ID: 1165725645

View in Genome Browser
Species Human (GRCh38)
Location 19:38110763-38110785
Sequence TTGGGGGATTTGCAGCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165725645_1165725654 27 Left 1165725645 19:38110763-38110785 CCTACCAGCTGCAAATCCCCCAA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1165725654 19:38110813-38110835 GCATCAGAAGCCCCAGAATTGGG 0: 1
1: 0
2: 1
3: 7
4: 184
1165725645_1165725653 26 Left 1165725645 19:38110763-38110785 CCTACCAGCTGCAAATCCCCCAA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1165725653 19:38110812-38110834 TGCATCAGAAGCCCCAGAATTGG 0: 1
1: 1
2: 1
3: 10
4: 162
1165725645_1165725655 28 Left 1165725645 19:38110763-38110785 CCTACCAGCTGCAAATCCCCCAA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1165725655 19:38110814-38110836 CATCAGAAGCCCCAGAATTGGGG 0: 1
1: 0
2: 0
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165725645 Original CRISPR TTGGGGGATTTGCAGCTGGT AGG (reversed) Intronic
900349861 1:2229230-2229252 TTTGAGGATCTCCAGCTGGTCGG - Exonic
901499292 1:9641674-9641696 TTGTGGGTTTTGCAGGTGGAGGG - Intergenic
902059765 1:13632267-13632289 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
902120577 1:14161767-14161789 TTGGGGGGTTTGGAGATGGAAGG - Intergenic
902205281 1:14863929-14863951 TGGGGGGATGTGCAGCTGAAAGG + Intronic
902554950 1:17241349-17241371 TTGGGGTGTTGGCAGCTGGCAGG + Intronic
902733201 1:18383501-18383523 TGGGGGAATCTGCAGATGGTGGG - Intergenic
902822436 1:18951464-18951486 TAGTGTGATTTGCAGCTGGCTGG - Intronic
902964603 1:19990526-19990548 TTGCTGGTTTTGCAGCTAGTGGG + Intergenic
903345185 1:22679958-22679980 TTGGGGGAGGAGCAGCTGGAAGG - Intergenic
904700930 1:32357706-32357728 GTGGGGGATTTGCTTGTGGTTGG + Intronic
904809297 1:33152961-33152983 TTGGGGGATTTAGACCAGGTAGG + Intronic
906201844 1:43965612-43965634 TTTGGGGATGTGCAGGTGTTTGG + Intronic
912807202 1:112766529-112766551 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
914865460 1:151424199-151424221 ATGGGGGCTTTGCTGCTGATGGG + Exonic
915216522 1:154344128-154344150 TTGTGGTATTTTCAGCTGCTGGG + Exonic
920194654 1:204218779-204218801 TTGTGGGGTTGGCAGCTTGTGGG - Intergenic
921105037 1:211968569-211968591 TTGTGGCAATTGCAGGTGGTGGG + Exonic
922539303 1:226407170-226407192 TTGGTGCATTTGCAGCTGTCTGG - Intronic
1064874097 10:19973727-19973749 TTGGGGGCTTTCAGGCTGGTGGG - Intronic
1065053422 10:21818560-21818582 TTGCTGGTTTTGCAGCTTGTGGG + Intronic
1065611248 10:27472633-27472655 TAGGGGGATTTTGAGCTGGGTGG + Intergenic
1065936254 10:30523037-30523059 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1067190041 10:44061293-44061315 ATGGGGGGCATGCAGCTGGTGGG + Intergenic
1069486141 10:68825233-68825255 ATGAGGGACTTGCAGCTAGTTGG - Intergenic
1071859610 10:89658801-89658823 CTGAGGAATTTGTAGCTGGTTGG - Intergenic
1072562822 10:96592078-96592100 TGTGTGGTTTTGCAGCTGGTTGG - Intergenic
1072719289 10:97771002-97771024 TTGGGGGATTCTCAGCAGCTTGG + Intronic
1074394443 10:113085991-113086013 TTGGGGCAATTCCAGCAGGTGGG + Intronic
1075464817 10:122643352-122643374 TGGGGGGGTCTGCAGCTGGATGG - Exonic
1077822934 11:5768216-5768238 TTGGGGGATGGGCAGATGGAAGG - Intronic
1081910952 11:46699748-46699770 TGGTGGGATTTGCAACTGGGAGG - Intronic
1085022051 11:73216140-73216162 TTGGGGGATTTGAAGCCTGCTGG + Intergenic
1088224509 11:107604878-107604900 TTGGGGCATTTCCAGCAGCTTGG - Intronic
1088443035 11:109892722-109892744 CTGGGGGGTTTGGAGCTGTTTGG + Intergenic
1091393402 12:139272-139294 GTGGGCGACTTGCAGCTGGCTGG - Exonic
1091633028 12:2176562-2176584 TTGGGGGGGTTGGAGCTGGGGGG + Intronic
1095132865 12:38564558-38564580 TAGGGGGATTGGCAACTTGTAGG - Intergenic
1095172766 12:39055184-39055206 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1096688117 12:53302524-53302546 TTGGGGGATTTTAAGCAGGCAGG - Intronic
1098960599 12:76736060-76736082 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1100037525 12:90271205-90271227 TTGGGGGATTTGTGTCTTGTGGG - Intergenic
1100430301 12:94526271-94526293 TTGGGGCAGATGCAGTTGGTTGG - Intergenic
1100435950 12:94571844-94571866 TTTGGGGATTTGCAGCCGCCTGG - Intronic
1102943185 12:116961941-116961963 TTGGGGGATTTGGACCAGGGTGG + Intronic
1103225172 12:119281191-119281213 TTGGGTGATTTCCAGCTTGAGGG - Intergenic
1107472055 13:40700112-40700134 TTGGGGGGTTGGGAGGTGGTTGG - Intergenic
1109909452 13:68890661-68890683 TAGAGGAAGTTGCAGCTGGTGGG + Intergenic
1110569712 13:76991048-76991070 TTGGAGGATATGTAGCTTGTGGG - Exonic
1112659896 13:101496012-101496034 TTGTGGAATTTGAAGCTGGTGGG - Intronic
1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG + Intergenic
1113856107 13:113446234-113446256 CTGGGGGGTTTGCAGCTGCAGGG - Intronic
1113964424 13:114144565-114144587 CTGGGGGATTTGCAGGGTGTGGG + Intergenic
1114515515 14:23297413-23297435 TTGGTTGGTTTGCAGATGGTGGG + Exonic
1115820198 14:37205612-37205634 TTGGGGGATGGGGAGCTGGCGGG - Intronic
1117685132 14:58245058-58245080 GTGGGCCATTTGCAGCTGTTTGG + Intronic
1118372154 14:65146495-65146517 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
1118386240 14:65257781-65257803 TTGGGGGACTTGCCTCTGGGTGG - Intergenic
1122025535 14:98873138-98873160 TTGAAGGATTTGAAGCTGGGAGG - Intergenic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1202904595 14_GL000194v1_random:60869-60891 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1125891944 15:43273606-43273628 CTGGGGGATGTCCAGCTGGAAGG + Intergenic
1129116976 15:73369798-73369820 GTGGGGGCTGTGCAGCTGCTTGG - Intergenic
1130336156 15:82958893-82958915 TGGGGGCACTTGCAGCTGGCTGG - Intronic
1131721115 15:95169958-95169980 TTGGGGGATCTACAGCAGGAGGG + Intergenic
1138622949 16:58226232-58226254 TTGGGGGTTGCACAGCTGGTGGG + Intergenic
1139235997 16:65339947-65339969 TTGGGAGATTTACAGCAGCTAGG + Intergenic
1139656219 16:68388611-68388633 GAGGGGGCTGTGCAGCTGGTGGG - Intronic
1140533170 16:75684268-75684290 TGGGGGGATTTGCCTCTGTTAGG + Intronic
1141890558 16:86924134-86924156 TGGGCGCATTTGCTGCTGGTGGG - Intergenic
1142641426 17:1288231-1288253 GTGGGGGATGGGGAGCTGGTGGG - Intronic
1142968075 17:3593323-3593345 TTAAGTGATTTGGAGCTGGTTGG + Intronic
1146629251 17:34458320-34458342 TTTGGGGACTGGCAGCTGGGTGG - Intergenic
1149019662 17:51948451-51948473 TGGGGAGCGTTGCAGCTGGTTGG - Intronic
1151864644 17:76792933-76792955 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
1152610879 17:81314547-81314569 CTGGGGGAGTTGCAGGTGGTGGG - Intronic
1152619469 17:81355004-81355026 TTCTGTCATTTGCAGCTGGTCGG - Intergenic
1152828172 17:82480461-82480483 TGGGGGGCTTTGCAGATGTTTGG + Intronic
1153475440 18:5494192-5494214 TTGGGGGGTTGGCAGCAGGCAGG - Intronic
1153957778 18:10112789-10112811 CTGAAGGATTGGCAGCTGGTGGG - Intergenic
1156353474 18:36321669-36321691 TTGGGGGACTTGCAGGTGGCTGG + Intronic
1156487773 18:37477476-37477498 CTGGGTGGTTTGCAGGTGGTGGG + Intronic
1156649874 18:39213076-39213098 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
1156761413 18:40596162-40596184 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
1159574267 18:70156616-70156638 TTGCTGGTTTTGCAGCTTGTGGG + Intronic
1160456010 18:79001076-79001098 TACAGGGATTTGAAGCTGGTTGG - Intronic
1160534544 18:79585159-79585181 TCGGGGGCTTTGCACCTGGAGGG + Intergenic
1160746385 19:713074-713096 GTGGGGGGTTTGCTGCTGGGTGG + Intronic
1163765588 19:19161571-19161593 TTGGGGGATTGGCATGTGTTGGG - Intronic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1165992870 19:39826146-39826168 TTGGGGGCTTTGGAGGTGGGTGG - Intronic
1166581562 19:43904818-43904840 TTGGGCAATTTGCTGCTGTTTGG - Intergenic
1166759146 19:45213563-45213585 AAGGGGGATTTGGAGATGGTTGG - Intronic
1167505468 19:49869077-49869099 TTGGGGGATCGGCAGTTGGGAGG - Exonic
1167982936 19:53291012-53291034 TTGCTGGCTTTGCAGGTGGTGGG - Exonic
926531346 2:14049898-14049920 TTGGGTGTTGAGCAGCTGGTGGG + Intergenic
926859074 2:17290152-17290174 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
927786654 2:25979614-25979636 TTGGGGGTTATGCAGGAGGTAGG - Intronic
930222181 2:48755900-48755922 TAGGGCCATTTGCAGATGGTAGG - Intronic
930855287 2:56009378-56009400 CTGGGGTATTTGCAGGTGGTGGG + Intergenic
932492136 2:72128980-72129002 TTGGGGGAGGGGCAGCTGGGAGG - Intergenic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
933085733 2:78052598-78052620 TTGGGTTAATTGCAGCTTGTTGG + Intergenic
933121861 2:78547839-78547861 TTGGTGGTTTTGAAGCTGGTGGG + Intergenic
933986091 2:87593494-87593516 TTCTGGGATGTGCAGCTGGGAGG + Intergenic
934502046 2:94869526-94869548 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
934950393 2:98571702-98571724 TTTGGGGGTATTCAGCTGGTGGG - Intronic
935649557 2:105370574-105370596 GTGGGGGGTGTGGAGCTGGTGGG + Intronic
936559941 2:113528754-113528776 ATGGAGGACTTCCAGCTGGTTGG + Intergenic
937839980 2:126515111-126515133 TTTTGGAATTTGTAGCTGGTGGG - Intergenic
938888175 2:135675347-135675369 TTGGTAGTTTTGCTGCTGGTTGG - Exonic
939796789 2:146655404-146655426 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
942017218 2:171829330-171829352 CTGGGAGTTTTGCAGATGGTTGG - Intronic
942540410 2:177009540-177009562 TTGGGAGTTTTGCAGGTGGTTGG - Intergenic
943165230 2:184314101-184314123 TTGGAGGATCTGCAACTGTTAGG - Intergenic
944099970 2:196014388-196014410 CTGGGTGATTTGGAGCTGTTCGG - Intronic
944244919 2:197521264-197521286 TTGCCGGTTTTGCAGCTTGTGGG - Intronic
944368785 2:198956412-198956434 TTATGGGATTGGCAGCAGGTGGG - Intergenic
945066626 2:205953103-205953125 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
946249864 2:218405520-218405542 TTGGGGGATCTGTAGGAGGTGGG + Exonic
948201029 2:236129962-236129984 TTTGGGGTTTTGCACCTGTTGGG + Exonic
948555569 2:238807819-238807841 TTGTGGGATTTGTCGCAGGTAGG + Intergenic
948899727 2:240950189-240950211 GTGGGGGGTGTGCAGCTGGCTGG + Intronic
1168874071 20:1158435-1158457 TTGGGAATTTTCCAGCTGGTTGG - Intronic
1170030102 20:11935657-11935679 TTGGGGGGTTTTCAGCTGCTGGG + Intergenic
1172223275 20:33287995-33288017 TGGGTGGATTTGCAGCTGAGAGG + Intronic
1172392680 20:34576526-34576548 TTGCTGGATTTGCAGCTGGAAGG - Intronic
1176623965 21:9075636-9075658 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1181573988 22:23782489-23782511 TTGGGGGTGAGGCAGCTGGTGGG + Intronic
1182070160 22:27457981-27458003 TTGTGGGATCTCCAGGTGGTGGG - Intergenic
1182079350 22:27518183-27518205 TTGGGGGTATGGCAGCTGGCTGG + Intergenic
1183041732 22:35184990-35185012 TTGGGTCGATTGCAGCTGGTTGG - Intergenic
950213395 3:11140400-11140422 TAGGTGGAATTGCAGCTGGAGGG - Intronic
950351055 3:12353567-12353589 TTGGGGGTGTTGCAAATGGTTGG + Intronic
950455486 3:13090527-13090549 GTGGGGGACTTGCAGCCAGTGGG - Intergenic
952161683 3:30700104-30700126 TTGGGTGACTTGCAACTGCTTGG - Intergenic
952581891 3:34843770-34843792 TTAGCGGATTTCCAGCTGGTGGG - Intergenic
952952812 3:38538493-38538515 ATGGGGGCCTTGCAGCAGGTGGG + Intronic
954369762 3:50164002-50164024 TTGGGGGATGTGCAGCTTCCAGG - Intronic
954636893 3:52075841-52075863 TCGGTGGATTTGCAGGTGGCAGG - Exonic
956688104 3:71850822-71850844 TTGGGAGATTTGCAGTTTGTAGG + Intergenic
957373501 3:79326338-79326360 TTGCTGGTTTTGCAGCTTGTGGG + Intronic
957874781 3:86131169-86131191 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
960374214 3:116878581-116878603 TTGCTGGTTTTGCAGCTTGTGGG - Intronic
961123739 3:124397180-124397202 TTGAGGGCTTTGCTGCTGGGAGG - Intronic
962456164 3:135567456-135567478 TGTGGGGATTTGGAGCTGCTTGG + Intergenic
963040869 3:141068921-141068943 TTGGGGTATTTTAAGCTTGTGGG + Intronic
963737991 3:149042850-149042872 TTGGGTTATTTCCTGCTGGTCGG + Intronic
963921509 3:150910175-150910197 TTGGGGGATTGGAAACTGGTTGG + Intronic
964257621 3:154794873-154794895 AAGGGGGGTTTGCAGATGGTTGG + Intergenic
965776672 3:172239142-172239164 CTGAGGGACTTGCAGCTGGGTGG + Intronic
968066841 3:195763557-195763579 CTGGGGGACTTCCTGCTGGTCGG - Exonic
968212118 3:196857649-196857671 TTGCTGGTTTTGCAGCTTGTGGG - Intergenic
968856016 4:3122874-3122896 TTCTGTGATTTGCAGCTGGAGGG + Exonic
969362977 4:6676949-6676971 TGGGTGGATGTGAAGCTGGTGGG + Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970027411 4:11638215-11638237 TTGGGGGAAATGCAGCAGCTAGG - Intergenic
972667789 4:41183822-41183844 CTGGGGGAGTTGCAGGGGGTGGG + Intronic
972727523 4:41758201-41758223 TTAGGGGGTTTTCAGCAGGTAGG - Intergenic
974548737 4:63345860-63345882 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG + Intronic
977649516 4:99453945-99453967 TTGGGTCAATTGCAGCTTGTTGG + Intergenic
977776720 4:100929662-100929684 TTGAGGGATTCGTAGCTGGCTGG - Intergenic
986003380 5:3647914-3647936 TTCAGAGATGTGCAGCTGGTGGG + Intergenic
991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG + Intronic
992093197 5:73337966-73337988 TTGGGGGCTTTGGCCCTGGTTGG + Intergenic
993788696 5:92178168-92178190 TTTGGTGAATTGCTGCTGGTTGG - Intergenic
998033757 5:138895424-138895446 TTGTGGGATGTGGAGATGGTGGG + Intronic
998435142 5:142101733-142101755 TTGGGGGATTTGCAGATATATGG + Intergenic
999450104 5:151671589-151671611 ATGGGGGCTGGGCAGCTGGTGGG + Exonic
1000501208 5:162053188-162053210 TTAGGGGATTTGCAGAGGGAAGG + Intergenic
1003990256 6:11479824-11479846 TTGGGGGATTTTAAACTTGTTGG - Intergenic
1005004336 6:21272713-21272735 TTTGGGGATTTGCAGTGGGAGGG + Intergenic
1005152183 6:22764797-22764819 TTTAGGGAATTGCAGCTGGAAGG - Intergenic
1005767264 6:29024314-29024336 TTCTGGGATTAGCAGGTGGTTGG + Intergenic
1008170760 6:48202652-48202674 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1008768730 6:54952365-54952387 TTGGGGGAGTGGGAGGTGGTGGG - Intergenic
1009809218 6:68639367-68639389 TTGGGTGGTTTGCAGCTCCTGGG - Exonic
1011015435 6:82749191-82749213 TTGGGGGATGTGTAGGAGGTGGG - Intergenic
1019215287 6:170439107-170439129 CTGGGGGTTCTGCAGCTGGGAGG + Intergenic
1020553142 7:9633450-9633472 TTCAGAGATTTGCAGGTGGTAGG - Intergenic
1021116850 7:16754060-16754082 TTGGGGGCTTTGCACCTGCTTGG + Intronic
1022967491 7:35487209-35487231 TCAGGGGAGTTGCAGCTGGCAGG - Intergenic
1024622088 7:51169238-51169260 TTGGGGGACTTCCAGCTCATAGG - Intronic
1031551376 7:123117515-123117537 TGGGTGGATTTGCTACTGGTAGG + Exonic
1032549869 7:132774819-132774841 TTGGGGTATTTGGGGCTGATGGG - Intergenic
1032943716 7:136825593-136825615 TAGGAGGCTTTGCAGCTGGCTGG + Intergenic
1033638083 7:143231382-143231404 TTGGAGGATTTTAAGCAGGTGGG - Intergenic
1034268546 7:149792522-149792544 GTGGTGGATGTGCAGCTGGGCGG - Intergenic
1034670738 7:152856299-152856321 TTGGGGGATTTGCTGCTTCTCGG + Intergenic
1037265350 8:17053255-17053277 TTAGGGTATTATCAGCTGGTAGG + Intronic
1037303403 8:17478212-17478234 CTGGGGAACTTGCAGCTGATGGG + Intergenic
1038786524 8:30622334-30622356 TTGCTGGTTTTGCAGCTTGTGGG - Intronic
1047310400 8:123687064-123687086 ATGGTGGATTTTAAGCTGGTGGG - Intronic
1047447747 8:124934764-124934786 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1049892925 9:87610-87632 GTGGAGGACTTCCAGCTGGTTGG - Intergenic
1052767018 9:32651285-32651307 TTGGGTCAATTGCAGCTTGTTGG - Intergenic
1053734149 9:41087672-41087694 GTGGAGGACTTCCAGCTGGTTGG - Intergenic
1054694249 9:68343880-68343902 GTGGAGGACTTCCAGCTGGTTGG + Intronic
1055218333 9:73895470-73895492 ATGAGGGATGTGCAGCTGTTCGG + Intergenic
1058268474 9:102937526-102937548 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1059443751 9:114325411-114325433 TTGGGGGATTGGCAATTGGAGGG + Intronic
1059444952 9:114332188-114332210 TTGGGGGATTGGCAATTGGAGGG + Intronic
1203747148 Un_GL000218v1:46064-46086 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1203562958 Un_KI270744v1:73416-73438 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
1189865585 X:45323759-45323781 TTGGGGAGTTTTCAGCTGGATGG + Intergenic
1190616342 X:52236822-52236844 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1190873356 X:54443298-54443320 TTGGTGGATCTGCAACTGGGTGG - Intronic
1191126080 X:56955146-56955168 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1192264506 X:69529679-69529701 GTGGTGGAATTGCTGCTGGTGGG - Exonic
1194917537 X:99723497-99723519 TTGGGGCAATTGCAGCTTGTTGG - Intergenic
1195381557 X:104276133-104276155 TTGGGGGAGGTGCAGTAGGTAGG - Intergenic
1195394702 X:104398324-104398346 TTGCAGGCTTTGCAGCTGATTGG + Intergenic
1200016323 X:153166389-153166411 TTGCTGGTTTTGCAGCTTGTGGG + Intergenic
1200067572 X:153511395-153511417 GTGGGGGATTGGCAGCTTGCCGG - Intergenic
1200374450 X:155765227-155765249 TGAAGGGATTTGCAGATGGTTGG + Intergenic
1201160469 Y:11161059-11161081 TTTGGGATTTTGCAGCTGGCAGG - Intergenic