ID: 1165723033

View in Genome Browser
Species Human (GRCh38)
Location 19:38093170-38093192
Sequence ATTTTTAACAGGAAGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 334}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165723028_1165723033 -10 Left 1165723028 19:38093157-38093179 CCCAGGTGCTTAGATTTTTAACA 0: 1
1: 0
2: 1
3: 25
4: 284
Right 1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG 0: 1
1: 0
2: 5
3: 18
4: 334
1165723022_1165723033 22 Left 1165723022 19:38093125-38093147 CCGGGATTACAGGCATGAGCCAC 0: 1406
1: 3588
2: 4650
3: 4179
4: 4000
Right 1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG 0: 1
1: 0
2: 5
3: 18
4: 334
1165723027_1165723033 -5 Left 1165723027 19:38093152-38093174 CCTGGCCCAGGTGCTTAGATTTT 0: 1
1: 0
2: 4
3: 34
4: 364
Right 1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG 0: 1
1: 0
2: 5
3: 18
4: 334
1165723021_1165723033 30 Left 1165723021 19:38093117-38093139 CCAAAGTGCCGGGATTACAGGCA 0: 887
1: 92963
2: 232247
3: 242131
4: 216904
Right 1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG 0: 1
1: 0
2: 5
3: 18
4: 334
1165723025_1165723033 3 Left 1165723025 19:38093144-38093166 CCACCACACCTGGCCCAGGTGCT 0: 2
1: 6
2: 66
3: 583
4: 3455
Right 1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG 0: 1
1: 0
2: 5
3: 18
4: 334
1165723026_1165723033 0 Left 1165723026 19:38093147-38093169 CCACACCTGGCCCAGGTGCTTAG No data
Right 1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG 0: 1
1: 0
2: 5
3: 18
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165723033 Original CRISPR ATTTTTAACAGGAAGGTCAA GGG Intronic
902316744 1:15626074-15626096 ATTTTTAGCAGGGAGGAAAAGGG - Intronic
903017158 1:20368584-20368606 AGTTTTAATAGGATGGCCAAAGG - Intergenic
904570739 1:31462710-31462732 ACTTTTGACAGGAAGGCCACTGG - Intergenic
904713228 1:32447434-32447456 ATTTTTGATAGGAAGGCTAAAGG + Intergenic
905413574 1:37789308-37789330 ATTTTTAACAAGATCCTCAAGGG + Intergenic
905720250 1:40193795-40193817 TATTTTAACATGAAGGTTAAGGG + Intronic
905872759 1:41414636-41414658 ATTTTTAAGTGAAAGGTCAAGGG + Intergenic
906027403 1:42684975-42684997 ATTTTTAACAGGAATGATAATGG + Intronic
906431309 1:45757904-45757926 ATTTTTGACAGGAAGGCTATGGG + Intergenic
906582444 1:46947288-46947310 ATTTTTGATAGGAAGGCCACTGG - Intergenic
906583214 1:46953465-46953487 ATTTTTGATAGGAAGGCCACTGG - Intergenic
907144721 1:52221659-52221681 ATTTTTGACAGGAAGGCTACGGG + Intronic
908423882 1:63986226-63986248 ATTTTTAAAAGGGAGGTAGAGGG - Intronic
911706326 1:101017559-101017581 ATTTTTATCAGGAGGGAAAAAGG - Intronic
912095882 1:106143009-106143031 ATTTTTTCCAGAAAGATCAATGG - Intergenic
912248191 1:107983260-107983282 AGTTTTAAGATGAAGGACAACGG - Intergenic
912628674 1:111227874-111227896 TTTTTTGACACTAAGGTCAACGG - Intronic
913985971 1:143566386-143566408 AGTTTTAACTGAAATGTCAATGG + Intergenic
915005550 1:152631859-152631881 ATTTTTGTGAGGAATGTCAATGG - Intergenic
916266516 1:162895557-162895579 ATTTTCCACAGGAAGGATAAGGG - Intergenic
916926870 1:169530956-169530978 ATTTTTCATAGGAAAGTCCATGG + Exonic
917004928 1:170404173-170404195 ATTTATAAAAAGAAAGTCAAAGG - Intergenic
917525660 1:175786211-175786233 TTTTTTATCTGGAAAGTCAAGGG - Intergenic
917676576 1:177324362-177324384 ATTTTTGACAGGAAGGCTATGGG - Intergenic
918061248 1:181063034-181063056 TCTTTTAACAGTAAGGTGAAGGG - Intergenic
918338333 1:183544840-183544862 TTTTTTAACAGGTAGGTAGAGGG - Intronic
918578333 1:186093237-186093259 ATTTTTAACTTGAATGTCTATGG + Exonic
918691910 1:187491476-187491498 ATCTGTAAAATGAAGGTCAATGG - Intergenic
920638488 1:207728460-207728482 ATTTCTAACATGAAAATCAATGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921754234 1:218834902-218834924 ATTATTATCTGGAATGTCAATGG - Intergenic
922012892 1:221609458-221609480 ATTTTTAAAAAGAAGATAAAAGG - Intergenic
922042741 1:221912798-221912820 ATTTTTAAGAGGAAAGGAAATGG - Intergenic
923379860 1:233406153-233406175 ATTTTAAACATAAAGCTCAATGG - Intergenic
923643599 1:235791971-235791993 ATTTTAAACAGTAAGGCCATGGG - Exonic
923897551 1:238289031-238289053 CCTTTTGACAGCAAGGTCAAGGG - Intergenic
923930162 1:238685189-238685211 GTTTTTAACATGAAGGTGAGAGG - Intergenic
924277330 1:242401718-242401740 ATTTTAGACAGGACTGTCAAGGG - Intronic
1063198153 10:3762252-3762274 CTTTCTAACAGGCAGGTCAGTGG - Intergenic
1063649517 10:7919012-7919034 AGGTTTAACAGGAAGGTGAAGGG + Intronic
1064352518 10:14589214-14589236 CTTTTTAAAAGAATGGTCAAAGG + Intronic
1066623082 10:37379048-37379070 ATTTCTGACAGGAAGATCGATGG + Intronic
1067062375 10:43084176-43084198 ATTTATAACAGGAATGTCCCTGG - Intronic
1068086279 10:52376928-52376950 TTTTTGAACATGAAGATCAAAGG + Intergenic
1069162018 10:65104597-65104619 ATTTTTGACAGGTTTGTCAAAGG - Intergenic
1069378719 10:67820460-67820482 ACTTTGAACAGGAAGGGAAAAGG + Intronic
1069520244 10:69113355-69113377 TTTTTTAACAAGAATGTCATTGG - Intergenic
1071578222 10:86745960-86745982 ATTTTTAACAGCGAGAACAAAGG + Intergenic
1071732997 10:88267741-88267763 ATTTTTAAAAAGATGGCCAATGG + Intergenic
1071841181 10:89473208-89473230 ATTTTTAAAAGAAAGAACAAAGG + Intronic
1073824405 10:107304013-107304035 ATTTTGAAAAGGAAAGTCACAGG + Intergenic
1074742442 10:116498310-116498332 ATTTTTGATAGGAAGGTTACGGG + Intergenic
1079050866 11:17158010-17158032 AAGTTTAAGAGGAAGGTGAAGGG - Intronic
1079104985 11:17565041-17565063 ATTTTTAACAAAGATGTCAAGGG - Intronic
1079492007 11:20999509-20999531 ATTTTTAGTAGGAAAGTCTAAGG - Intronic
1080711868 11:34756133-34756155 CTTTTTAAGAGGAAGAACAAAGG + Intergenic
1080919192 11:36691907-36691929 ATTTTTAAAATGAGGATCAAAGG + Intergenic
1081516823 11:43840413-43840435 ATTTTTAATATGCAGTTCAATGG + Intronic
1081554468 11:44145378-44145400 ACTTTTAGCAGAAAGGACAAAGG + Intronic
1081630678 11:44687523-44687545 ATGGTTAACATGAGGGTCAAGGG - Intergenic
1082608151 11:55267572-55267594 ATTTTTAAGAGGAATGTAAGCGG + Intronic
1082955973 11:58870179-58870201 ATTTTTAATAGGATGGTCAAAGG + Intronic
1082963497 11:58941582-58941604 ATTTTTAATAGGATGGCCAAAGG + Intronic
1082977059 11:59083080-59083102 ATTGTTAATAGGATGGTCACAGG + Intergenic
1083371425 11:62185319-62185341 AATTTTAAAAGGCAGGTCCAAGG + Intergenic
1085320461 11:75570821-75570843 ACTGATAACAGGAAGGTCCAGGG + Intronic
1085346358 11:75770531-75770553 ATTTTTAACAGCATGAACAAGGG - Intronic
1085375677 11:76058759-76058781 ATGGGCAACAGGAAGGTCAAAGG + Intronic
1085566740 11:77520953-77520975 CATGTTAACAGGAAGGCCAAGGG + Intronic
1085720613 11:78909479-78909501 ATGTTTAACAGTAGGGTCTATGG - Intronic
1086291322 11:85313247-85313269 ATCTTCAACAAGTAGGTCAAGGG - Intronic
1086376049 11:86201667-86201689 TTTGTTAACAGGAAGGGGAAAGG + Intergenic
1087904863 11:103684033-103684055 ATTTTTAACGTGAAATTCAATGG + Intergenic
1088772233 11:113046523-113046545 CTTTTCAACAGGAGGGCCAAAGG + Intronic
1088853719 11:113727358-113727380 ATTAATAACAGGAAAATCAAAGG + Intergenic
1089922080 11:122218839-122218861 CATTTTAACAGGAAGCTCCAGGG + Intergenic
1092318370 12:7443570-7443592 ATTTATAGCAGAAAGATCAAGGG + Intronic
1093916568 12:24808828-24808850 ATAATTAACAGGATGGTTAAGGG - Intergenic
1094063363 12:26338827-26338849 ATTTATAACATGAAGCACAATGG - Exonic
1094593836 12:31845999-31846021 ATTTTTAAAAGGAAAATGAAGGG - Intergenic
1095283709 12:40385607-40385629 ATTTTTGATAGGAAGGCTAAGGG - Intergenic
1095682364 12:44993068-44993090 ATTTTTTCCAGGAAGATGAAAGG + Intergenic
1095694116 12:45125007-45125029 GTTTTTAACAGGAAGGAGAATGG - Intergenic
1096689028 12:53308122-53308144 ATTTCTTACAGGAAAGCCAAGGG - Exonic
1097389002 12:58985993-58986015 ATTATTAACATTAAGGCCAATGG + Intergenic
1097606439 12:61760168-61760190 AGTTTTAATAAGAAGGACAAAGG - Intronic
1099008051 12:77259169-77259191 ATTTTTAATAGGATGGTCAAGGG + Intergenic
1099041658 12:77661990-77662012 ATTTTGAAAAAGAAAGTCAAAGG - Intergenic
1099214378 12:79836429-79836451 TTTTTTAACTTGAAGTTCAAAGG - Intronic
1099318730 12:81118185-81118207 ATTTTTAAATGTTAGGTCAAAGG + Intronic
1099909603 12:88813503-88813525 ATTTTTCATAAGAAAGTCAAAGG + Intergenic
1100040802 12:90314624-90314646 ATTTTGAAGAGGGAGGTTAACGG - Intergenic
1100267127 12:92988181-92988203 ATTTGTCACAGCAAGGACAAGGG + Intergenic
1102383231 12:112484947-112484969 ATTTTTAAAAGGGATGTAAAAGG - Intronic
1106466782 13:30020881-30020903 ATTTTAAACTGGAAGGCAAAGGG + Intergenic
1107306964 13:39032523-39032545 ATTCTATACAGCAAGGTCAATGG + Intronic
1108372576 13:49785241-49785263 TTTTTAAACAGGAAGGTGACAGG + Intronic
1110509002 13:76326574-76326596 ATTGTCAGCAGGAAGTTCAATGG - Intergenic
1110553167 13:76829641-76829663 ATATTTAACAGCAAAGTTAAAGG + Intergenic
1110849527 13:80229237-80229259 CTTTTTAACAATCAGGTCAATGG + Intergenic
1111202446 13:84957133-84957155 ATTTTTAACATGTAGGCCTAAGG - Intergenic
1111218423 13:85174509-85174531 ATATTTAAAAGAAAGTTCAAAGG + Intergenic
1111331143 13:86762844-86762866 TTTTTTAACAGGGAGGATAAGGG + Intergenic
1112868532 13:103939321-103939343 ATTTTTAAAAAGGAGGTGAAAGG - Intergenic
1113107525 13:106787588-106787610 ATATTTTACAGGAATGTTAAAGG - Intergenic
1113207922 13:107940174-107940196 ATTTTTAAAAGGCTGGGCAAGGG - Intergenic
1113449706 13:110399094-110399116 ATGTTTAAGAAGCAGGTCAAAGG + Intronic
1115166078 14:30450000-30450022 ATTTTTAAAAGAAATGTCAAAGG - Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1115787357 14:36841513-36841535 ATGTTTGAAAGGAAGATCAATGG - Intronic
1116438249 14:44919523-44919545 ATTTTTAAGAGAGAGGTAAAGGG - Intergenic
1117889475 14:60403089-60403111 ATTTTTGAAAGAAAGGTGAATGG - Intronic
1118099430 14:62579900-62579922 AATTTAAACAAGAAGGTAAAAGG + Intergenic
1118109099 14:62695955-62695977 ATAGTTGACAGGAAGGTAAAAGG + Intergenic
1118563513 14:67113944-67113966 TTCTTTAATAGTAAGGTCAAAGG - Intronic
1120451331 14:84670601-84670623 TTTTTTAACAGGAAAGTATATGG - Intergenic
1120779088 14:88469722-88469744 ATCTTTAACAGGAGGGTGGAAGG - Exonic
1120870393 14:89331487-89331509 TTTTTAAACAGGATGGTCTATGG + Intronic
1124918351 15:33998663-33998685 AAATTTAACAGGAAGGTTATTGG - Intronic
1126158978 15:45591827-45591849 ATTTTTTAGAGGAAGCTCAGAGG + Intronic
1128862060 15:71082524-71082546 ATTGTTAACATGAAAGTCAGAGG - Intergenic
1128957384 15:71962855-71962877 ATTTTGAAAATGAAGGTCACTGG - Intronic
1130262015 15:82362598-82362620 TTATTTAACACCAAGGTCAAAGG - Intergenic
1130279217 15:82506409-82506431 TTATTTAACACCAAGGTCAAAGG + Intergenic
1135052770 16:19205781-19205803 CTCTTTAAAAGGAAAGTCAAGGG - Intronic
1135748671 16:25038798-25038820 ATTTTTAACTGGTAGGTGATAGG - Intergenic
1136101601 16:28000815-28000837 ATTTTAAACTACAAGGTCAAAGG - Intronic
1137010842 16:35318099-35318121 ATTTTTAATGTGCAGGTCAAAGG - Intergenic
1138971360 16:62148083-62148105 ATTTTTACAAGTAAAGTCAAGGG + Intergenic
1140119187 16:72068650-72068672 ATTTTTGACAGGAAGGCCATGGG - Intronic
1140440887 16:74986653-74986675 ATTTTTAACAGCAGTGTAAAGGG + Intronic
1141292456 16:82732530-82732552 ATTTGAAACAGGAAGATGAATGG + Intronic
1142891223 17:2944577-2944599 TTCTTAAAGAGGAAGGTCAAAGG - Intronic
1147021960 17:37541970-37541992 ACCTTGAACAGAAAGGTCAAAGG + Exonic
1148893892 17:50828803-50828825 ATTTTTAGCAGGAACCTAAAAGG + Intergenic
1149274351 17:55016987-55017009 ATTTTTGATAGGAAGGCTAAGGG + Intronic
1150805894 17:68318809-68318831 ATTTGCCACAGGAAGGTCAGGGG + Intronic
1150966394 17:69974049-69974071 ATCTTTAACAGGAAGACAAAAGG - Intergenic
1152861734 17:82700417-82700439 TTTTTTAGAAGGAAGGTCAGAGG + Intergenic
1154089907 18:11348280-11348302 ATTTTAAAAAGGAAAGTGAAAGG + Intergenic
1156244037 18:35280481-35280503 TTTTTTATCAGTAAGGTCATTGG - Intronic
1156328753 18:36099803-36099825 ATTTTTAAAAGGACGTTCATTGG - Intergenic
1158740037 18:60130777-60130799 ATTTTTAACATGAAGATCTTAGG - Intergenic
1159169820 18:64751543-64751565 ATTTTTAACAAGAAGATCAGTGG + Intergenic
1159268593 18:66118685-66118707 AAAATTAACAGGAAAGTCAAGGG - Intergenic
1159269079 18:66125640-66125662 ATTTTTTACAGGAAAGTAAGAGG + Intergenic
1159506293 18:69341252-69341274 ATTATTAGCAGCAAGGTCACTGG + Intergenic
1160004156 18:75056211-75056233 ATGTTTAACATGCATGTCAAAGG + Intronic
1161480885 19:4510060-4510082 ATTTTTAAAAAAAAAGTCAAGGG + Intronic
1164677285 19:30109940-30109962 GTTTTTCAAAGGAAGGTTAAAGG + Intergenic
1164887305 19:31791990-31792012 ATTTTTAAAAAGAAGAACAAAGG + Intergenic
1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG + Intronic
1166609172 19:44173779-44173801 ATTTTTAATAGGGTGGTCAGAGG - Intronic
1166795352 19:45422460-45422482 ACTTTAGATAGGAAGGTCAAGGG - Intronic
1168453006 19:56480416-56480438 ATTTTACACAGGATGGTCAGGGG + Intergenic
924974312 2:158970-158992 ATTTTTAATAGGAAGGCTACGGG + Intergenic
925073487 2:990084-990106 ATTTTTAAAAGAAAGGTCAAAGG - Intronic
925193404 2:1903876-1903898 ATATTTAAAAGGAAGGACACTGG + Intronic
926720775 2:15958596-15958618 ATTATTAAGAGAAGGGTCAAAGG + Intergenic
927381867 2:22488734-22488756 ATTTTTATCAGGAGGTTGAAGGG - Intergenic
929614078 2:43294622-43294644 ATTTTAAGCAGTAAGGTCAGGGG + Intronic
929632917 2:43484158-43484180 ATATTTAAAAGGAAGGTAACTGG - Intronic
931969170 2:67566979-67567001 ATTTTAATTAGGATGGTCAAGGG + Intergenic
932095251 2:68841604-68841626 ATTTTTAACACAAGAGTCAAAGG + Intergenic
932116164 2:69049966-69049988 AATTTTTACAGACAGGTCAAAGG - Intronic
932696175 2:73958652-73958674 ATTTTTAACAGAATTTTCAATGG - Intronic
933396036 2:81732522-81732544 ATTTCTGACAGCAAAGTCAAAGG + Intergenic
935560999 2:104560037-104560059 TTTCTAAACAGGAAGTTCAAGGG + Intergenic
937229280 2:120388113-120388135 ATTTGTGAAAGGAAGGACAAAGG - Intergenic
937302062 2:120848630-120848652 ATTTTTAGCAGGAAAGGCAAAGG - Intronic
937824557 2:126353579-126353601 ATTTTTAAAAAGAAGATCAAAGG + Intergenic
938098469 2:128478926-128478948 TTATTTTACAGGAAGGTAAAGGG + Intergenic
939590976 2:144063049-144063071 ATTTTTGTCAGGCAGGTCTATGG + Intronic
940171811 2:150836648-150836670 ATCTCTACCAGGAAGGACAAAGG + Intergenic
940352549 2:152705442-152705464 ACTTTTGACAGGAAGGCCACGGG - Intronic
940361674 2:152802824-152802846 ATTTTTAACAGCAAGCTCCCAGG - Intergenic
941361323 2:164554974-164554996 ATATTTAAAATGAAAGTCAAAGG + Intronic
941537354 2:166740231-166740253 ATTTTTGACAGGAAGGCCATGGG + Intergenic
942100604 2:172579118-172579140 AAGCTTAACAGGAAGGTCTAGGG - Intronic
943824875 2:192376708-192376730 ATTTATAACAAGAAGGTTAAAGG + Intergenic
945709307 2:213276569-213276591 TGTTTTAAAAGAAAGGTCAATGG + Intergenic
945793868 2:214337625-214337647 ATTTTTTACAGGAAAGTGCATGG + Intronic
946693772 2:222332139-222332161 CTTTATAAAAGGAAGGTGAAGGG - Intergenic
947248835 2:228079078-228079100 ATTTTTTCATGGAAGGTCAAGGG + Intronic
948016302 2:234693412-234693434 ATTTTAATCAGGAAGTGCAAGGG + Intergenic
1169400945 20:5279672-5279694 ATTTTTATGTGGAAGGTCACTGG + Intergenic
1169683336 20:8242133-8242155 ACATGTAGCAGGAAGGTCAAGGG - Intronic
1171261818 20:23740825-23740847 ATTTTTGATAGGAAGGCTAAGGG - Intergenic
1172073179 20:32273789-32273811 TTTTTAAACAGGTAGGTAAAAGG - Intergenic
1173285080 20:41663307-41663329 ATATTTAACAGGAAAGGCACAGG + Intergenic
1173933796 20:46844119-46844141 ATTTGTTACAGGGAAGTCAAGGG + Intergenic
1178188894 21:30257610-30257632 ATTTTTAACAGTAATGTTAAAGG - Intergenic
1178846568 21:36178757-36178779 ATTTTTAAAAGATAGGTAAATGG - Intronic
1184861500 22:47175510-47175532 GTTTTAAACAGGAAGCTCCACGG + Exonic
951804172 3:26626272-26626294 TTTTTAAATAGGAAGGTAAATGG + Intronic
952062172 3:29524067-29524089 AATTTTATCAGGAAGCTCATAGG - Intronic
953439161 3:42903316-42903338 GTGTTTGACAGAAAGGTCAATGG + Intronic
955387345 3:58490645-58490667 ATCTTGAACACGATGGTCAATGG + Intergenic
955945268 3:64187749-64187771 ATTTATACCAGGAGGGACAAAGG - Intronic
956839017 3:73120045-73120067 ATTTTTTAAATGATGGTCAAAGG - Intergenic
958093431 3:88907269-88907291 ATTTTTAACAAGAAGTTCTCTGG + Intergenic
958981744 3:100728467-100728489 CTTTTTACCAGTAAGGTCATAGG + Intronic
959017461 3:101151619-101151641 CTGTTTAACAAGAAGGTCAGTGG - Intergenic
959126767 3:102299426-102299448 ATTTTTGACATGAAGGACATTGG + Intronic
959412620 3:106044310-106044332 ATTTTTTAAAAGTAGGTCAAGGG + Intergenic
960260365 3:115561126-115561148 TTTTTTATAAGGAAAGTCAATGG - Intergenic
960720604 3:120621727-120621749 ATTTTTGACAGGAAGGCTACGGG + Intergenic
961095177 3:124148415-124148437 CTTTTTAAAAGGAAGATCATAGG + Intronic
964017883 3:151969647-151969669 ATTTATTACAGGAAGGAAAAAGG - Intergenic
965057412 3:163739752-163739774 ATAGTTAACAGGAATGTGAATGG + Intergenic
965326274 3:167308725-167308747 ATTTATAAGAGGAAGCTAAATGG + Intronic
965365390 3:167792535-167792557 ATGTTAAACTGGAAGATCAAGGG - Intronic
965454910 3:168887506-168887528 ATTTTTAACTGGAATGAAAAGGG + Intergenic
965949359 3:174287016-174287038 TTTTTTAAAAAGAAGGGCAAAGG + Intergenic
966283254 3:178260893-178260915 TTTTTTAAAAGCAAGATCAAAGG - Intergenic
966626800 3:182025591-182025613 ATTTTTAACAGAGAGGCCCATGG - Intergenic
967590123 3:191263104-191263126 ATTTTTAAAAGTAAGGTTTAAGG - Intronic
970110187 4:12629088-12629110 ATGTTGAACTGGAAGGTGAAAGG - Intergenic
970293896 4:14607066-14607088 TTTTTAAACAGGACTGTCAATGG - Intergenic
970925518 4:21447168-21447190 ATCTTTAACAGAAAGGTAGAAGG + Intronic
971369760 4:26008096-26008118 ATTTTTAAAATGAATGTCTATGG - Intergenic
972027021 4:34393943-34393965 GTTTTTAACAAGGATGTCAAGGG + Intergenic
972196913 4:36664746-36664768 ATTTTCAAAAGGAAAGTCCAGGG - Intergenic
972707781 4:41562231-41562253 ATTTTTAAAAGGAAGCAAAAAGG - Intronic
973879528 4:55255039-55255061 ATTTTAAACATGATGGTCATGGG - Intergenic
974156123 4:58075173-58075195 ATTTTTACCATTAAGTTCAATGG + Intergenic
974175146 4:58312356-58312378 GTTTTTGACAAGCAGGTCAATGG - Intergenic
974978316 4:68920241-68920263 ATTTCTCACATGAAGGCCAAGGG - Intergenic
976297868 4:83489562-83489584 ATTTTAAATAGGAGGGTTAATGG + Intronic
976471860 4:85437898-85437920 ATTTGTAACAGGAAGAACCATGG + Intergenic
976825054 4:89251307-89251329 ACTTTTAATAGTAAGGTCTAGGG + Intronic
976979071 4:91202615-91202637 ATTATTACCAGAAAGGGCAATGG + Intronic
977990936 4:103441726-103441748 ATTTTCAGCTGGAAAGTCAAGGG + Intergenic
979059188 4:116033896-116033918 GTTTTCAACTGGAAGGTCACAGG - Intergenic
980662970 4:135890415-135890437 ATTTTAAAAAGGAAAGTAAAAGG - Intergenic
981331848 4:143519022-143519044 ATTTTAATAAGGAAGGACAAAGG - Intronic
982271251 4:153591467-153591489 TTTTATAACAAGAAGCTCAAAGG + Intronic
982816743 4:159895201-159895223 GTTTTTAACAGGACAGTGAAAGG + Intergenic
983572758 4:169227777-169227799 ACTTTTAAGAGGAATGTCAAAGG + Intronic
983605360 4:169576603-169576625 ATTTTTATCAAGAATGTCATAGG + Intronic
983910521 4:173233793-173233815 ATTTTTAAAAGCAAAGGCAAGGG - Intronic
984632371 4:182074426-182074448 ATTTTTAACAGCCAGGCAAAGGG + Intergenic
985658846 5:1145580-1145602 ATTTGAAACAGGAAGGTCCCTGG + Intergenic
986411548 5:7486424-7486446 ATTTTTAACATGAATTTTAAGGG + Intronic
986758927 5:10862340-10862362 AGGTATAGCAGGAAGGTCAATGG - Intergenic
986953873 5:13126008-13126030 ATTTTTAAGAGGAATACCAATGG + Intergenic
987931028 5:24399446-24399468 ATTTTTGACAGGAAGGCTATGGG - Intergenic
989259185 5:39400140-39400162 ATTTTTAACATTAAGGGGAATGG + Intronic
990061315 5:51652669-51652691 ATTTTTAACTGGAATGTAATTGG - Intergenic
990361127 5:55020972-55020994 ATTTTTCAAAGGAATGTAAAAGG + Intronic
990511789 5:56495753-56495775 ATTGTTAACAGGAATATAAATGG + Intergenic
990703143 5:58497213-58497235 AATTTTAATAGGGTGGTCAAAGG + Intergenic
991256873 5:64623722-64623744 ACTTTAAACAGGAAGTTTAAAGG - Intergenic
993764645 5:91841166-91841188 ATTTTTATCAGTAAGAACAAAGG + Intergenic
994435511 5:99725969-99725991 AATTTAAACAGGAATGTAAAAGG + Intergenic
996723986 5:126657820-126657842 CTTTTTAACAGAAAGATGAAGGG - Intergenic
996737871 5:126774422-126774444 ATTTTTAAAAGACAGGTAAAGGG + Intergenic
996995027 5:129685547-129685569 ATTTGGAACATGAAAGTCAATGG + Intronic
999591902 5:153157483-153157505 GGTATTAACAGCAAGGTCAAAGG + Intergenic
999617594 5:153441323-153441345 ATTTTATACAGGAAAGTCATTGG - Intergenic
999798165 5:155007415-155007437 ATTTTTAAAAAGAAGGCTAAGGG + Intergenic
999957093 5:156714311-156714333 ATTTTAAACAGCAAAATCAAAGG - Intronic
1000174576 5:158738633-158738655 ATTTTTAACATTTACGTCAAGGG - Intronic
1000210257 5:159101317-159101339 CTTTTTAACAGGAAGAATAAAGG - Intergenic
1001289453 5:170446398-170446420 TTTTTTGTCAGCAAGGTCAAAGG - Intronic
1001518094 5:172371161-172371183 ATTTTTAAGATGAAGGGTAAAGG + Intronic
1004124545 6:12859937-12859959 AATTTTTACAGGAAGCGCAATGG - Intronic
1004236574 6:13879888-13879910 ATTTTTGATAGGAAGGCTAAGGG - Intergenic
1007219020 6:40263978-40264000 ATTATTACCAGGAAAGTCTATGG - Intergenic
1008144737 6:47877872-47877894 TTTTTGAACAGGTTGGTCAAAGG - Intergenic
1008257547 6:49322401-49322423 ATTTTGAAAAGGAAAGTAAAAGG - Intergenic
1008376145 6:50794493-50794515 ATTTTTACCAAGAAGGCAAAAGG - Intergenic
1008795042 6:55292812-55292834 ATTTTTAACAAGAATCTCAGGGG - Intergenic
1009398094 6:63225919-63225941 TTTTTTAAAAGGAAAGTAAAAGG - Intergenic
1009932345 6:70191247-70191269 ATTTTTATAAGGAAGATCCAGGG - Intronic
1010892184 6:81326697-81326719 AGTTCTAACAGGTAGGACAATGG - Intergenic
1012747056 6:103104997-103105019 AATTTTAACAAAATGGTCAAAGG - Intergenic
1014030605 6:116698236-116698258 ATTTTTTACAGAAATGTTAACGG - Intronic
1014706829 6:124758207-124758229 GTTTGTAACAGGAAAGTCAAGGG - Intronic
1015259788 6:131223740-131223762 TTTTTTAACAGGAATGAGAAAGG - Intronic
1015297374 6:131612088-131612110 ATTTTTGACAGAAAAGTTAAGGG - Intronic
1015453989 6:133404125-133404147 ATTTTTAACAGGAGTGTCTCAGG + Intronic
1015754246 6:136591705-136591727 ATATTTAAAAGGAGGGTGAAGGG - Intronic
1016064495 6:139665163-139665185 ATTTTTGATAGGAATGTAAATGG - Intergenic
1018276715 6:162140202-162140224 ATTTTAAACAGGAAACTAAAAGG - Intronic
1018937762 6:168284674-168284696 ATGTTTAGCAGGAAGATCATGGG - Intergenic
1019339183 7:500488-500510 TTTGTTAACAGGAAGGCCTAGGG - Exonic
1019850388 7:3549963-3549985 ATTTTTAAGATGTAGGTTAAAGG - Intronic
1020727974 7:11840955-11840977 ATGTGGTACAGGAAGGTCAAAGG - Intergenic
1021103236 7:16607725-16607747 TTTTTTCCCAGGAAGGTAAAAGG + Intronic
1021534105 7:21683246-21683268 ATTTTTAACTGGAAGATGAATGG + Intronic
1021657395 7:22885677-22885699 ATGTTTAACAGAAAGATAAATGG - Intergenic
1021934892 7:25620669-25620691 ATTTTACACAGCAAGCTCAAGGG - Intergenic
1022764341 7:33393832-33393854 ATTTCTAACAGGTGGGTCACTGG + Intronic
1023259114 7:38340912-38340934 ATTTTCTACAGGAAGATCACAGG + Intergenic
1024719882 7:52124047-52124069 CTTTCTACCAGGAAGGACAAAGG + Intergenic
1024751208 7:52467520-52467542 ATTTATCAGAGGAAGGTCACTGG - Intergenic
1027591076 7:80119932-80119954 ATTTTTAACAGGAAGGGGAATGG - Intergenic
1028160722 7:87481963-87481985 ATTTTTAAGAGAAAGGTCAAAGG - Intergenic
1028604648 7:92642581-92642603 ATTATGAACAGGAAGTTCAGTGG + Intronic
1028736163 7:94214862-94214884 ATTTTTAACAGAACAGTCAAGGG - Intergenic
1030358960 7:108575219-108575241 AATTTTCACTTGAAGGTCAAGGG + Intergenic
1030420697 7:109303245-109303267 ATTTTTGACAGGAAGGCTATGGG - Intergenic
1031452065 7:121934218-121934240 AATTTTAGCAAGAAGGGCAAAGG + Intronic
1032544308 7:132728891-132728913 ATTTTGAACAGGTAGGTTGAGGG - Intergenic
1032572739 7:133017954-133017976 ATTTTTCACTGGAAGGTGATTGG - Intronic
1033706959 7:143899216-143899238 ATATTTATATGGAAGGTCAAAGG + Intronic
1033995257 7:147337887-147337909 AATTTTATCAGTAAGGTCAGGGG - Intronic
1034868158 7:154658384-154658406 AAGTTTACCAGGAAGGTAAATGG + Intronic
1034973565 7:155434964-155434986 ATTTTCCACAAGAAAGTCAATGG + Intergenic
1036930885 8:12954125-12954147 ACTTTAAATTGGAAGGTCAATGG + Intronic
1037160126 8:15759533-15759555 ATATTTCACAGGAAGGGAAAAGG + Intronic
1043274725 8:78378722-78378744 ATTTTAAATATGAATGTCAAAGG + Intergenic
1043578880 8:81689125-81689147 AGTTTTAACAGAAAAGTCATCGG + Intergenic
1046137589 8:110049364-110049386 ATTTTTAATAGTACAGTCAATGG + Intergenic
1046501043 8:115077475-115077497 CTTTTTAAAAAGAAGGTCAAAGG - Intergenic
1047030449 8:120873558-120873580 ATTTAAAGCAGGAAGGCCAAAGG - Intergenic
1048068441 8:130997036-130997058 ATTTTTAACAGTAAGAGAAATGG + Intronic
1051114519 9:13679195-13679217 GTTTTTAAAAGAAAAGTCAATGG - Intergenic
1051177692 9:14377684-14377706 AATTTTAAGAGGAAGGAAAAGGG + Intronic
1051629799 9:19130720-19130742 ATTCCTAACAGGAATGTAAATGG + Intronic
1051797211 9:20885673-20885695 ATTTTTAAAAGGTAGCTGAAAGG - Intronic
1052302735 9:26972410-26972432 ACTTTTGACAGGAAGGCCACGGG + Intronic
1052336567 9:27326006-27326028 ATCTTTAACAGGGATGTTAAAGG + Exonic
1052529189 9:29658754-29658776 ATTTTTGACAGGAAGGCTACTGG + Intergenic
1052718066 9:32142499-32142521 ATTTTAATCAGAAATGTCAATGG + Intergenic
1053367274 9:37532078-37532100 ATTTGTAACAGGAAAATAAATGG - Intronic
1055321782 9:75089050-75089072 ATTTTTTAAAGGGAGATCAATGG - Intronic
1055872850 9:80905075-80905097 TTTTCTAACAGTAAGGTGAAGGG - Intergenic
1056655865 9:88508572-88508594 ATTTTCAACAGGAATGAAAATGG + Intergenic
1057482597 9:95457089-95457111 ATTTTTACAAGGAAGATGAAAGG - Intronic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1061070797 9:128309407-128309429 AGCTGTAACAGAAAGGTCAATGG - Exonic
1061528871 9:131194057-131194079 ATTTTTAATATGATGGGCAAAGG + Intronic
1186151609 X:6680502-6680524 TTTTTCAATAAGAAGGTCAATGG - Intergenic
1186584798 X:10861342-10861364 ATTTATAACAGCAAAGACAAAGG - Intergenic
1186716054 X:12252860-12252882 ACTTTAGACAGCAAGGTCAAGGG + Intronic
1187111820 X:16309786-16309808 ATTTTTATCAGGAAGGATCATGG + Intergenic
1189935443 X:46063335-46063357 AGGTTTAACAGGAATGTAAAAGG - Intergenic
1190066665 X:47246057-47246079 ATTTTTAACAGGGTAGTCAGAGG - Intronic
1190383867 X:49865414-49865436 ATTTTCAACTAGAATGTCAAGGG - Intergenic
1190508221 X:51150155-51150177 ATTTTTAAAAGGAATGATAATGG - Intergenic
1190766122 X:53477209-53477231 ATTGTTAACCACAAGGTCAATGG + Intergenic
1191731051 X:64335697-64335719 AAATTTAACAGGAAGAACAAGGG - Intronic
1192217713 X:69175077-69175099 ATTTTAAGCAGGAAAGTCAGTGG + Intergenic
1193252935 X:79314190-79314212 ATTTTTGTTAGGAAGGTCATTGG - Intergenic
1193656833 X:84208958-84208980 TTTCTTAACAAGAAGGTCACTGG - Intergenic
1194183693 X:90745079-90745101 ATTTTTAGCAAGAAGGAGAATGG - Intergenic
1194933313 X:99915958-99915980 GTTTTGAGCAGGAATGTCAAGGG + Intergenic
1195462202 X:105140184-105140206 AGTTCTAATAGGAAGGTAAAAGG - Intronic
1196047450 X:111271046-111271068 ATTGTTAAGAGGAAAGTGAATGG + Intergenic
1197267163 X:124386985-124387007 ATGTTTCAGAGGAAGGTAAATGG + Intronic
1197552600 X:127911811-127911833 AATTTAATCAGGAAGGTGAAAGG + Intergenic
1197666215 X:129226571-129226593 AGTTTTAAAAGGAATCTCAAAGG + Intergenic
1197886594 X:131224488-131224510 ATTTTTAAAAGCAAAGACAATGG + Intergenic
1198968703 X:142255176-142255198 ATTTTTTCTAGGAAGGTAAATGG + Intergenic
1200530294 Y:4327028-4327050 ATTTTTAGCAAGAAGGAGAATGG - Intergenic
1201260230 Y:12152138-12152160 ATTTTTAATAGGAAGGCTACAGG + Intergenic