ID: 1165723245

View in Genome Browser
Species Human (GRCh38)
Location 19:38094491-38094513
Sequence TTTGGGAAGCCAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3594
Summary {0: 1, 1: 5, 2: 72, 3: 577, 4: 2939}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165723245_1165723253 12 Left 1165723245 19:38094491-38094513 CCCTCCTCCTTTGGCTTCCCAAA 0: 1
1: 5
2: 72
3: 577
4: 2939
Right 1165723253 19:38094526-38094548 CAGGCATGAGCCACTGCACCTGG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
1165723245_1165723249 -7 Left 1165723245 19:38094491-38094513 CCCTCCTCCTTTGGCTTCCCAAA 0: 1
1: 5
2: 72
3: 577
4: 2939
Right 1165723249 19:38094507-38094529 TCCCAAAATGCCGAGATTACAGG 0: 17
1: 1447
2: 35581
3: 333600
4: 258638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165723245 Original CRISPR TTTGGGAAGCCAAAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr