGAAGAGATGG - Intronic
1136382721 16:29903634-29903656 CAGAGAGAGGGAAGAGAGGAAGG - Intronic
1137027024 16:35486572-35486594 CAGGGACAGCAGGGAGGAGAGGG - Intergenic
1137362779 16:47834860-47834882 CAGAAGGAGAAGAGAGAAAAAGG + Intergenic
1137482950 16:48867497-48867519 CAGAGAGAGAAGGGAGGACAGGG - Intergenic
1137509880 16:49089930-49089952 GAGGAAGAGCAGAGAGGAGATGG - Intergenic
1137715547 16:50596107-50596129 CAGTGAGAGCAGTGAGAAGCAGG + Intronic
1137756065 16:50903365-50903387 AAAATAGAGCAGAGAGATGAAGG - Intergenic
1138068385 16:53965690-53965712 CAGAGAGAAAAGAGAGAATGAGG - Intronic
1138222372 16:55263572-55263594 CGGAGAGAGGAAGGAGAAGAGGG - Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138329753 16:56204217-56204239 AAGAGATAGCAGAGAGGATATGG + Intronic
1138637284 16:58351045-58351067 TGGAGAGAGTAGAGAGAAGGAGG + Intronic
1138891715 16:61150673-61150695 CAAGGAGAGCAGAGAGGAGCAGG - Intergenic
1139044571 16:63040979-63041001 GAGATAGAGGAGAGAGAAGGGGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139706941 16:68747307-68747329 CAGAAAGAGGAGGGAGGAGAGGG + Intronic
1139815830 16:69670903-69670925 CAGAGAGAGAAGAGAGAAACAGG + Intronic
1139958292 16:70703711-70703733 CAGAGAAACCAAAGAGAAGCTGG - Intronic
1140028144 16:71310778-71310800 CAGAGTGGGCAGAGACTAGAAGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140088395 16:71816782-71816804 CCGAGAAAGGAGAGTGAAGAGGG + Intergenic
1140133392 16:72183780-72183802 GGCAGAGAGGAGAGAGAAGACGG - Intergenic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140537883 16:75727458-75727480 CAAAGAGAGCAGAGAGGGGGAGG + Intronic
1140644652 16:77016240-77016262 CAGAAGGTGCAGAGAGTAGATGG + Intergenic
1140686208 16:77435652-77435674 GAGAGAGATCCGGGAGAAGAGGG - Intergenic
1140767164 16:78170819-78170841 TTGAGAAAGCAGAGAGATGAGGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1140824749 16:78695582-78695604 CAGAGAGAGCAGAGCCATGCTGG + Intronic
1140887640 16:79258897-79258919 GAGGGAGGGTAGAGAGAAGATGG + Intergenic
1140943610 16:79747108-79747130 GAGGGAGAAGAGAGAGAAGAGGG + Intergenic
1141026405 16:80552857-80552879 CAGAGAGAACAGAGCAAATAAGG + Intergenic
1141137242 16:81474374-81474396 AAGAGAGAGCGGAGAAAGGAAGG - Intronic
1141259419 16:82439164-82439186 AAGAGAAAGAAGAGAGAAGGAGG - Intergenic
1141267478 16:82509910-82509932 CAGAAAGAGCAAGGAGAAGCTGG - Intergenic
1141368705 16:83467670-83467692 CACAGACAGCAGAGGGCAGAAGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141883730 16:86877717-86877739 CAGAGAGACCAGAGAGAGAGAGG - Intergenic
1141910383 16:87054506-87054528 CACAGAGGGAAGAGAGGAGAAGG - Intergenic
1141932292 16:87214065-87214087 GAGGGAGAGCAGAGACAAGTTGG + Intronic
1142308868 16:89300475-89300497 CAGAGAGAGCAGAGTGCAGCAGG - Intronic
1142313090 16:89325436-89325458 GAGAGAGAGGAGAGGGGAGAGGG - Intronic
1142374026 16:89697673-89697695 CAGAGAGAGGAAGGAGAAGGCGG + Exonic
1142507939 17:377233-377255 CAGAGAGAGTGGGGAGAAGAGGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143037407 17:4007322-4007344 CAGAGGGAGTAGAGAAAACAGGG + Intronic
1143164066 17:4889212-4889234 CACAGAAAGCACAGAAAAGAGGG - Intronic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143424409 17:6822436-6822458 CAGAAAGAGCATAGAGAAAATGG - Intronic
1143528514 17:7486256-7486278 AGGAGAGACCAGAGAGAGGAGGG + Intronic
1143588930 17:7868256-7868278 AAGAGAGAGCACAGAAGAGAGGG + Intronic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143921742 17:10335864-10335886 CACCGGGAGCAGAGAGAAAAAGG + Intronic
1143936389 17:10489695-10489717 CAGAAGGAGAAGAGAGAAAAAGG - Intergenic
1144055908 17:11540320-11540342 AAAAGAGAGCAGAGAGATGGAGG + Intronic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144452581 17:15393397-15393419 CACAGAAAGAAGAGAAAAGAGGG - Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144575755 17:16428405-16428427 CAGAGACAGTTGAGAGAAGGAGG - Intronic
1144587372 17:16495384-16495406 CAGAGAGAGAAAAGGAAAGAAGG - Intergenic
1144591565 17:16528528-16528550 CACAGAGAGAAAAGAGCAGAGGG + Intergenic
1144746726 17:17620905-17620927 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1144759042 17:17696966-17696988 CAGAGAGAGGCTAGAGAAGAGGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144845576 17:18217067-18217089 AAGAGAGAGGAGAGAGAAAGAGG + Intergenic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1144951030 17:18993537-18993559 CATAGTGAGGAGAGAGAATATGG - Intronic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1145824485 17:27866622-27866644 GGGAGAGAGGAGAGAGAAAAGGG - Intronic
1145981934 17:29017998-29018020 CAGAAAGAGCAGGGACAAGAGGG - Intronic
1146532755 17:33623902-33623924 CAGAGAGAGAAGGCAGAGGAGGG - Intronic
1146711096 17:35042080-35042102 CAGAGAGAGGAGAGAGACCTTGG - Intronic
1146734351 17:35224921-35224943 CAGACAGATCAGACTGAAGAAGG - Intergenic
1147036315 17:37684097-37684119 CACAGAGAGCACTGGGAAGATGG - Intergenic
1147122455 17:38343676-38343698 CAGAGGGGGCAGAGAGCGGATGG + Exonic
1147159582 17:38562430-38562452 GAGGGAGGGCAGAGAGCAGAAGG - Intronic
1147177973 17:38668607-38668629 CAGACACAGAAGAGTGAAGAGGG + Intergenic
1147313468 17:39607777-39607799 GAGAGAGAGGGGGGAGAAGAGGG + Exonic
1147513779 17:41097080-41097102 AAGAGAGAGCAGGGAGAAAGCGG + Exonic
1147526590 17:41230404-41230426 AAGAGGAAGGAGAGAGAAGAAGG + Intronic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147559367 17:41499564-41499586 TGGAGAGAGAGGAGAGAAGAAGG + Intergenic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1147934136 17:44001815-44001837 CAAAGAGGACAGAGACAAGAAGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148080628 17:44966199-44966221 CAGGCAGAGGAAAGAGAAGAAGG + Intronic
1148214595 17:45827554-45827576 CAGAGAGGGGAGTGAGGAGAGGG - Intronic
1148521048 17:48275273-48275295 CAGGGAGATCAGAGAGAATAAGG - Intronic
1148563421 17:48619389-48619411 GAGAGGGAGAAGAGAGAAGCCGG - Intronic
1148761982 17:50009220-50009242 GAGAGAGAGCAGAAAGAATGAGG + Intergenic
1148869695 17:50649602-50649624 GAGAGAGAGGAGAGAGATGAGGG + Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149560657 17:57605757-57605779 CAGAGGCAGCTGAAAGAAGAGGG - Intronic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150494142 17:65594209-65594231 GAGAGAGAGAGGAGAAAAGAAGG + Intronic
1150719299 17:67600961-67600983 CATAGAAAGCATATAGAAGAGGG - Intronic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151441589 17:74132843-74132865 TACAGAGAGAAGAGAGAAGTGGG + Intergenic
1151467636 17:74297847-74297869 CATACAGAGCAGAGAGGAGTGGG - Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1151925026 17:77189243-77189265 CACAGAGAACAGAGAGCAGATGG + Intronic
1151925751 17:77194965-77194987 CAGAGCAAACAGAGAGAAAACGG - Intronic
1152018530 17:77768112-77768134 TAGAGCGAGAAGAGAGAAAATGG + Intergenic
1152105043 17:78323923-78323945 CACAGGAAGGAGAGAGAAGAGGG - Intergenic
1152157995 17:78647549-78647571 CATAGAGAGGAGAGAGAGGCAGG + Intergenic
1152368867 17:79872575-79872597 AAAAGAGAGAAGAGAGGAGAGGG - Intergenic
1152496907 17:80679813-80679835 AAGAGAAAGCAGAGAAAGGAAGG - Intronic
1152840330 17:82563408-82563430 CAGCGAGAAGAGAGAGAAGCAGG + Exonic
1153136283 18:1921000-1921022 CAGATACAGCAAAGGGAAGAAGG - Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153752535 18:8247976-8247998 CAGGGATAGCAGAGAGAGGGCGG - Intronic
1153987790 18:10368591-10368613 GAGGGAGAGCAGAGAGAGGGAGG + Intergenic
1154010442 18:10569455-10569477 CACAGAGACAAGAGAGAAGGAGG - Intergenic
1154050764 18:10954822-10954844 CAGAGAGAAATGAGAGAAGAAGG - Intronic
1154078454 18:11229421-11229443 TAGAGAAAACAGAGAGAAGGAGG - Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154157991 18:11959024-11959046 GAGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154236785 18:12613459-12613481 CTAAAGGAGCAGAGAGAAGAAGG - Intronic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155195407 18:23469430-23469452 GAGAGAGAGGAGAGAGGAGAGGG - Intronic
1155331732 18:24725821-24725843 GAGAGAGAGGAGAGAGATGGGGG + Intergenic
1155340852 18:24812688-24812710 CACAGAGAGAAGAGGGCAGAAGG - Intergenic
1155464378 18:26119688-26119710 CACAGAGAACAGAGAAAAGCAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155615941 18:27721480-27721502 AAGAGAGAGGAGGGAGGAGAAGG + Intergenic
1155724433 18:29062004-29062026 CAGAAAGAGAAGAGTGAAGAAGG - Intergenic
1155912218 18:31517040-31517062 CAGATTGAGCCAAGAGAAGAAGG + Intronic
1155984716 18:32218057-32218079 CATAGGAAACAGAGAGAAGAAGG - Intronic
1156037204 18:32778135-32778157 GAGAAAGAGCAGAGAGAACAAGG + Intergenic
1156454925 18:37287527-37287549 AAGAGAGAGGAGGAAGAAGAGGG - Intronic
1156463057 18:37332481-37332503 TGGGGAGAGCAGAGAGAAGGAGG - Intronic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1156524970 18:37758324-37758346 GAGAGACAGAAGAGAGAAGAGGG + Intergenic
1156775565 18:40784007-40784029 TAGAGAGAACACAGAGATGAGGG - Intergenic
1156958776 18:42997447-42997469 AAGAAAGAAGAGAGAGAAGAAGG + Intronic
1157078684 18:44497487-44497509 AAAAGACAGCAGAGAGAAGGAGG - Intergenic
1157119403 18:44895137-44895159 CAGAGAAAGAAAGGAGAAGAGGG + Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157439166 18:47696996-47697018 CAGAGAGAGCGTAGAGGAAAGGG - Intergenic
1157439197 18:47697134-47697156 CAGACAGGGCACAGAGAAGAGGG - Intergenic
1157769816 18:50335961-50335983 CAGGGAGATACGAGAGAAGAAGG + Intergenic
1158219956 18:55140304-55140326 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1158483795 18:57846509-57846531 CATTCAGAGCAGAGAGGAGAGGG + Intergenic
1158485216 18:57860145-57860167 CAGAAAGAGAAGAGAGAGAAAGG - Intergenic
1158667448 18:59445495-59445517 CTGACAGAGCAGTGACAAGATGG + Intronic
1159401011 18:67934124-67934146 AAGAGAGAGGAGAGAGCAGAAGG - Intergenic
1159726995 18:71973563-71973585 AAGAGAGAACAGAGGGAAAAGGG + Intergenic
1159798597 18:72869694-72869716 GAGAGAAAGCTGAGAGAAGGGGG + Intergenic
1159934317 18:74350243-74350265 TGGAGAGAACAGAGAGAGGAGGG - Intronic
1160008306 18:75084750-75084772 CAAAACGAGCAGAAAGAAGACGG + Intergenic
1160088791 18:75806506-75806528 GAGAGAGAGAGGAGAGAAGAGGG + Intergenic
1160100782 18:75917460-75917482 CCGAGAGAGAAGAGAGGGGAGGG - Intergenic
1160308196 18:77760965-77760987 AAGAGAGAGCAGTGAGGAGGAGG + Intergenic
1160951512 19:1669780-1669802 GAGAGAGAGGAGAGAGGGGAGGG - Intergenic
1160966586 19:1749441-1749463 CAGACAGAGCCCCGAGAAGAGGG + Intergenic
1161504046 19:4634470-4634492 GAGAGAGAGAGGAGAGAGGAGGG + Intergenic
1161657304 19:5524194-5524216 CACAGAGGTGAGAGAGAAGAGGG - Intergenic
1162180156 19:8863224-8863246 CAGAGAAATCAGGTAGAAGAGGG + Intronic
1162516198 19:11149283-11149305 CAAGGAGAGCAGAGAGAAGGTGG + Intronic
1162604116 19:11694107-11694129 GAGAGAGAGAAGGGAGGAGAGGG - Intergenic
1162719942 19:12656428-12656450 CAGAGGGAGAAGATACAAGAGGG + Intronic
1162860067 19:13499767-13499789 GAAAGAGGGCAGAGAGGAGAGGG - Intronic
1162905952 19:13824145-13824167 GAGAGAGAAGAAAGAGAAGAGGG + Intronic
1163207423 19:15813859-15813881 CAGAGAGAGGAAAGAGAGGTAGG + Intergenic
1163359517 19:16837038-16837060 GGGAGAGGGCAGAGAGAGGATGG + Intronic
1163377553 19:16942787-16942809 CAGAAAGAGCACAGAGACAAAGG - Intronic
1163770695 19:19189335-19189357 CAGAGAGGCCAGGGAGAAGGTGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164403600 19:27921411-27921433 CAGAGAGAGCTGAATAAAGATGG + Intergenic
1164465401 19:28483362-28483384 GAGAAAGAGGAGAGAGAAGAGGG - Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165102593 19:33447645-33447667 CAGAGGGAGCTGCGAGAGGACGG + Intronic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165269381 19:34691926-34691948 CAGAGAAAGCAGGGAAAGGAGGG + Intergenic
1165287334 19:34852959-34852981 CAGAGAGGGCAGGGAGAAAAAGG + Intergenic
1165384790 19:35503969-35503991 CAGAGTGAGGAGGGAGCAGAGGG - Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1165796599 19:38523529-38523551 GAGACAGAGATGAGAGAAGAGGG - Intronic
1165997666 19:39856051-39856073 CAGAGAAGGCAAAGTGAAGATGG - Intergenic
1166161884 19:40960316-40960338 GAGAGAGAGAAGAGAGAGAAAGG - Intergenic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1166685225 19:44792621-44792643 CAGAGAGGGCAAAGAGCTGATGG + Intronic
1166761618 19:45227887-45227909 TAGAGAGAGGAGAGATGAGAGGG - Intronic
1166935489 19:46329991-46330013 GAGAGAGTGAAGAGAGAGGAAGG + Intronic
1167083507 19:47293420-47293442 CAGAGAAAACCGAGAGGAGAGGG - Intronic
1167128450 19:47568213-47568235 CAGGGAGAGAAGGGAGAAGGTGG - Intergenic
1167255429 19:48425010-48425032 GAGAGAGAGAAGAGAGAATCTGG - Intronic
1167349662 19:48966567-48966589 CACAGAGCTGAGAGAGAAGAGGG - Exonic
1167459244 19:49615614-49615636 AACAGAGACCAGAGAGAGGAGGG + Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167623192 19:50569839-50569861 GAGAGAGAGAAGAAAGATGAAGG + Intergenic
1167636399 19:50658479-50658501 CGGTGAGATCAGAGAGAAGGAGG + Intronic
1167639369 19:50672233-50672255 AAGGGAGAGCAGTGTGAAGACGG + Intronic
1167650784 19:50727522-50727544 GAGAGAGTACAGAGAGATGAAGG - Intergenic
1167698185 19:51026985-51027007 CAGAGAGAGAAGAGTGGAGATGG - Intronic
1167728634 19:51236255-51236277 CAGAGGGAGCAAGGAGAAAATGG + Intronic
1167755973 19:51414099-51414121 TAGAAAGAGCAGAGAGCAGGAGG + Intronic
1168059038 19:53881014-53881036 CAGAGACAGAGAAGAGAAGAGGG + Intronic
1168059044 19:53881064-53881086 CAGAGACAGAGAAGAGAAGAGGG + Intronic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168509379 19:56961930-56961952 GAGAGAGAGAAGAGAAGAGAGGG - Intergenic
1168516123 19:57011585-57011607 AAGAGAGAGAGGAGAGAGGAGGG - Intergenic
924998741 2:386904-386926 GGGAGAGGGCAGAGAGCAGAGGG - Intergenic
925057564 2:866885-866907 CCTAGAGAGCAGAGAGGAAAGGG - Intergenic
925107714 2:1307465-1307487 GAGAGAGAAGAGAGAGAAGGAGG + Intronic
925540049 2:4957017-4957039 TAGAGAAAGCAGGCAGAAGAAGG - Intergenic
925931262 2:8709815-8709837 CAGAGAGAGGAAAGAGACGCAGG + Intergenic
926037008 2:9643732-9643754 CTGAGAGAGGAGAGAGGAGAGGG - Intergenic
926044747 2:9702382-9702404 GAAAGACAGGAGAGAGAAGATGG - Intergenic
926069788 2:9877835-9877857 GAGAGAGAGAGGAGAAAAGAGGG - Intronic
926251749 2:11158906-11158928 CAGGGAAAGCAGGGAGTAGACGG + Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926443191 2:12911456-12911478 TACAGAGAGGAGAGAGGAGAGGG + Intergenic
926456488 2:13073927-13073949 CAAGGAGAGCTGTGAGAAGAGGG - Intergenic
926689783 2:15725347-15725369 GAGAGAGAGGAGAGAGGGGATGG - Intronic
926838421 2:17050665-17050687 CACAGACAGCAGGGAGAAGAGGG - Intergenic
926885844 2:17597749-17597771 CACAGAAAGCACAGAGAAAATGG - Intronic
927113602 2:19881572-19881594 CAGAGAGAGCAGACAGACACTGG + Intergenic
927599725 2:24430397-24430419 GAGAGAGAGGAGAGGGGAGAAGG - Intergenic
927660278 2:24987556-24987578 AAGAGAGAGAAAAGAAAAGAAGG + Intergenic
927912166 2:26907453-26907475 TAGAGAGAGCCGTGAGATGAAGG - Intronic
928174689 2:29025817-29025839 CTGAGACAGGAGGGAGAAGAGGG - Intronic
928359504 2:30651620-30651642 CAGAGAGATCAGAGATGGGAAGG - Intergenic
928693159 2:33821454-33821476 CAAAGAGGGGAGAGAGAAAAAGG + Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929620234 2:43347337-43347359 GAGAGGGAGCAGACAGAACATGG - Intronic
929799060 2:45083839-45083861 TAGAGAGAGCAAAGATAAAATGG + Intergenic
929806977 2:45154712-45154734 GAGAGAGAGGAGAGAGAAAAAGG - Intergenic
929930995 2:46255367-46255389 AAGAGAGGCCACAGAGAAGAAGG - Intergenic
930030739 2:47056698-47056720 GAGAGAAAGCACAGAGGAGAGGG + Intronic
930036821 2:47091089-47091111 AAGAAAGAACAGAGAGAGGAAGG + Intronic
930225684 2:48790194-48790216 CAGACACAGCAGATGGAAGAAGG + Intergenic
930229148 2:48826492-48826514 CACAGAGAACAGAGAAAAGCCGG + Intergenic
930517611 2:52428301-52428323 CAGACAGAGCAAAGTGAGGAGGG - Intergenic
930752263 2:54945228-54945250 GAGAGAGGGGAGAGAGAAGGGGG - Intronic
930752272 2:54945258-54945280 GAGAGAGGGGAGAGAGAAGGGGG - Intronic
930793271 2:55357384-55357406 GAGAGAGAGGAGAGAGAGGAGGG - Intronic
931077695 2:58734992-58735014 GGGAGAGAGGAGAGAGAAGGAGG - Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932081873 2:68722984-68723006 AAAAGAGAGCAGAGAGGTGATGG - Intronic
932148753 2:69348725-69348747 GAGAGAGATCAGAGAGAAAGTGG - Intronic
932294226 2:70610709-70610731 AAGAGAGAGCAAAGAGGATATGG + Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932437893 2:71713637-71713659 TAGAGTAAGCAGAGAGGAGAAGG + Intergenic
932448051 2:71792599-71792621 CACACAGAGCAGGGAGAATAAGG - Intergenic
932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG + Intergenic
932639016 2:73423284-73423306 GAGAGGGAGGAGAGAGATGATGG - Intronic
932706672 2:74031318-74031340 CAGACAGGCCAGAGAGACGAGGG + Intronic
932745833 2:74332879-74332901 GACAGGGAGCAGAGAGAAAAGGG - Intronic
932939123 2:76141028-76141050 AAGAGAAAGCAGAGAGAATTAGG - Intergenic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933277685 2:80301317-80301339 CAAAGAGAGCAGTGAGCTGAGGG + Intronic
933578314 2:84095216-84095238 CAGAGAAAGCAGTGCTAAGAGGG + Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
933973210 2:87486876-87486898 CAGAGCAAGCAGAGAAAAGGTGG - Intergenic
934049943 2:88201295-88201317 GAGGGAGAGAAGAGAGAAGGAGG + Intergenic
934489666 2:94752724-94752746 CAGAGAGAGCAAAGGGAACTTGG - Intergenic
934578525 2:95418985-95419007 TACAGAGAGAAGACAGAAGATGG + Intergenic
934582933 2:95460627-95460649 TAGAGACAACTGAGAGAAGAGGG - Intergenic
934589115 2:95530485-95530507 CAGGGAGAGAAGCGAAAAGAGGG - Intergenic
934596517 2:95616087-95616109 TAGAGACAACTGAGAGAAGAGGG + Intergenic
934765763 2:96879250-96879272 AAGAGAGAGCCGAGAGGACAAGG - Intronic
934786248 2:97009475-97009497 TAGAGACAACTGAGAGAAGAGGG - Intronic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935047224 2:99493222-99493244 CAGAGAAAGGAGAGAGAACAGGG + Intergenic
935606762 2:104979373-104979395 CAGCGAGAGCAGAGTGAACAAGG - Intergenic
936022370 2:109004596-109004618 CACAGTGAGAAGCGAGAAGAGGG + Intergenic
936062017 2:109301159-109301181 CAAAGACAGCAGAGTCAAGAGGG + Intronic
936073791 2:109388826-109388848 GAGAGAGACTAGAGAGAAGGGGG + Intronic
936320511 2:111463337-111463359 CAGAGCAAGCAGAGAAAAGGTGG + Intergenic
936534294 2:113299875-113299897 TACAGAGAGAAGACAGAAGATGG - Intergenic
936891649 2:117377876-117377898 AAAAGAGAGGAGAGAGAAAAAGG + Intergenic
937329114 2:121013540-121013562 CAGTGAAAGCAGTGATAAGAGGG + Intergenic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
938111004 2:128564968-128564990 CAGAGAGATAAGAGAGAACTGGG - Intergenic
938165118 2:129019355-129019377 GAGAGTCAGCAGAGAGAAGGGGG + Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
939000507 2:136728515-136728537 CAGACAAAGAACAGAGAAGAGGG - Intergenic
939027990 2:137036939-137036961 CAGAGAAGGAAGAGAGAAGGGGG - Intronic
939197604 2:138991790-138991812 GAGAGACAGCAGAGAGCAAAGGG + Intergenic
939223834 2:139339759-139339781 GAAAGATAGCAGAGAGAAGGAGG + Intergenic
939513624 2:143139006-143139028 AAGAGAGACCAAAAAGAAGATGG - Intronic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
940102951 2:150062910-150062932 GAGAGAGAGGAGAGAGAGGTAGG + Intergenic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
940832870 2:158487785-158487807 GAGAGAGAGAAGAGAGAGAAGGG + Intronic
940832872 2:158487787-158487809 GAGAGAGAAGAGAGAGAAGGGGG + Intronic
941198299 2:162477477-162477499 CAGAGATAGAATAGAGAAGGAGG + Intronic
941244078 2:163075053-163075075 CAGGGAGTTCAGAGAGAAGCTGG - Intergenic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
941612457 2:167678120-167678142 CCCAGAGAGCAGATAGAAGGTGG - Intergenic
941664036 2:168226000-168226022 CAGGGAAAGAAGAGAGAAGCTGG + Intronic
941667373 2:168255863-168255885 CAGAGAAAAGAGAGAGCAGAAGG + Intergenic
941670194 2:168284630-168284652 GAGAGAGAGAATAGAGATGAAGG - Intergenic
941841587 2:170090813-170090835 AAGGGAGAGGAGAGAGAATATGG + Intergenic
942113066 2:172701034-172701056 GAGGGAGAGGAGGGAGAAGAGGG + Intergenic
942227313 2:173828765-173828787 GGGAGAGAGCACAGAGAGGAAGG - Intergenic
942248796 2:174030764-174030786 CAGGGAGAGCACAGAGAAAGAGG + Intergenic
943178882 2:184515993-184516015 TAGAGAGACTAGAGAGAAGCAGG + Intergenic
943355297 2:186848527-186848549 CAGAGTGAGCAAAGAGTAAAGGG + Intronic
943413080 2:187564976-187564998 AAGAGAGAGTAGAGAAAAGGAGG + Intronic
944075311 2:195723025-195723047 CAGAAACTGCAGAGAGAAAAAGG - Intronic
944408526 2:199413471-199413493 CAGAGAAGGCAGAGAGCAGAGGG - Intronic
944626787 2:201578225-201578247 GAGAGGGAGGAGACAGAAGATGG + Intronic
944865185 2:203852861-203852883 AAGAGAGAGAGGAGGGAAGAGGG - Intergenic
945050530 2:205819983-205820005 CAGAGAGAAGAGAGAGAGGAGGG - Intergenic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945326586 2:208489219-208489241 CAGAGAGAGTGCAGAGAAAAAGG - Intronic
945355068 2:208830630-208830652 CAAACAGAGTAGAGAGAAAAAGG + Intronic
945502065 2:210588677-210588699 CTGAGAGAGGAGTGAGGAGAAGG - Intronic
946070100 2:217027105-217027127 CCAAGAGAGCAGAGTGAAAATGG - Intergenic
946214084 2:218170128-218170150 AAGAAAGTACAGAGAGAAGATGG - Intergenic
946554432 2:220839392-220839414 AAGGGAGAGGAGAAAGAAGAAGG + Intergenic
946576786 2:221084267-221084289 CAGAGAGAGCAAAGAGCTGCTGG + Intergenic
946774556 2:223124153-223124175 CAGAGAGGAAAGGGAGAAGAGGG - Intronic
946918317 2:224550069-224550091 CACAGAGACAAGAGAAAAGAGGG - Intronic
946924869 2:224616558-224616580 CAGAGGGAGTAGGGAGATGAGGG - Intergenic
947106056 2:226668894-226668916 CAGAGATAGCAGTGTGCAGAAGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947435593 2:230069326-230069348 CAGAAAGAGCAGGGAGAGGTGGG - Intergenic
947534642 2:230933189-230933211 CAGAGAGGGCGGAGGGAAGGGGG - Intronic
947701161 2:232235155-232235177 CATTTAGAGCAGAGAGAGGAAGG - Intronic
947835284 2:233170567-233170589 CACAGAGAGGAGGGAGCAGAAGG + Exonic
948161442 2:235828053-235828075 CAGAGAAAGATGAGAGCAGATGG + Intronic
948197844 2:236108353-236108375 CAGAGGAAGGAGAGAAAAGAGGG - Intronic
948334723 2:237199004-237199026 CAGAGAGGACAGAGACAAGCTGG - Intergenic
948382001 2:237557143-237557165 GAGAGAGAGGAGAGAGAGAACGG - Intergenic
948742426 2:240056668-240056690 CAGGAAGAGCAGAGAGGAGGAGG + Intergenic
948819439 2:240532043-240532065 GAGAGAGAGGAGAGAGAATGAGG + Intronic
948891658 2:240909798-240909820 CAGAGTGAGCAGGGAGCAGGCGG + Intergenic
948963715 2:241359645-241359667 CAGAGAGAGCAGAAAGAAAGAGG - Intronic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
949072292 2:242033029-242033051 GAGAGAGGGCAGAGGGTAGACGG + Intergenic
1168912317 20:1458785-1458807 CACAGAGACCAGAGAGTTGAAGG + Intronic
1168949699 20:1788478-1788500 AAGAGAGAGGAAAGAAAAGAAGG + Intergenic
1169352306 20:4878913-4878935 CAAAAAGATCAGAGAGGAGAGGG - Intronic
1169550834 20:6699602-6699624 GAGAGAGAGGGGAGAGAGGAAGG - Intergenic
1169676746 20:8163244-8163266 GAGACAGTGCAGAGAGGAGAGGG + Intronic
1169963619 20:11190941-11190963 CAGAGAAAAGAGAGAGCAGAAGG + Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170014792 20:11768497-11768519 CAGGAACAGGAGAGAGAAGAGGG + Intergenic
1170043830 20:12065359-12065381 CAGAGACTACAGAGAGATGATGG - Intergenic
1170329519 20:15193127-15193149 GAGAGAGAAGAGAAAGAAGATGG - Intronic
1170370188 20:15639863-15639885 AAGAGAGAGGAGAGAGATGTAGG + Intronic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1170382151 20:15772701-15772723 AAGAGAGAGAAGAAAGAAGGAGG + Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170819224 20:19742067-19742089 AGGAGAGAGCACAGAGAAGCTGG - Intergenic
1170948540 20:20913174-20913196 TGGAGAGAGCAGAGAGAGTAGGG + Intergenic
1171063215 20:21986890-21986912 CAGAGACTCCAGAGAGAACACGG + Intergenic
1171105743 20:22430764-22430786 CAGAAAGACAAGAGAGAAGTAGG + Intergenic
1171174656 20:23042446-23042468 GAGGGGGAGCAGAGAGCAGAGGG - Intergenic
1171465683 20:25326140-25326162 AAGAAAGAGAAGAGAGAGGAAGG + Intronic
1172011113 20:31846468-31846490 GAGAGAGAGGAGAGAGAGGCAGG + Intergenic
1172061901 20:32192125-32192147 AAGACAGAGCAGAGAGAAATAGG + Intergenic
1172221272 20:33276686-33276708 CAGAGAGAGGAGAGAGACAGTGG + Intronic
1172329096 20:34062249-34062271 CAGAGAAAGTAGAGAGTAAAAGG - Intronic
1172571742 20:35975920-35975942 GAAAGAGGGCAGGGAGAAGAGGG - Intronic
1172718698 20:36983115-36983137 AAGAGAGAGCAGAGGAGAGAAGG - Intergenic
1172783557 20:37451411-37451433 CAGAGAGAGAAGACAGAGCATGG - Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172927471 20:38551904-38551926 TGGAGAGACCAGGGAGAAGAAGG + Intronic
1172991555 20:39040613-39040635 GTGAGAGGGCAGAGAGAAGCTGG + Intergenic
1173367700 20:42402130-42402152 CAGAGAGAGCACAGAGGTGTGGG + Intronic
1173436115 20:43033719-43033741 CAGATGAAGCACAGAGAAGATGG + Intronic
1173475312 20:43354995-43355017 CAGAAAAATCAGAGAGAAAAAGG + Intergenic
1173706900 20:45116650-45116672 AAGAGAGAGAGGAAAGAAGAAGG - Intergenic
1174118939 20:48247982-48248004 CATAGAGAGCAAAGAGCAGAGGG - Intergenic
1174478686 20:50815592-50815614 CGGGGAGAGGGGAGAGAAGACGG - Intronic
1174508992 20:51036901-51036923 CAGCAAGATCAGAGAGAGGAAGG - Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174686916 20:52465099-52465121 CAGGGAAAGCAGAGACAAGCTGG - Intergenic
1174791294 20:53480758-53480780 CAGAGAGTGAAGAGAGAAGGGGG + Intronic
1174864191 20:54119845-54119867 AAGAGAGAGAGGAGAGGAGAGGG + Intergenic
1174886662 20:54343103-54343125 GAGAGAAAGGAGAGCGAAGAAGG - Intergenic
1174905243 20:54543601-54543623 GAGAGAGAGGAGAGAGAGGAGGG + Intronic
1175239904 20:57539396-57539418 CACAGGGAGGAGAGAGGAGAAGG - Intergenic
1175411059 20:58769349-58769371 GAGACACGGCAGAGAGAAGATGG - Intergenic
1175453618 20:59092481-59092503 CAGAGATAGCAGAGATACTAAGG - Intergenic
1175469881 20:59220004-59220026 GAGAGAGAGAAAAGAGGAGAGGG + Intronic
1175685777 20:61027683-61027705 AAGAGAGAGCAGAGAGAGAGAGG - Intergenic
1175891569 20:62318210-62318232 AAGAGGGAGGAGAGAGGAGAAGG + Intronic
1176057038 20:63154470-63154492 GAGGGAGAGGAAAGAGAAGAGGG + Intergenic
1176270545 20:64233581-64233603 GAGAGAGAGCAGAGAAAAAAAGG + Intronic
1176719115 21:10379081-10379103 CAGAGAGGGGAGAGAGAGGGGGG - Intergenic
1176920604 21:14683599-14683621 GAGAAAGAGAGGAGAGAAGAAGG + Intergenic
1177077563 21:16596310-16596332 CAGAGCCAGCAGAGAGAACTTGG - Intergenic
1177366375 21:20143380-20143402 CTCAGAGAGCAGAGAGAAATAGG + Intergenic
1177498624 21:21920853-21920875 CAGAGTGTGCAGAGAAGAGAGGG + Intergenic
1177593133 21:23199956-23199978 CAGAAAGAGAAAAGAGAACAAGG - Intergenic
1178308431 21:31509634-31509656 CACAGAGAGGAGAGAGAGGCAGG + Intronic
1178505272 21:33157462-33157484 GAGAGAGAGAAGAGAGAGGAAGG - Intergenic
1178505743 21:33161599-33161621 AAAAGAGAGCAGAGAGCAGGGGG - Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178778754 21:35578895-35578917 AAGAGAGAGAAGAGAGAGGAAGG + Intronic
1179053191 21:37906818-37906840 AAGAGAGGGCAGAAAGAGGACGG - Intronic
1179097644 21:38329819-38329841 GAGAGAGTACAGGGAGAAGAAGG - Intergenic
1179296235 21:40065358-40065380 GAGAGAGTGCAAAAAGAAGATGG + Intronic
1179310651 21:40193043-40193065 CGGAGATTGGAGAGAGAAGAGGG + Intronic
1179432496 21:41333457-41333479 CAGAAACAAGAGAGAGAAGAGGG - Intronic
1179463924 21:41558144-41558166 AACAGAGAGGTGAGAGAAGAAGG + Intergenic
1179646988 21:42782113-42782135 AAGGGAGAGGAGAGAGGAGAGGG - Intergenic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181735713 22:24879918-24879940 CAGAAAGAGCAGAAAGAGTAAGG + Intronic
1181911680 22:26243401-26243423 CAGAGAGAGCTGAGTGAATGAGG + Intronic
1181983043 22:26779842-26779864 CAGAGAGAACAGAGTGCACAAGG - Intergenic
1181999064 22:26905243-26905265 TAAAGAGAGGAGAGAGGAGAGGG + Intergenic
1181999124 22:26905713-26905735 CAGAGAGAGAAGAGAGGGGAGGG + Intergenic
1182073071 22:27476957-27476979 CAGAGACAGCAGACAGAAGCAGG + Intergenic
1182547741 22:31085503-31085525 CAGCGAGGGCAGAGAGTACACGG + Intronic
1182741730 22:32572565-32572587 GAGAGAGAGAAGAGAAGAGAAGG - Intronic
1182747665 22:32617881-32617903 CAGAAACAGCATAGAGGAGAAGG - Intronic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
1183050070 22:35253742-35253764 CTGAGAGAACAGAGTTAAGAGGG + Intergenic
1183354556 22:37351207-37351229 GAGGGAGAGAAGAGAGAAGAGGG - Intergenic
1183449794 22:37886846-37886868 GTGAGAGATCTGAGAGAAGAGGG + Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183583304 22:38738269-38738291 CAAAGAGAGCGGAGGGAAGTGGG + Intronic
1183719271 22:39552897-39552919 CAGAGAGAAAAGAGTGGAGAGGG - Intergenic
1183837065 22:40463298-40463320 CAGAGAGAGAGGAGAGATGAGGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184117805 22:42432200-42432222 GCGAGAGAGTAGAGAGAAGGAGG + Intronic
1184175762 22:42787997-42788019 GAGAGAAAGCGGAGAGAAAACGG + Intergenic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184533295 22:45070529-45070551 CAGAGAAAGGAGACAGCAGAGGG + Intergenic
1184837957 22:47035237-47035259 CAGAGAGAGCAGGTACAAGCAGG - Intronic
1184949909 22:47833922-47833944 CTGAGATTGCAGAGAGGAGACGG + Intergenic
1184958967 22:47914972-47914994 CAGAGAGAGAGGAGAAAGGAAGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185127726 22:49021177-49021199 CAGAGGGGGCAGAGAGCAGCGGG - Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949284375 3:2383730-2383752 GAGAGGGAGAAGAGAGAAGAGGG - Intronic
949284377 3:2383746-2383768 GAGAGGGAGAAGAGAGGAGAGGG - Intronic
949419704 3:3852818-3852840 CAGAGAAAAAAGAGAGTAGAAGG - Intronic
949460798 3:4291371-4291393 GAGAGAGAGCAGAGATGAGGGGG - Intronic
949654006 3:6195538-6195560 GAGAGAGAGAAAACAGAAGAAGG - Intergenic
949996906 3:9625110-9625132 CAGAAAGTGGAGACAGAAGAGGG - Intergenic
950063731 3:10094007-10094029 GAGTGAGAGCATAGAGTAGAGGG - Intronic
950118162 3:10464535-10464557 CAGGCAGAGAAGAGAGGAGAGGG - Intronic
950460887 3:13121704-13121726 AAAAGAGAGCAGAGAGAATGGGG + Intergenic
950566569 3:13772960-13772982 CAGAAAGAGCAGAGACAGGCAGG - Intergenic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
951182213 3:19671852-19671874 CATTGAGAGCAAAGAGAAGGAGG - Intergenic
951206838 3:19934332-19934354 GAGACAGAGGAGAGAGAAGAGGG - Intronic
951206842 3:19934363-19934385 GAAACAGAGGAGAGAGAAGAGGG - Intronic
951206847 3:19934394-19934416 GAGAGAGAGGAGAGAGAAGGGGG - Intronic
951485512 3:23204157-23204179 GAGAGAGATCGGAGAAAAGAGGG - Intronic
952269351 3:31817038-31817060 CAGCCAGAGCAGGGAGAGGATGG - Intronic
952482532 3:33776245-33776267 GAGAAAGAGGAGAAAGAAGAAGG - Intergenic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952974089 3:38679361-38679383 CAGAGACAGCAGCTAGAAGAGGG + Intergenic
953041603 3:39260053-39260075 GGGAGAGAGCAGAGAGCTGATGG - Intergenic
953064119 3:39453748-39453770 CAGGGAGAAAACAGAGAAGATGG + Intergenic
953127491 3:40105763-40105785 CAGAGAGAGAAGAGTGAGGCAGG + Intronic
953386604 3:42509854-42509876 AAGAGAGGGCACAGAGAGGAGGG - Intronic
953658298 3:44871497-44871519 CTTGGAGAGCAGAGAGCAGAGGG + Intronic
953772622 3:45790619-45790641 CAAGGAGAGCAGAGAACAGATGG - Intronic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954301228 3:49701813-49701835 CAAAGAGAGCACGGAGATGAAGG + Exonic
954416897 3:50397731-50397753 CAGAAAGAGCAGATAGCAGCAGG - Intronic
954692515 3:52403188-52403210 CACGGACAGCAGAGAGAAGACGG - Exonic
954881594 3:53839397-53839419 GAGAGAGATGAGAGAGAGGAAGG + Intronic
955146688 3:56326819-56326841 CACAGAGAGCAGAGGAATGATGG - Intronic
955195413 3:56801368-56801390 CTGAGAGTCCAGACAGAAGATGG + Intronic
955461201 3:59185158-59185180 CAGAGAGAGCTGGCAAAAGAGGG + Intergenic
955509271 3:59663174-59663196 GATAGAGAGCAAATAGAAGAGGG + Intergenic
955960653 3:64338039-64338061 CAGAGAGAGCCTAAAGAAAATGG - Intronic
956192711 3:66622488-66622510 CAGAGAGAGCAGAGGAAAGTGGG - Intergenic
956235800 3:67069507-67069529 CAGACAGAGCACATGGAAGAGGG + Intergenic
956245170 3:67174889-67174911 GACAGAGAGCAGAGCGAAGAAGG - Intergenic
956252282 3:67247137-67247159 CACAGAGAGCAGACAGAGAAAGG - Intergenic
956657539 3:71566917-71566939 CTGAGAGCCCAGGGAGAAGATGG - Intronic
956693108 3:71895832-71895854 AACTGAGAGTAGAGAGAAGATGG + Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957174344 3:76786468-76786490 CAGAAAGAAGAGAGAGAAGGGGG + Intronic
957295094 3:78325087-78325109 AAGAGAGAGTAGAGAAAGGAGGG - Intergenic
957307186 3:78472847-78472869 CACAGAGAGCAGAGAAGAAAAGG + Intergenic
957612288 3:82483739-82483761 CAAAGAGAGAACAGAGAAAAAGG + Intergenic
957683502 3:83470124-83470146 CAGAGAGAGTAGACACATGAAGG + Intergenic
957925139 3:86799385-86799407 CAGAAAGAACATAGAGAAAAGGG - Intergenic
958665047 3:97126845-97126867 CAGTAAGAGCATAAAGAAGATGG + Intronic
958988598 3:100813727-100813749 CAGTCAGAGCTGAAAGAAGAGGG + Intronic
959060038 3:101608318-101608340 CAGAGGGAGGGGAGAGAAAAAGG - Intergenic
959254100 3:103989163-103989185 CACACAGAGGAGAGAAAAGAAGG - Intergenic
959513123 3:107235709-107235731 AAGATAGAGCAGGGAGTAGATGG - Intergenic
959946737 3:112133237-112133259 CAGAGACAGCAGAAAGGAGAAGG + Exonic
960052105 3:113248950-113248972 CACCGGGAGCAGAGAGAAGTGGG + Intronic
960223709 3:115146829-115146851 CGCAGGGAGTAGAGAGAAGAAGG + Intronic
960269634 3:115659620-115659642 GAGAGAGAGAAAAGGGAAGAGGG + Intronic
960365512 3:116766835-116766857 CAAAGAAATCAGATAGAAGATGG - Intronic
960585448 3:119316943-119316965 CAGGGAGAGCAAAGACAGGAGGG - Intronic
960727158 3:120682108-120682130 CACATAGAGGAGAGAGAAAATGG - Exonic
961352141 3:126310920-126310942 GAGAGAGAGCAGGGTGGAGATGG - Intergenic
961392384 3:126560623-126560645 CAGAGAAAGCAGTGCTAAGAGGG - Intergenic
961466336 3:127084217-127084239 CAGAGAGAACAAAGAGAGAACGG - Intergenic
961546798 3:127639940-127639962 CAGAGACAGCATAGAGCAGTAGG - Intronic
961718861 3:128878914-128878936 CAGAGAGAGCTGAGAAGAGATGG - Intergenic
961745827 3:129062887-129062909 GAGAAAAAGGAGAGAGAAGACGG - Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962432617 3:135333862-135333884 AAGAGAGAGAACAGAGAAAATGG - Intergenic
962611962 3:137085231-137085253 AAGAAAGAGTAGAGAGAAGCAGG + Intergenic
962646382 3:137444933-137444955 AAGAGGGAGCTGTGAGAAGAGGG - Intergenic
962932860 3:140053646-140053668 GAGAGAGAGGAGGGAGATGAGGG - Intronic
963057709 3:141200963-141200985 CAGACAAGCCAGAGAGAAGAAGG + Intergenic
963098047 3:141566766-141566788 TAGATAGAGAATAGAGAAGATGG + Intronic
963128231 3:141834635-141834657 GAGAGAAAGAAGAGAGGAGAGGG - Intergenic
963259031 3:143175777-143175799 CAGAGAGAGGTCAGAGAAGAAGG + Intergenic
963445340 3:145398325-145398347 GAGAGAGAGGAGAGAGGAGAAGG + Intergenic
963497940 3:146092582-146092604 CAGAGAGATCTGAAAGAAAATGG - Intronic
963631327 3:147734054-147734076 CAGAGAGAAGAGAAAAAAGAAGG - Intergenic
963805089 3:149714527-149714549 CAGAGAGGGCAGAGATGACAGGG - Intronic
964133676 3:153319040-153319062 CAGAGAGAGAGGAGAGAAAGAGG + Intergenic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964416604 3:156454477-156454499 CAGAGAGGGCTGACAGAGGAAGG + Intronic
964494918 3:157278404-157278426 CAAAGAGAGCAGAGGGAATGTGG + Intronic
964633959 3:158841205-158841227 CTGAGAAAGCAGAAAGCAGATGG + Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965120781 3:164553308-164553330 TAGAGAGAGAAGGGAAAAGAAGG - Intergenic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965426602 3:168532139-168532161 CACAGAGAGCAGAGAGTACCTGG + Intergenic
965459765 3:168947553-168947575 CAGAGAGACCAGCTAGAAGCTGG + Intergenic
965521392 3:169670966-169670988 GAGAGAGAGGAGAGAGAGAATGG + Intergenic
965652234 3:170946813-170946835 GAGAGAGAGAGGAGAGAGGAGGG + Intergenic
965652257 3:170946891-170946913 GAGAGAGAGAGGAGAGAGGAGGG + Intergenic
965961748 3:174437555-174437577 CTCAGAGAGGGGAGAGAAGAAGG - Intergenic
966002942 3:174972452-174972474 TAGAGAGCGCAGAGAGAAGGTGG - Intronic
966307131 3:178549235-178549257 TAGAGAGAAGAGAGAAAAGAAGG + Intronic
966317479 3:178664324-178664346 TGGAGAAAGCAGAGATAAGAGGG + Intronic
966433557 3:179858438-179858460 GAGAGAGAGAAAAGGGAAGAGGG - Intronic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
966888674 3:184390596-184390618 GAGGGAGGGGAGAGAGAAGAGGG - Intronic
966908176 3:184542721-184542743 CAGAGAGGGGAGAGAGAGAAGGG + Intronic
966960939 3:184938058-184938080 CAAATGGAGGAGAGAGAAGAAGG + Intronic
966986390 3:185184163-185184185 GAAAGAGAGGAGAGAGAAGCAGG + Intergenic
967133832 3:186496580-186496602 CTGAGAGAGCTGGGAAAAGAAGG - Intergenic
967347446 3:188473692-188473714 AAGAAAGAGCAGAGAAATGAGGG - Intronic
967655911 3:192048509-192048531 CAAACAGAACAGAGAGAACAAGG + Intergenic
967674032 3:192274568-192274590 AAGAGAGAGGAGAGAGAAGAGGG + Intronic
968191419 3:196670475-196670497 CAGAGAGAGCAAGGAGGAGGGGG + Intronic
968264763 3:197354468-197354490 CAGAGAGAGCAGAGTGTTAAAGG + Intergenic
968339216 3:197941158-197941180 GAGAGAGAGGAGAGAGAGGAAGG - Intronic
968719153 4:2187077-2187099 AAAAGAGAGAAGAGAAAAGAAGG + Intronic
968787122 4:2630918-2630940 CAGAGCCTGCACAGAGAAGAGGG - Exonic
968934283 4:3601843-3601865 GGGAGAGAGAAGAGAGAAGCAGG - Intergenic
968957440 4:3726456-3726478 GAGGGAGAGGAGAGAGAGGAAGG + Intergenic
968978661 4:3835056-3835078 GAGAGAGAGAAGAGGGAAGGAGG + Intergenic
969159155 4:5240040-5240062 GAGAGAGAGAAGAGAAATGAAGG - Intronic
969179614 4:5427922-5427944 CAAAGTAAGCAGAGAGAAGGAGG - Intronic
969425482 4:7121590-7121612 GAGAGAGAGGAAAGAGGAGACGG - Intergenic
969453616 4:7288591-7288613 AAGAGAGAGGAGAGAGGAGAGGG + Intronic
969603549 4:8190555-8190577 GAGAGAGTGCACAGAGGAGAAGG - Intronic
969654264 4:8487348-8487370 AAGAGAGAGTAGAGACAAGGAGG + Intronic
969828718 4:9778736-9778758 CAGATAGAGCAGAGGGAGAAAGG + Intronic
970172567 4:13304410-13304432 AAGAGAGAGAGGAGAGGAGAGGG + Intergenic
970224000 4:13838324-13838346 CAGAGAGAGAAAAGATGAGATGG - Intergenic
970224426 4:13842785-13842807 GAGAGAGAAGAGAGAGAAGGAGG - Intergenic
970485538 4:16521100-16521122 CAGGGAGATTAGAGAGAAGCAGG + Intronic
970907445 4:21232877-21232899 CAGGGACAGCAGAGAGAATGAGG + Intronic
971259403 4:25042769-25042791 GAGAGAGAGCAGAGCAAAGATGG + Intergenic
971311565 4:25529913-25529935 AAGAAAGAGAGGAGAGAAGAAGG + Intergenic
971348178 4:25831013-25831035 CAGATAGAATAGAAAGAAGAAGG + Intronic
971425158 4:26508724-26508746 AAGAGAGAAAAAAGAGAAGAGGG - Intergenic
971540140 4:27805718-27805740 CAGAGACAGGGCAGAGAAGAAGG - Intergenic
971849674 4:31968090-31968112 GGGAGAGAAGAGAGAGAAGAGGG - Intergenic
972167986 4:36310863-36310885 AAGAGAGAGGAGGGAGAGGAAGG + Intronic
972401670 4:38710003-38710025 TATAGAGAGCAGGGAGCAGAAGG + Intergenic
972930869 4:44070639-44070661 CAGAGAATGCAGAGAGAAATTGG + Intergenic
973094045 4:46175170-46175192 CAGAAAGGGAAGAGAGAAGGAGG + Intergenic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
973235486 4:47898470-47898492 AAGAGAGGGGAAAGAGAAGAAGG + Intronic
973319845 4:48798884-48798906 GAGAGAGGGGAGAGAGAAAAAGG + Intergenic
973589227 4:52423942-52423964 GAGAGAGAGAAGAGGAAAGAGGG + Intergenic
973603051 4:52560838-52560860 GAGAGAGAGGAGAGAGATTAAGG - Intergenic
974074296 4:57154834-57154856 CAGGGAGAGGAAAGAGAAGAGGG - Intergenic
974152586 4:58028442-58028464 CAAAGACAGCAGAAAGAAGTGGG - Intergenic
974166628 4:58212882-58212904 CAAAGAGTGCAGGGTGAAGAGGG + Intergenic
974373706 4:61049374-61049396 CAGATAGAGCAGATAGAGCAAGG + Intergenic
974549527 4:63353000-63353022 AAGAGAGAGCAGAGAGGAAAGGG - Intergenic
974867235 4:67596221-67596243 AAGAGAGAGCACAGGGAAAATGG - Intronic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975648818 4:76571991-76572013 TGGAGGAAGCAGAGAGAAGATGG - Intronic
975762049 4:77630221-77630243 CAAAGAGAGGGGAGAGATGAGGG + Intergenic
976616080 4:87078627-87078649 CACAGATGGAAGAGAGAAGAGGG + Intronic
976690836 4:87865529-87865551 GAGGGAGAGAAGAGAGAAAAAGG - Intergenic
976838870 4:89407798-89407820 CAGAGAGAGGACAGGAAAGAAGG + Intergenic
976894044 4:90085708-90085730 CTGAGAGAGAAGAGGGAATAGGG - Intergenic
977060856 4:92255307-92255329 CATGGAGAGCAAAGAAAAGAGGG - Intergenic
977233621 4:94480774-94480796 CAGAGAGGGCAGAGAAAAGCAGG + Intronic
977398258 4:96498665-96498687 TAGAAAGAGCAGAGGGAAGGAGG + Intergenic
978202916 4:106044201-106044223 CTGAGAAAGCAGAGAAGAGAGGG - Exonic
978952218 4:114574377-114574399 GAAAGAGAGAAGAGAGAGGAAGG - Intergenic
978999868 4:115203147-115203169 GGGAGAGGGCAAAGAGAAGAGGG - Intergenic
979132912 4:117070898-117070920 CAGAGAGGGAGGAGAGAAAATGG - Intergenic
979185771 4:117790592-117790614 AAGAGAGAGGGAAGAGAAGATGG - Intergenic
979239170 4:118433324-118433346 CACAATGAGCAGAGACAAGACGG + Intergenic
979440811 4:120748226-120748248 CAAAGACAACAGAGATAAGAAGG + Intronic
979533689 4:121795768-121795790 TAGAAAGAGCAGGGAGAAGGAGG + Intergenic
979926067 4:126566211-126566233 AAGAGCGGGAAGAGAGAAGAGGG + Intergenic
980084594 4:128378233-128378255 AGGAGAGAGAAGAGGGAAGAAGG + Intergenic
980140468 4:128909997-128910019 CAGAGAAACCAGAGTGAAGGCGG + Intronic
980497237 4:133602219-133602241 AAAATAGAGCAGAGTGAAGATGG + Intergenic
980796473 4:137690662-137690684 CACAGCCAACAGAGAGAAGAAGG - Intergenic
980973925 4:139592748-139592770 CAGAGAGAACAGTGTGAAAAAGG + Intronic
981013744 4:139952250-139952272 CAGATAGAGCCAAGAAAAGAGGG - Intronic
981144601 4:141309829-141309851 CAGAGAGAGCAGACAGCAGGAGG + Intergenic
981221011 4:142234913-142234935 CATAAAGAGAAGAGAGAAGAGGG + Intronic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981811391 4:148779889-148779911 GTGAGAGAGGAGAGACAAGAAGG - Intergenic
981949790 4:150392377-150392399 AAGAGAGAGCAGAGTGAGTAGGG + Intronic
982194783 4:152900032-152900054 CAGATAGCAGAGAGAGAAGATGG + Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982339343 4:154278694-154278716 CAGAGACAGTAGAGATCAGAAGG + Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
982764909 4:159335207-159335229 CATAGAGAGGAAGGAGAAGATGG + Intronic
982847012 4:160266915-160266937 CAGAGAGTTTAGAGAGAAGGAGG - Intergenic
983289736 4:165786703-165786725 CAGAGACCACAGAGACAAGAAGG - Intergenic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983532464 4:168825258-168825280 GAGAGAGAAGAGAGAGAATAAGG - Intronic
983569361 4:169187961-169187983 CAGAGACATCAGAGTGAAGAAGG + Intronic
984090465 4:175368321-175368343 CTGAAAGGGCAGAGAGAAAATGG - Intergenic
984179564 4:176464958-176464980 AAGAGGGAACAGAGAAAAGAGGG - Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984816829 4:183846366-183846388 CAAAGAGAGGAGAGAGAAAAAGG - Intergenic
984955759 4:185044064-185044086 CACAGAGGGCAGAGTGAAAATGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985817293 5:2136247-2136269 CAGAAACAGCTGAGAGTAGAAGG - Intergenic
986002312 5:3639839-3639861 CAGAGAAGGCAGGGTGAAGAGGG - Intergenic
986053026 5:4108099-4108121 CATAGAAAGCAGAAAGAACATGG + Intergenic
986130687 5:4927129-4927151 CAGAGGGAGGAGAGAAAAGCAGG - Intergenic
986302198 5:6486538-6486560 GAAAGAAAGGAGAGAGAAGAGGG - Intronic
986313621 5:6571876-6571898 CAGAGAAGGGAGAGAGGAGAGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986381596 5:7192078-7192100 CAGAGAGAGTGGACAAAAGATGG - Intergenic
986532040 5:8747750-8747772 CAGAGAAAGAAGAGAAAGGATGG - Intergenic
986835765 5:11635315-11635337 CAGAGAGAACAGTGAGAAACTGG + Intronic
986867834 5:12010472-12010494 CAAAGACAGCAGAGAAAAGAGGG - Intergenic
987017665 5:13836859-13836881 CAGAGACACAAGACAGAAGAAGG + Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
988025721 5:25686332-25686354 CGGAGAGAGGAGAGACCAGAAGG + Intergenic
988452551 5:31357744-31357766 CAGAGAAAGCAAAGTGACGACGG - Intergenic
988656802 5:33220675-33220697 CAGAGAAAGCAGAGTTGAGATGG + Intergenic
988959333 5:36353923-36353945 AAAAGAGAGCAGAGGGCAGAAGG + Intergenic
989083288 5:37649151-37649173 CAGGCAGAGAGGAGAGAAGAAGG + Intronic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989734507 5:44687765-44687787 AAGAGGAAGCAGAGAGAAGTGGG + Intergenic
990109990 5:52310792-52310814 GAGAGAGAGGAGAGAGAGCAGGG - Intergenic
990109997 5:52310825-52310847 CATAGAGAGGAGAGAGAGGGAGG - Intergenic
990238719 5:53795686-53795708 CAGATGGAGCAGGGAGAAGATGG - Intergenic
990279126 5:54231046-54231068 CAGAAAGAGCAGGGGAAAGAGGG - Intronic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990509843 5:56480662-56480684 CAGAGAAAGAAAAGAGAAGCTGG + Intronic
990934842 5:61136996-61137018 CAGAGTAAGCTGAGAGAATATGG + Intronic
990995857 5:61731691-61731713 GAGAGAGAGGAGAGAGAGGTGGG + Intronic
991089618 5:62681477-62681499 CAGAAAGAGTAAAGAGAACATGG + Intergenic
991156348 5:63440766-63440788 CACAGATCACAGAGAGAAGAGGG - Intergenic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
991272648 5:64803291-64803313 AAGAAAGAGGGGAGAGAAGAAGG - Intronic
991515246 5:67427973-67427995 AAGGGAGAGAAGAGAGAGGAAGG - Intergenic
991640946 5:68751787-68751809 CAGAGAAAGAAGAGAGGAGGGGG + Intergenic
991939156 5:71833420-71833442 CAGAAAAAGAAGAGAGGAGAGGG - Intergenic
992143716 5:73824385-73824407 TAGAAAGAGCTCAGAGAAGAAGG + Intronic
992189649 5:74278867-74278889 GAAAGAGAGGAGAAAGAAGATGG - Intergenic
992341455 5:75827989-75828011 GAGAGAGGGAAGAGAAAAGATGG - Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
993108579 5:83627834-83627856 GAGTGAGAGGAGAGAGAACAGGG - Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993685396 5:90931081-90931103 GAGAGAGAGGAGGGAGAAGGAGG + Intronic
993722780 5:91338044-91338066 GAGAAAGTGCAGAGAGCAGAGGG + Intergenic
993900630 5:93581991-93582013 GAGAGAGAGAAGAGAGGAGAGGG - Intergenic
993970947 5:94419332-94419354 TGGAGGGAGCAGAAAGAAGAGGG - Intronic
994002668 5:94799137-94799159 AGGAGATAGAAGAGAGAAGAAGG + Intronic
994254016 5:97571196-97571218 AAGAGAGAGAAGAGTGAAGGAGG + Intergenic
994259496 5:97640563-97640585 CAGAGAAGGAAGAGAGGAGAAGG + Intergenic
994278776 5:97874373-97874395 CACAGAGAGAAGAAAAAAGAAGG + Intergenic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
994985538 5:106928433-106928455 CAGAAAGAGCTGGGGGAAGATGG + Intergenic
995019239 5:107348021-107348043 AAGAGAGAGTAGAGAGGAGAAGG - Intergenic
995050356 5:107696488-107696510 TGGAGAGAGAAGAGGGAAGAAGG + Intergenic
995160724 5:108977837-108977859 AAGAGAGAGAAGAGAGAAACAGG - Intronic
995712962 5:115053296-115053318 CAGAGAAAGCTAAAAGAAGAAGG + Intergenic
995716160 5:115083572-115083594 TAGAAAGAGAAGTGAGAAGAAGG + Intergenic
995735851 5:115298373-115298395 GAGAAGGAGAAGAGAGAAGAAGG + Intergenic
996203406 5:120702097-120702119 AAGAGAGAGCAGAGAAATGGAGG + Intergenic
996737031 5:126767517-126767539 CAGAGAGAAGAGAGAGAAAGAGG - Intergenic
996821978 5:127639608-127639630 AAGAGAGAGGAGAGGGAAGAAGG - Intergenic
996825084 5:127673838-127673860 CAGAGACAGAAGAGAGACCAAGG - Intergenic
997191832 5:131945185-131945207 CAGAGAAAGCAGAGCGGAGCAGG - Intronic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997604529 5:135164563-135164585 CAGACAGGGCAGAGAGGTGAGGG + Intronic
997738309 5:136231122-136231144 CAGCGAGAGCAGAAAGAACTGGG - Intronic
997894059 5:137700052-137700074 CAGTCAGAGAAGAGAGAACAGGG - Intronic
997997946 5:138601573-138601595 AAGAGAAAGCTGAGAGAAGCAGG + Intergenic
998350529 5:141497483-141497505 CAGAGAGAGGAGAGAGAGAGAGG - Intronic
998477869 5:142436556-142436578 GAGAGATAGCAGAGAGAGGTGGG - Intergenic
998495824 5:142588473-142588495 GAGAGAGAGAAGAGAGAAGAGGG - Intergenic
999228781 5:150049178-150049200 CAGAGTGAGCTGAGAGGAGGGGG + Intronic
999283069 5:150377451-150377473 CTGGAAGAGCTGAGAGAAGATGG + Intronic
999340366 5:150764951-150764973 CAGACAGAGCTGTGTGAAGAGGG + Intergenic
999386707 5:151158544-151158566 GAGGGAGAGGAGAGATAAGAGGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000113255 5:158129395-158129417 GAGAGAGAGAAGAAAGAAGGGGG + Intergenic
1000152090 5:158513148-158513170 GAGAGAGAGAGGAGAGAAGTTGG + Intergenic
1000153908 5:158531741-158531763 AAGAAAGAGGAGAGAGGAGAGGG + Intergenic
1000668941 5:164035756-164035778 AAGAAAGAGCAGAGAAAGGAAGG - Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001084631 5:168691728-168691750 CAGAGATTGCTGGGAGAAGAAGG + Intronic
1001133015 5:169079928-169079950 CAAAGGGAAGAGAGAGAAGAGGG + Intronic
1001141519 5:169147905-169147927 AGGAGGGGGCAGAGAGAAGACGG - Intronic
1001265484 5:170271172-170271194 CAGAGAGAGAAGAAAGGGGAAGG + Intronic
1001281942 5:170392290-170392312 CAGAGAGAGCACAGAGCAGGTGG - Intronic
1001478028 5:172064819-172064841 CAGAGACAGCAGAGAGTAGCTGG + Intronic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1001624305 5:173117634-173117656 GAGAGAGAGAGGAGAGAAGGAGG - Intronic
1002303807 5:178272113-178272135 CAGAGGGAACAGAGAGCCGAGGG - Intronic
1002461709 5:179377102-179377124 CTGAGACAGGAGTGAGAAGATGG - Intergenic
1002512118 5:179727540-179727562 CAGAGAGAGTGGAGAAAAGAAGG + Intronic
1002739420 5:181423922-181423944 CACAATGAGCAGAGACAAGACGG + Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003344331 6:5252592-5252614 AAAAGACAGCAGAGAGAAAACGG - Intronic
1003439615 6:6127073-6127095 GAGACAGAGCAAAGTGAAGAGGG - Intergenic
1003538625 6:6998697-6998719 GAGAGAGAGAAAAGAGAGGAGGG + Intergenic
1003655401 6:8002581-8002603 GAGAGAGAGAAGAAAGAAAAGGG + Intronic
1003762859 6:9200421-9200443 CAGAGAGAGAAAAGAGAAAAGGG + Intergenic
1004015424 6:11727896-11727918 AAGAGAGAGGGGAAAGAAGAAGG + Intronic
1004101963 6:12621875-12621897 AAGAGAGAGAAGAGAAAAGGAGG + Intergenic
1004295605 6:14407072-14407094 GAGAGAGAGAAGAAAGGAGAAGG - Intergenic
1004610133 6:17232136-17232158 CAGAGAGAGCAGCAAGGACAAGG + Intergenic
1004691564 6:17996600-17996622 CAAAGTGAGAAGAAAGAAGAAGG + Intergenic
1004735070 6:18397738-18397760 CAGACGAAGCAGAGAAAAGAAGG - Intronic
1005056061 6:21729773-21729795 CATGGAGAGCAAAGAGAGGAAGG - Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005187524 6:23179943-23179965 CAGAGAGACCAATGAGAAAAGGG - Intergenic
1005897621 6:30191536-30191558 AAAAGAGAGCAGAGTGAAGGGGG + Intronic
1006047994 6:31315181-31315203 CAGAGAGAACAGAGATAAACAGG - Intronic
1006245092 6:32726494-32726516 CTGAAAGAGAAGAGAGAAAAAGG + Intergenic
1006682626 6:35808068-35808090 CAGAGAGACTACAGAGAACAGGG - Intronic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1006744869 6:36334454-36334476 CAGAGAGGAAAGAGAAAAGAAGG - Intronic
1006936857 6:37724569-37724591 CAGATAGAACAGAGAGAGGGAGG + Intergenic
1007286306 6:40750000-40750022 AAGAGAGACCAGAGATGAGAAGG - Intergenic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1008137702 6:47795749-47795771 GAGAGAGAGAAGAGAGAAGTGGG - Intronic
1008200715 6:48586009-48586031 TAGAGAGAGAAGAGAGATGAAGG - Intergenic
1008490995 6:52087229-52087251 CAGAGAGAGGAGAGAGAGAGAGG - Intronic
1008581208 6:52908981-52909003 CAAAGAGAACAAAGAGAAGGAGG + Intronic
1008635700 6:53408357-53408379 CAGAGAGAGGGGAGAGAAGGTGG + Intergenic
1009198962 6:60720838-60720860 CAAAGAGAGCTGAGAGCTGATGG - Intergenic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1009371477 6:62908712-62908734 TAGAAATAGCAGACAGAAGAAGG + Intergenic
1009567241 6:65324615-65324637 AAGAGAAAGCATAGAGAAAATGG + Intronic
1009707208 6:67266778-67266800 CACAGAGAGCAAGGAGAAGCAGG - Intergenic
1010386366 6:75284862-75284884 GAGAGGGAGGAGGGAGAAGAAGG + Exonic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1010800379 6:80168317-80168339 GAGAGAGGGGAGAGGGAAGAAGG + Intronic
1011184287 6:84657238-84657260 GAGAGAGAGAAGAGAGAGGGAGG - Intergenic
1011218648 6:85031850-85031872 GAGGGAGAAGAGAGAGAAGAGGG + Intergenic
1011337455 6:86276627-86276649 CAGAGAGAGAACACAGAAGTTGG - Intergenic
1011371313 6:86639827-86639849 AAGAAGGAGGAGAGAGAAGATGG + Intergenic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012144852 6:95668602-95668624 CAGGAACAGCAGTGAGAAGAAGG - Intergenic
1012288956 6:97427014-97427036 CAGAGGGAGCTTAGAGAGGAGGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012584231 6:100903395-100903417 TGGAGAAAGGAGAGAGAAGAAGG - Intergenic
1012858763 6:104533843-104533865 GAGAGAGAGGAGAGAGAAGAGGG - Intergenic
1012993114 6:105946459-105946481 CAGAGAGAGGAGAGATAGGGTGG - Intergenic
1013080595 6:106808631-106808653 AAGAGAGAGCAGGGGGAAAAGGG - Intergenic
1013080633 6:106808880-106808902 CAGAGAGAGGAGAGAGAGAGAGG - Intergenic
1013272626 6:108558341-108558363 GAGAGAGAGGAGAGGGAAAAAGG - Intergenic
1013423143 6:109984378-109984400 CATAGACAGAAAAGAGAAGAGGG + Intergenic
1013432765 6:110069788-110069810 CAGAGTGAGCCAAGAGGAGAGGG - Intergenic
1013627948 6:111956312-111956334 CAGAGAGTGGGGAGAGGAGATGG + Intergenic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1013967437 6:115971898-115971920 GACTAAGAGCAGAGAGAAGAGGG + Intronic
1014024670 6:116631564-116631586 CACAGAGAGCAGAGAAAGGAGGG + Intronic
1014269035 6:119315045-119315067 CAGAAAGAGGAAAGAGAAGCTGG - Intronic
1014904823 6:127013262-127013284 GAGAGAAAGAAGAGAGAAGTTGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015256453 6:131184068-131184090 CATGGAGAGCAGAGAGAAACTGG + Intronic
1015793357 6:136986314-136986336 GAGAGGAAGCAGAGAGAAGCAGG - Intergenic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1016683504 6:146856539-146856561 CAAACTGAGCAAAGAGAAGACGG + Intergenic
1017096430 6:150809352-150809374 CAGAGAGAGCAGAGAGGGTGAGG - Intronic
1017346860 6:153393334-153393356 GAGAGATAACAGAGAGAAGGGGG - Intergenic
1017662246 6:156686523-156686545 GAGAGAGAGGAGAGAGGAGAGGG - Intergenic
1017759353 6:157556228-157556250 CAGAGCCAGCAGAGAGGACAGGG + Intronic
1017876566 6:158529733-158529755 CAGGGAGAGCAGGGAAGAGATGG - Intergenic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1017953409 6:159157856-159157878 CAGAGAGATAAGAGAGGAAAAGG - Intergenic
1018513415 6:164551649-164551671 AAAAGAGAGGAGAGAGAGGAAGG + Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1018926010 6:168207548-168207570 CAGAGAGGGCAGTGTGGAGATGG + Intergenic
1018931609 6:168243721-168243743 CAGAGAGAGGATGGAGAGGAAGG - Intergenic
1019079547 6:169420896-169420918 CAGAGAGATCCGAGATCAGATGG - Intergenic
1019173038 6:170145507-170145529 AGGAGAGAGCAGGGAGAGGAGGG + Intergenic
1019244531 6:170699481-170699503 CACAATGAGCAGAGACAAGACGG + Intergenic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019517418 7:1446173-1446195 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019517475 7:1446317-1446339 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019517514 7:1446423-1446445 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1019964069 7:4484631-4484653 GAGAGAGGAGAGAGAGAAGAGGG + Intergenic
1021118978 7:16776154-16776176 GAGAGAGAGGAGAGAGAATGGGG - Intronic
1021285423 7:18775895-18775917 CAAAGAAAGCTGAGACAAGAAGG - Intronic
1021385222 7:20021108-20021130 GAAAGAAAGAAGAGAGAAGATGG + Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021776378 7:24059038-24059060 CAGCGAAAGGAGAGAGAAGGAGG + Intergenic
1021920835 7:25483385-25483407 CACAGGGACCAGAGAGCAGATGG + Intergenic
1021960575 7:25868937-25868959 CAGGGATGGCAGAGAGAAGCAGG + Intergenic
1022292444 7:29017208-29017230 CAAAATGAGCAGAGAGAATATGG - Intronic
1022318446 7:29265656-29265678 GAGAGAGACATGAGAGAAGAGGG + Intronic
1022569946 7:31442525-31442547 ATGAGAGAGCAGAGAGGAGACGG + Intergenic
1022705521 7:32798486-32798508 GAGAGAGAGGAGAGAGACAAAGG - Intergenic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023018195 7:35986388-35986410 AAGTGAGAGGAGGGAGAAGAAGG + Intergenic
1023059729 7:36315850-36315872 CACAGACAGCAGAAAGGAGACGG + Intergenic
1023070318 7:36425034-36425056 TAGAGAACACAGAGAGAAGAGGG - Intronic
1023149058 7:37182583-37182605 GAGAGAGAAGAGAGAGAGGAGGG - Intronic
1023326348 7:39062474-39062496 CATAGAAAGTAGAGAGTAGAAGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024216948 7:47255957-47255979 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024270138 7:47635767-47635789 GAGAGAGAGGAGAGGGAAGCAGG + Intergenic
1024344624 7:48300614-48300636 CAGAGACAGGAGTGAGCAGAAGG + Intronic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1024693098 7:51824295-51824317 CAGTGGGAGCAAAGAGAATATGG - Intergenic
1024757451 7:52552291-52552313 GAGTGAGAGCTGAGCGAAGAGGG - Intergenic
1024794710 7:53007526-53007548 CAGAGGGAGCAGAGAACAGGTGG + Intergenic
1024845481 7:53636880-53636902 CTAATGGAGCAGAGAGAAGAAGG + Intergenic
1024987012 7:55202981-55203003 TAGAGCCAGCAGAGAGAACAGGG - Intronic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026403121 7:70036525-70036547 CAGAGAGAGGAGAAACAAGGTGG - Intronic
1026534932 7:71231693-71231715 AGGAGAGAGAAAAGAGAAGAGGG + Intronic
1026648218 7:72191602-72191624 AAGAGAGTGCAGAGAGAACATGG + Intronic
1026857267 7:73762997-73763019 GAGAGAGAGGAGAGAGAAGGGGG - Intergenic
1026862573 7:73800574-73800596 TAGAGAGAACAGAGAGAATAGGG - Intronic
1026962431 7:74417368-74417390 CAGGCAGAGCAAAGAGAAGTGGG - Intergenic
1027130308 7:75585811-75585833 CACAGAAAAAAGAGAGAAGAAGG - Intronic
1027266075 7:76495957-76495979 CAGAGAGATGAGAGAGGACAAGG - Intronic
1027338800 7:77183232-77183254 CAAAGAGATCAAGGAGAAGATGG - Intronic
1027782459 7:82536537-82536559 GAGAGAGAGCAAACAAAAGAAGG - Intergenic
1028325017 7:89512866-89512888 ATGAGAGGGCAGAGAGAAGAAGG - Intergenic
1028455372 7:91032564-91032586 AAGAGAAAGCAGTGTGAAGAGGG + Intronic
1028513770 7:91653848-91653870 CTCAGGGAGGAGAGAGAAGATGG - Intergenic
1028813134 7:95111852-95111874 GAAAGAGAGCAGGGAGAAGAGGG + Intronic
1028892881 7:96008307-96008329 GGGAGAGAGCAGAGGGAAGGGGG + Intronic
1028984090 7:96996583-96996605 CAGAGAGAGAGAAGAGAAGGGGG + Intergenic
1029094937 7:98077583-98077605 GAAAGAGAGAAGGGAGAAGAAGG + Intergenic
1029869756 7:103677943-103677965 CAGAGAGAGCAGGGATCTGATGG - Intronic
1030095532 7:105895195-105895217 CAAGGAGAGAAGAGAGAAGCAGG + Intronic
1030179830 7:106694769-106694791 GAGAAAGGGCAGAGAGAAGTGGG - Intergenic
1030248185 7:107409156-107409178 CAGAGAGAGCACAAAGATTAAGG + Intronic
1030299177 7:107958068-107958090 AACAGGGAGCAGAGAGAGGAGGG - Intronic
1030463411 7:109869383-109869405 AGGAAAGGGCAGAGAGAAGAAGG - Intergenic
1030508649 7:110455944-110455966 GAGAGAGAGAAGAGAGAAGAGGG + Intergenic
1030543716 7:110866415-110866437 CACAGAGATCAGAGAGGACAGGG + Intronic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1031120869 7:117720173-117720195 AAGAGAGAGAAGGGAGATGAAGG - Intronic
1031389857 7:121200951-121200973 AAGAGAGAGCAGTGAAGAGAAGG + Intronic
1031998250 7:128246909-128246931 CAGGGAGTGCAGAGAGAAGTGGG + Intronic
1031999729 7:128256993-128257015 CAGAGAAAGAAGAGACAGGAGGG + Exonic
1032094348 7:128930091-128930113 GAGGGAGAGTGGAGAGAAGACGG + Intergenic
1032388771 7:131542233-131542255 GAGAGAGGGCAGAGAGAGAACGG - Intronic
1032425579 7:131819929-131819951 CAGAGAGGGCGGTGAGGAGAGGG - Intergenic
1032501822 7:132405415-132405437 GAGTGAGATCAGAGAGAAAAGGG - Intronic
1032638625 7:133739410-133739432 CAGGGAGAGCAGTGACAAGCTGG + Intronic
1032789761 7:135233641-135233663 AAAAGGGAGGAGAGAGAAGAGGG - Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032858581 7:135857839-135857861 AAGAGAGGACAGAGAGATGATGG - Intergenic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033246345 7:139719435-139719457 CAGAGAGAACAGAGTCAAAACGG - Intronic
1033264628 7:139874116-139874138 GAGAGAGAGATGAGAGGAGAAGG - Intronic
1033716496 7:144008445-144008467 CAGCCAGAGCAGTGAGAAAAGGG + Intergenic
1034015939 7:147586512-147586534 CAGAGAGAGAAGAGGAAGGAAGG + Intronic
1034215069 7:149398794-149398816 CAGCAACTGCAGAGAGAAGACGG - Intergenic
1034312139 7:150098082-150098104 CAGTGAGTGCAGATAGGAGATGG - Intergenic
1034692425 7:153024435-153024457 GAGAGAGAGGAGAGGGAAAAGGG - Intergenic
1034697488 7:153066759-153066781 CACTGAGAGCAGAGAGAACCTGG + Intergenic
1034794716 7:154002576-154002598 CAGTGAGTGCAGATAGGAGATGG + Intronic
1034816129 7:154173580-154173602 CAGGGAGAGCAGGGAGCAGCGGG - Intronic
1034907018 7:154958220-154958242 CAAAGAGAGCAGGAAGGAGATGG + Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035333248 7:158110155-158110177 TGGAGAGGTCAGAGAGAAGAGGG - Intronic
1035503594 8:108691-108713 CACAATGAGCAGAGACAAGACGG - Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035662596 8:1359248-1359270 CAGGGAGGGCAGCGAGGAGAAGG - Intergenic
1035836164 8:2754531-2754553 GAGAGAGAGTAGAAATAAGAAGG + Intergenic
1036031235 8:4976154-4976176 TAGAGGGAGCAGAGAGACAAGGG + Intronic
1036097126 8:5736763-5736785 GAAAGAGAGAAGTGAGAAGAAGG - Intergenic
1036411263 8:8503821-8503843 CAAACAAAGCAGAGAGCAGATGG + Intergenic
1036521363 8:9494493-9494515 CAGTAAGAGCAGAAAGTAGATGG - Intergenic
1037103433 8:15076263-15076285 CAAAGAGAGCAGAAAGAAAGAGG + Intronic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1037609031 8:20460899-20460921 TAGAAAGAGCAGAGTGAACAAGG - Intergenic
1037695013 8:21215963-21215985 CAGAGGGAGGAGATAGGAGATGG - Intergenic
1038090596 8:24248663-24248685 CAGACAGACCAGGAAGAAGATGG + Intergenic
1038272031 8:26082999-26083021 CAGAGACACCACAGAGAACAAGG + Intergenic
1038428432 8:27480631-27480653 CTTGGAGAGCAGGGAGAAGAGGG + Intergenic
1038450167 8:27634379-27634401 CAGAGGAAGCAAAGAGGAGAGGG + Intronic
1038918886 8:32059850-32059872 GAGAAAGAGAAGAGAGAAAATGG - Intronic
1038972018 8:32646911-32646933 AAGAGAGAGAGGAGAGAGGACGG + Intronic
1039143737 8:34421871-34421893 CAGAAAGAGCAGGGAGCAGGAGG + Intergenic
1039179141 8:34844483-34844505 CAGAGAATGCAGACAGAACAGGG + Intergenic
1039374938 8:37023861-37023883 CAGGGAGAGCAGAGATAGCAAGG - Intergenic
1039407852 8:37328236-37328258 GAGAGAGAGAAGAAGGAAGAAGG - Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1039862132 8:41468148-41468170 AGGAGAGAACACAGAGAAGAAGG + Intergenic
1039926745 8:41940907-41940929 CAGTGAGAGCAGCGAGGAGGAGG - Exonic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1040518050 8:48150526-48150548 CAGAATGAGCAGACAGATGAGGG - Intergenic
1040626605 8:49157155-49157177 AGGAGTGAGCAGGGAGAAGATGG - Intergenic
1040816381 8:51512364-51512386 CAGAGAGAAATCAGAGAAGAAGG + Intronic
1040857321 8:51961529-51961551 AAGAGAGAGTAGACAGAAGAAGG + Intergenic
1040881905 8:52214459-52214481 CAGAGAGAACAGCGACAAGAGGG + Intronic
1040889472 8:52301996-52302018 GAGCCAGAGCAGAGTGAAGATGG + Intronic
1040912280 8:52531345-52531367 GAGAGAGAGAAGAGAAGAGATGG - Intergenic
1040912326 8:52531645-52531667 CATAGGGACCAGACAGAAGAGGG + Intergenic
1041008317 8:53517012-53517034 CAGAAAGAGCACTAAGAAGAGGG + Intergenic
1041447142 8:57964770-57964792 CAGGCAGAGAAGAGAGAAAAGGG + Intergenic
1041469336 8:58191358-58191380 AAGAGGGAACACAGAGAAGATGG + Intronic
1041576332 8:59399940-59399962 CAGAGAGAGGGGAGAGAGAAAGG + Intergenic
1042045674 8:64648568-64648590 CAGAGATAGCAGTGAGCAAAGGG - Intronic
1042294448 8:67204172-67204194 GAGAGAGAGAAGAGAGAATGTGG - Intronic
1042551984 8:70002229-70002251 GAAAGAGAGGACAGAGAAGAGGG - Intergenic
1043000012 8:74746692-74746714 TGGAGAGAAGAGAGAGAAGATGG + Intronic
1043564272 8:81530809-81530831 AAGAGAGAGCAGTGTGAAAATGG + Intronic
1043660961 8:82739932-82739954 ATCAGAGAGCAGAGGGAAGATGG + Intergenic
1043849809 8:85203916-85203938 CACAGATACCTGAGAGAAGACGG - Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044034796 8:87287384-87287406 CACAGATAACAGAGAGAGGATGG + Intronic
1044381951 8:91544635-91544657 GAGAGAGAACAGAGAAAGGAAGG - Intergenic
1044743002 8:95346829-95346851 AGGAGAGAGAAGAGAGGAGAAGG - Intergenic
1044789676 8:95834673-95834695 CAGAGAAGACAGAGAGAATATGG + Intergenic
1044893780 8:96865704-96865726 TAGAGAGAGCACAGATGAGAAGG + Intronic
1044985943 8:97756457-97756479 CAGAGAGAGAGGAGAGAGCAGGG - Intergenic
1045151006 8:99408044-99408066 CAGAGAGAGCACTGGGAAGAGGG + Intronic
1045171754 8:99678114-99678136 AGGAGAGAGAAGAGAGAAAATGG - Intronic
1045191562 8:99889264-99889286 CTGGGAGAGCAAAGAGGAGATGG - Intronic
1045253621 8:100501500-100501522 GAGAGAGAACAGAAAGAAAAAGG + Intergenic
1045654792 8:104375822-104375844 GAGAGAGAACGGAGAGAAAAGGG + Intronic
1045737946 8:105318556-105318578 GAGAGCGAGCAGCGAGGAGAGGG - Intronic
1046146122 8:110160820-110160842 GAGGGAGAGGAGGGAGAAGAAGG + Intergenic
1046489360 8:114929382-114929404 CAAGGAGAGGAGAAAGAAGATGG - Intergenic
1046543106 8:115612166-115612188 CAAAGAGAGGAGGAAGAAGAAGG + Intronic
1046687784 8:117246090-117246112 AAGAAAGAGGAGAGAGAAGAAGG + Intergenic
1046892024 8:119432620-119432642 GAGAGAGAGAAGAGAGGGGAAGG - Intergenic
1047066020 8:121284086-121284108 AAGAGAGAGACGGGAGAAGATGG - Intergenic
1047139530 8:122121941-122121963 CAGAGAGAGAAAGGAAAAGAGGG - Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047305506 8:123649835-123649857 AAGACAGAGCAAAGAGGAGAAGG - Intronic
1047374874 8:124286440-124286462 AGGAGAGAGGAGAGAGAGGAGGG - Intergenic
1047404411 8:124573247-124573269 GAGGGACAGCAGAGTGAAGATGG - Intronic
1047623985 8:126636684-126636706 CAGAGACAGCACAGAGCAAAAGG + Intergenic
1047923693 8:129661230-129661252 CACAGACAGGAGAGAGAACATGG + Intergenic
1047924877 8:129672893-129672915 CTGAGAAAGCAGAGAGAACAAGG - Intergenic
1047966179 8:130048544-130048566 CAGATGGAGCAGACAGGAGAAGG - Intergenic
1048100038 8:131341359-131341381 CAGAGAGGGCTCAGAAAAGATGG + Intergenic
1048183311 8:132215890-132215912 AAGAGGGAGCAGAGAAGAGAAGG - Intronic
1048183719 8:132219485-132219507 CAGAGAGCGGGTAGAGAAGAAGG - Intronic
1048308816 8:133302515-133302537 CACAGAGAGATGAGAGAGGAAGG - Intergenic
1048346036 8:133575215-133575237 GAGAGAGAACAGAGCGGAGAGGG - Intergenic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048531580 8:135254850-135254872 CAGAAGCAGCAGAGAGGAGAAGG + Intergenic
1049007591 8:139865508-139865530 CAGAGAGAGGAGAAAGCAAAAGG + Intronic
1049021775 8:139961887-139961909 CAAACAGGGCAGAGAGATGACGG + Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049121675 8:140745199-140745221 CGGAGAAAGCAGGGACAAGAAGG + Intronic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049410130 8:142470189-142470211 CAGAGAGAGCCGGCAGGAGAGGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049856987 8:144868420-144868442 GAGAGAGAGGAGAGAGAGGGGGG + Intergenic
1050114198 9:2246419-2246441 CATAGAGAGAAGAGAGAAAGGGG + Intergenic
1050176746 9:2876495-2876517 CGGAGAAAGCACAGAGAAGGCGG - Intergenic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050683396 9:8140107-8140129 CAGAGAGAGTAGAGACCAGTAGG + Intergenic
1050842058 9:10162538-10162560 CAGAAAGGGTAGAGAGTAGAAGG + Intronic
1051446578 9:17146271-17146293 AAGAGAGAAAAGAGAGAAGAAGG - Intronic
1051907038 9:22107117-22107139 CAGGGAGATCAGTTAGAAGATGG + Intergenic
1051963290 9:22794502-22794524 GGGAGAGAGAAGAGAGAGGAAGG - Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052195174 9:25703891-25703913 CAGAGAGAAAAGATAGAAGCTGG + Intergenic
1052220022 9:26009263-26009285 CTGCGAGAGCTCAGAGAAGAGGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053063068 9:35046371-35046393 CAGGGAGAGAAAAGAGCAGAGGG - Intergenic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053278555 9:36801472-36801494 CAGGAAGAGCAAAGAGAAGATGG + Intergenic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053917932 9:42957817-42957839 CAGAGAGAGCAAAGGGAACTTGG + Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055112820 9:72576402-72576424 AAGATAGAGAAGAGAAAAGAGGG - Intronic
1055343448 9:75309355-75309377 CAGAGAGAGCAAAGAAAAGCAGG - Intergenic
1055774028 9:79748585-79748607 GAGAGTGAACAGAGAGAATAAGG + Intergenic
1056109302 9:83379151-83379173 AAAAGAGAGGAGAGAGAGGAAGG - Intronic
1056123355 9:83511331-83511353 CAGAGAGGGCCCAGAGAAGGGGG + Intronic
1056435423 9:86571103-86571125 CAGAAAAAGCAGGCAGAAGAAGG + Intergenic
1056438125 9:86592950-86592972 GAGAGAGAGGAGAGAGAGAAAGG + Intergenic
1056523371 9:87420554-87420576 GAGAGAGAGAAGAGGGAACAAGG + Intergenic
1056774775 9:89503257-89503279 GTCAGAGAGCCGAGAGAAGAGGG - Intergenic
1056826266 9:89878347-89878369 CAGAGAAGGCAGGGAGAAGGAGG + Intergenic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057349686 9:94285344-94285366 AAGATAGAACAGAGAGAAAATGG + Intronic
1057722893 9:97547028-97547050 GAGAAAGAGCAGAGAGAATCTGG - Intronic
1057759220 9:97859310-97859332 CACAGAGAGCAGAGAGGGCAGGG + Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058163518 9:101595093-101595115 GAGAGGGAGCGGAGAGAGGAGGG + Intronic
1058172994 9:101705283-101705305 CAGAGAGCGCAGAGAACAGTAGG + Intronic
1058315646 9:103561827-103561849 CAGAGACAGTAGAAAGAAAAAGG - Intergenic
1058343483 9:103927307-103927329 GAGAGAGAGAAGAAAGGAGAAGG + Intergenic
1058690314 9:107514780-107514802 TAGAGAGAGAAGAGAGTAAAGGG + Intergenic
1058753092 9:108058510-108058532 CAGAGGGAGCAAAGAGAATGAGG + Intergenic
1059091423 9:111363032-111363054 GAGAGAGAGAAAAAAGAAGAGGG + Intronic
1059142078 9:111862938-111862960 CAGAAGGAGAAGAGAGAACAAGG - Intergenic
1059222560 9:112638690-112638712 CAGAAAGAGAAGAGAGAATGGGG - Intronic
1059280526 9:113129701-113129723 CAGAGAGTACAGATAGAACAGGG - Intergenic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1059497501 9:114721568-114721590 CACACAGAGCAGGGAGAAGGCGG - Intergenic
1059617824 9:115969856-115969878 TAGAAAGAGAAGAGAGAACATGG + Intergenic
1059656931 9:116365837-116365859 CACAGAGAGAGGAGAGAAGGAGG - Intronic
1059877574 9:118652635-118652657 GAGAGAGAGAAGGAAGAAGAAGG + Intergenic
1059901313 9:118929206-118929228 AAGAAAGAACAGAGAGTAGAGGG - Intergenic
1060049238 9:120365599-120365621 CAGAAAGGAGAGAGAGAAGAGGG + Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060575575 9:124689831-124689853 AAGGGAGAACAGAGAAAAGAGGG - Intronic
1060600569 9:124874695-124874717 GAGAGAGAGAAGAGAAAAGAGGG - Intronic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1060872751 9:127055937-127055959 CAGAAAGAGCAGTCAGAGGAGGG + Intronic
1060876083 9:127084516-127084538 CACAAAGAGCAGTGGGAAGAGGG - Intronic
1060882750 9:127129796-127129818 CAGGGAGGGAAGAGAGAAGGCGG - Intronic
1061061896 9:128254621-128254643 GAGAGAAAGCAGAGAGAAAACGG - Intronic
1061255396 9:129452185-129452207 CAGGAAGGGCAGAGAGAAGGCGG + Intergenic
1061579213 9:131526634-131526656 CAGACAAAGCTGAGGGAAGAGGG + Intronic
1061715429 9:132515651-132515673 CAAGGAGGGGAGAGAGAAGAGGG - Intronic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062633017 9:137475044-137475066 AAGAGAGAACACAGATAAGAGGG + Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1203604719 Un_KI270748v1:48707-48729 CACAATGAGCAGAGACAAGACGG + Intergenic
1185490934 X:516519-516541 CAGAGAAAGGAAAGAGGAGAGGG - Intergenic
1185545810 X:943284-943306 GAGAGAGAGGAGAGAGGAGAGGG + Intergenic
1185562526 X:1070674-1070696 GAGAGAGAGGAGGGAGAAGGAGG + Intergenic
1185655541 X:1681648-1681670 AAGAGAGAGGAGAGAGAAAGAGG - Intergenic
1185751212 X:2610776-2610798 GAGAGAGAGGAGAGAGAAAGAGG - Intergenic
1185769237 X:2752485-2752507 CTGAGAGGGGAGGGAGAAGACGG + Intronic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1186082743 X:5951426-5951448 CAGAGAGAGCAGGAAAGAGAAGG - Intronic
1186217732 X:7317822-7317844 CAGAGAGAACACAGTGAAGAGGG - Intronic
1186244395 X:7605470-7605492 TGGAGGGAGAAGAGAGAAGAAGG - Intergenic
1186249817 X:7653406-7653428 CAGAGAGAAAAGAGAGAAAGGGG - Intergenic
1186473113 X:9836517-9836539 GAGAGAGAGAAGGGAGAAGGAGG - Intronic
1186573173 X:10737662-10737684 AGGAAAGAGAAGAGAGAAGAAGG + Intronic
1186604707 X:11078064-11078086 CAAAGAGAGCTGAGTGAAGAGGG - Intergenic
1186623512 X:11266618-11266640 CATGAAGAGCAGAGAGAAAAGGG + Intronic
1187002061 X:15192101-15192123 CTGAGTTAGCAGAGAAAAGAAGG + Intergenic
1187025810 X:15434275-15434297 AAGAAAGAGGAGAAAGAAGAAGG + Intronic
1187195536 X:17080204-17080226 GAGAAAAGGCAGAGAGAAGAAGG - Intronic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187245332 X:17548804-17548826 CAGAGAGAGGAAAAGGAAGAGGG + Intronic
1187309454 X:18127321-18127343 AAAAGAGAGAAGAGAGCAGAAGG + Intergenic
1187324586 X:18274615-18274637 CACAGAGGGCAGATAGTAGAGGG - Intronic
1187561639 X:20408868-20408890 CAGAGAAAGCAATGTGAAGATGG - Intergenic
1187643255 X:21318286-21318308 CAGAAAGAGCAGAAAGAACATGG + Intergenic
1187754029 X:22500178-22500200 GAGAGAGAGGAGAGAGGAGAGGG + Intergenic
1188025383 X:25202856-25202878 GAGAGAGAAGAGAGAGGAGAAGG + Intergenic
1188218049 X:27502994-27503016 AAGAAAGAGGAGAAAGAAGAGGG + Intergenic
1188261350 X:28028401-28028423 CAAAGAAAAAAGAGAGAAGATGG - Intergenic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189217327 X:39337416-39337438 GAGAGAGAGAAGAGAGAAAGGGG - Intergenic
1189248355 X:39580824-39580846 ATGAGAGAGGAGAGAGAGGAGGG - Intergenic
1189672600 X:43426813-43426835 CAGACAGGGCGGAGAGAAGCTGG - Intergenic
1189969886 X:46407391-46407413 GAGAGACAGCGGAGAGAAGAAGG + Intergenic
1190132745 X:47765765-47765787 AAGAGAAAGCAGAGAGTAAAGGG - Intergenic
1190259465 X:48788903-48788925 CAGAGAGATAGGAGAGGAGAGGG + Intronic
1190320012 X:49174465-49174487 CTGAGAGGGCAGAGGGAAAAAGG + Intronic
1190553113 X:51605452-51605474 CATAGAGAGCAGTGAGAGAAGGG + Intergenic
1190931342 X:54951534-54951556 CTGACAGAGGAGACAGAAGAGGG + Intronic
1191097508 X:56688899-56688921 CACAGAGAGCAAACAGAAGCAGG - Intergenic
1191104123 X:56761807-56761829 GAGAGAGGGCAGAAAGGAGAGGG - Intergenic
1191159000 X:57307172-57307194 CAGAGAGAATAGAAAGATGAAGG - Intronic
1191838991 X:65496473-65496495 CAGAAAAAGAAGAGAGAAAATGG + Intronic
1191936741 X:66435131-66435153 CAGAGAGACCAAAGAGAGCAAGG + Intergenic
1192040476 X:67615382-67615404 CAGAAATAACAGAGAGCAGAAGG + Intronic
1192318773 X:70072129-70072151 CAACCAGAGCAGAGACAAGAAGG + Intergenic
1192320898 X:70089794-70089816 AAGAGAGAGGAGAGAGAAGGGGG - Intergenic
1192416920 X:70989185-70989207 CAGAGAGAGATGAAAGAACATGG - Intergenic
1192484651 X:71514506-71514528 CTGAGGGAGCAGAAAGGAGAGGG + Intronic
1192540962 X:71972438-71972460 CAGAAACAGCGGAGAGCAGAAGG - Intergenic
1192544135 X:71998713-71998735 CTGAGAGTGCAGAAAGATGAAGG - Intergenic
1192577140 X:72252094-72252116 GAGGGAGAACAGAGAGAAAAAGG + Intronic
1192960559 X:76126609-76126631 CATGGAGAGCAAAGAGAAGCAGG + Intergenic
1193804882 X:85983372-85983394 CAGAGAGAACAGTGAAAGGAAGG + Intronic
1193889215 X:87022509-87022531 AGGAGAGAGCAGAGGGAAGGAGG + Intergenic
1194124190 X:89993016-89993038 CAGAGACAGTAGACAGCAGAAGG - Intergenic
1194218985 X:91168052-91168074 CAGAGAGAGTGGACTGAAGAGGG - Intergenic
1194241568 X:91456324-91456346 CACAGGGAGCAGAGAGTAGCAGG - Intergenic
1194379379 X:93175273-93175295 CAAAGAGGGCAGAGAGATGATGG + Intergenic
1194620873 X:96169813-96169835 CAGAGAGAGCAGAAAGAAATGGG + Intergenic
1194705119 X:97165888-97165910 GAGAGAGAGAGTAGAGAAGACGG - Intronic
1194879099 X:99227667-99227689 CAGAGAGAAAAGGGAGAAGAAGG + Intergenic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195123969 X:101786682-101786704 TAGAAAAAGCAGACAGAAGAAGG - Intergenic
1195252966 X:103065749-103065771 AGAAGAGAGAAGAGAGAAGAAGG - Intergenic
1195487951 X:105431853-105431875 CAGAGAGAGAAGAGAGACAGTGG + Intronic
1195652984 X:107305290-107305312 AAGAGAGAGAAGAGAGAAAGGGG + Intergenic
1195656086 X:107332759-107332781 GAGAGAGAGGATAGAGGAGATGG - Intergenic
1195756608 X:108205058-108205080 GAGAAAGGGTAGAGAGAAGAGGG + Intronic
1195883263 X:109614520-109614542 CAGAGAGAGGAGAGAGAGAGAGG + Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1195961783 X:110394648-110394670 CAGAGACAGCAGAGAGCAAAGGG + Intronic
1195999684 X:110768554-110768576 CAGAAAAAGCAGGTAGAAGAAGG + Intronic
1196036113 X:111147053-111147075 GAGAGAGAGAGGAGAGGAGAAGG + Intronic
1196142459 X:112279122-112279144 AAGAGAGAGAACAGAGAAAATGG + Intergenic
1196577374 X:117335176-117335198 CAGAGGGAGGAGGGAGAAGGGGG - Intergenic
1197005766 X:121495469-121495491 CAATGAAAGAAGAGAGAAGATGG - Intergenic
1197203944 X:123773709-123773731 CATAGATCCCAGAGAGAAGAAGG + Intergenic
1197274873 X:124466716-124466738 CAGGGAGAGTGGACAGAAGAAGG - Intronic
1197556491 X:127961541-127961563 CAGAGAAATCAGAGAAGAGAAGG - Intergenic
1197861246 X:130973051-130973073 CAGAGAGAGCCGAAAGGAGCTGG - Intergenic
1197966140 X:132064049-132064071 GAGAGGGTGCAGTGAGAAGAAGG + Intergenic
1198129352 X:133678308-133678330 TTGAGAGAGCAAAGGGAAGAGGG + Intronic
1198319020 X:135499940-135499962 GAGAGAGAGAGGAGAGAAGGGGG - Intergenic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198480746 X:137037641-137037663 AAGTGAGATCAGAGAGAGGAAGG - Intergenic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1199662010 X:150060828-150060850 TAGAGAGAGGAGAGAGTTGAGGG - Intergenic
1199735266 X:150680250-150680272 GAGAGATTGCATAGAGAAGAGGG + Intergenic
1199768261 X:150956404-150956426 CAGAGAAGGCAGAGTGAAGAGGG - Intergenic
1199970388 X:152855575-152855597 AAGAGAGAAAAGAGAGAAAAGGG - Intronic
1200477081 Y:3650638-3650660 CAGAGACAGTAGACAGCAGAAGG - Intergenic
1200555498 Y:4631808-4631830 CAGAGAGAGTGGACTGAAGAGGG - Intergenic
1200961845 Y:9003101-9003123 CAGAGATTTCAGAGAGAGGAAGG + Intergenic
1200982047 Y:9271404-9271426 CAGAGATTTCAGAGAGCAGAAGG - Intergenic
1201146206 Y:11066836-11066858 AAGGGAGGGGAGAGAGAAGAGGG + Intergenic
1201301269 Y:12507137-12507159 CTGAGAGGGGAGGGAGAAGACGG - Intergenic
1201441320 Y:14011818-14011840 ATGAGAGAGCAGAGAGAAAGAGG + Intergenic
1201443251 Y:14030890-14030912 ATGAGAGAGCAGAGAGAAAGAGG - Intergenic
1201463614 Y:14255757-14255779 AGGAGGGAGAAGAGAGAAGAAGG - Intergenic
1201512546 Y:14780905-14780927 CAGAGACAGCAGGAAAAAGAAGG + Intronic
1202128359 Y:21588327-21588349 CAGAGATATCAGAGAGCAGAAGG + Intergenic
1202150931 Y:21843130-21843152 CAGAGATATCAGAGAGCAGAAGG - Intergenic
1202330536 Y:23748037-23748059 GAGAGAGAGAAGAGGAAAGAGGG - Intergenic
1202347830 Y:23953616-23953638 GAGAGAGAGAAGAGGAAAGAGGG - Intergenic
1202367889 Y:24179387-24179409 GAGAGAAAGCAGAGAGAAAACGG + Intergenic
1202376954 Y:24246521-24246543 GAGAGAAAGCAGAGAGAAAACGG - Intergenic
1202386922 Y:24335115-24335137 CACAATGAGCAGAGACAAGACGG + Intergenic
1202483864 Y:25335013-25335035 CACAATGAGCAGAGACAAGACGG - Intergenic
1202493826 Y:25423600-25423622 GAGAGAAAGCAGAGAGAAAACGG + Intergenic
1202502894 Y:25490730-25490752 GAGAGAAAGCAGAGAGAAAACGG - Intergenic
1202522943 Y:25716475-25716497 GAGAGAGAGAAGAGGAAAGAGGG + Intergenic
1202540233 Y:25922024-25922046 GAGAGAGAGAAGAGGAAAGAGGG + Intergenic