ID: 1165726963

View in Genome Browser
Species Human (GRCh38)
Location 19:38119629-38119651
Sequence GTCCTGGGCCACCACCCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165726963_1165726973 11 Left 1165726963 19:38119629-38119651 CCTGGAGGGTGGTGGCCCAGGAC 0: 1
1: 0
2: 2
3: 32
4: 347
Right 1165726973 19:38119663-38119685 GGTGGAAATCGACTGCATTTTGG 0: 1
1: 0
2: 0
3: 7
4: 87
1165726963_1165726970 -7 Left 1165726963 19:38119629-38119651 CCTGGAGGGTGGTGGCCCAGGAC 0: 1
1: 0
2: 2
3: 32
4: 347
Right 1165726970 19:38119645-38119667 CCAGGACTACGCCCAGGGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 143
1165726963_1165726967 -10 Left 1165726963 19:38119629-38119651 CCTGGAGGGTGGTGGCCCAGGAC 0: 1
1: 0
2: 2
3: 32
4: 347
Right 1165726967 19:38119642-38119664 GGCCCAGGACTACGCCCAGGGGG 0: 1
1: 0
2: 0
3: 19
4: 160
1165726963_1165726974 12 Left 1165726963 19:38119629-38119651 CCTGGAGGGTGGTGGCCCAGGAC 0: 1
1: 0
2: 2
3: 32
4: 347
Right 1165726974 19:38119664-38119686 GTGGAAATCGACTGCATTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165726963 Original CRISPR GTCCTGGGCCACCACCCTCC AGG (reversed) Exonic
900412463 1:2519023-2519045 CTTCTTGGCCCCCACCCTCCAGG + Intronic
900435192 1:2627857-2627879 GCCCTGGACCCCCTCCCTCCAGG - Intronic
900461022 1:2802141-2802163 GTCCTGGGGCACCTCCCCACAGG + Intergenic
900514929 1:3077179-3077201 GTCCTGGTCCACGGGCCTCCTGG + Intronic
901534375 1:9872818-9872840 GTCCAGAGCCCCCTCCCTCCAGG + Intronic
901586924 1:10303536-10303558 GTCCCTGGCCACTGCCCTCCAGG - Intronic
901795255 1:11676045-11676067 GTCCTGGACCACAACCCCCCAGG - Exonic
901813116 1:11778928-11778950 TCCCAGGGCCCCCACCCTCCCGG + Exonic
902048499 1:13543474-13543496 GGCCTGAGCCACCATCCTCCTGG - Intergenic
902285211 1:15403905-15403927 TCCCTGGCACACCACCCTCCAGG + Intergenic
903151658 1:21414354-21414376 GTCATGGTCACCCACCCTCCAGG + Intergenic
905206743 1:36346963-36346985 CTCCTGGGGCACCACCCCCATGG - Intronic
905631436 1:39521265-39521287 GTCCTCAGCCTCCACGCTCCTGG + Intronic
905666318 1:39764906-39764928 GTCCTCAGCCTCCACGCTCCTGG - Intronic
906097807 1:43236032-43236054 ACCCTGGCCCAGCACCCTCCGGG - Intronic
906129386 1:43447114-43447136 TTCCTGGCCCACCACCCTGACGG + Exonic
908047308 1:60184661-60184683 GAAGAGGGCCACCACCCTCCAGG - Intergenic
909103241 1:71377375-71377397 GTCCCTGGCCCCCTCCCTCCAGG - Intergenic
911041508 1:93594536-93594558 GCCCTGGACCGCCAGCCTCCAGG + Intronic
912506608 1:110161070-110161092 GTCCTGGGCCAGCAGCATCCAGG + Intronic
912704965 1:111904869-111904891 CACTTGGGCCACCACCCTCGGGG + Intronic
914460266 1:147877424-147877446 CTCAGAGGCCACCACCCTCCTGG + Intergenic
915113223 1:153577998-153578020 GTCCTGGGACAGCAACCTCCTGG + Intergenic
916605383 1:166337489-166337511 TTCCTAGGCCACCAGCCTCTGGG + Intergenic
917882261 1:179348884-179348906 GTCATGGACCACCACATTCCAGG - Exonic
917956253 1:180101907-180101929 TCCCTGGGCTGCCACCCTCCAGG + Intronic
920173244 1:204084459-204084481 GTGCTTGGCCAGCAGCCTCCAGG + Intronic
920250238 1:204618297-204618319 GTCCAGTGCCTCCTCCCTCCGGG - Exonic
920626956 1:207611956-207611978 TTCCTGGGCCAACTCCCTCATGG + Exonic
920636900 1:207712781-207712803 TTCCTGGGCCAACTCCCTCATGG + Intronic
921127374 1:212189591-212189613 GTCCTGTGCCACCACATTTCAGG + Intergenic
922603631 1:226875128-226875150 GTACTGCCCTACCACCCTCCCGG - Intronic
922796823 1:228343595-228343617 TTCCTGGGCCCCCACCTCCCTGG - Intronic
922861676 1:228823199-228823221 GTCCTGGGACATCAGACTCCAGG - Intergenic
923141137 1:231162352-231162374 CCCCTGGGCCGCCACCCGCCGGG - Intronic
1062907927 10:1191249-1191271 GCCCTGGCCCCCCACCCTCCTGG - Intronic
1063060622 10:2547733-2547755 TTCCTGGCCCTCCACCCTCCTGG + Intergenic
1063450298 10:6145890-6145912 GTGCTGGGCCTCCAACCACCCGG - Intronic
1066244823 10:33572174-33572196 GTCCTGGCCAACCAGCATCCTGG + Intergenic
1067059250 10:43069507-43069529 GTCCTGGACCCCCACCTGCCTGG - Intergenic
1067576012 10:47409165-47409187 GCCCTGGGCATCCTCCCTCCAGG + Intergenic
1069956386 10:72054418-72054440 CTCCATGGGCACCACCCTCCAGG - Intergenic
1071604007 10:86972184-86972206 GTCCAGCCCCACCAGCCTCCTGG - Intronic
1071819523 10:89265237-89265259 GTCCTGGGCCCCCAAACTGCAGG + Intronic
1073042709 10:100618340-100618362 GGTGTGGGCCCCCACCCTCCCGG - Intergenic
1073115177 10:101087805-101087827 GTCATGTGCCCCCACCCACCGGG - Intergenic
1073486869 10:103824666-103824688 GTCCTGTGTCTCCACCATCCAGG + Intronic
1076293723 10:129367803-129367825 CTCCCAGGCCACCACCCTGCAGG - Intergenic
1076401074 10:130185758-130185780 GTCCTGGGCCTCCGTCCACCTGG + Intergenic
1076542115 10:131220907-131220929 GGCCAGGGCCACCACCATCCAGG + Intronic
1076636730 10:131885958-131885980 GGGCAGGGCCACCACCCTCCTGG - Intergenic
1076737377 10:132464918-132464940 GTCCTGAGCCACCATCCCCCAGG - Intergenic
1076820029 10:132933645-132933667 GTCCTGGGGCCCCTCCCTCGAGG + Intronic
1076839417 10:133038725-133038747 CTCCTGGGTCACCTCTCTCCTGG + Intergenic
1077167842 11:1151875-1151897 GTCCTACGCCACCCCCCGCCTGG + Intergenic
1077281790 11:1749288-1749310 TTCCGAGGCCCCCACCCTCCTGG - Intronic
1077391497 11:2302530-2302552 CCCCTGTGCCAGCACCCTCCGGG - Intronic
1077843010 11:5994994-5995016 GTTCTGGTCCACCAGCTTCCAGG - Intergenic
1079232933 11:18665322-18665344 ATCATGGCCCACCTCCCTCCTGG + Intergenic
1079304027 11:19306755-19306777 GTCCTGAGCCAGCTCCCCCCAGG + Intergenic
1079321825 11:19457762-19457784 GTTTTGGGGCACCACCGTCCTGG + Intronic
1080263401 11:30375003-30375025 GGCCTGGCACACCTCCCTCCTGG - Intergenic
1080427505 11:32169657-32169679 GTCCTGGGCCATCATCCCCTGGG - Intergenic
1081735338 11:45399600-45399622 CTCTAGGGGCACCACCCTCCAGG + Intergenic
1083724871 11:64622851-64622873 GACCACGGCCACCACCCTGCTGG - Exonic
1083752363 11:64767594-64767616 AACCAGGGCCCCCACCCTCCTGG - Exonic
1083943593 11:65911774-65911796 GTGCTGGGACTCCAGCCTCCAGG - Intergenic
1084269664 11:68022221-68022243 GTCCTGAGCCCCCAGTCTCCTGG + Intronic
1084501221 11:69536577-69536599 TTCCTGGACCTCCAGCCTCCAGG + Intergenic
1084518778 11:69650433-69650455 GTCCTGCACCTCCACCCTCTGGG - Intronic
1084641938 11:70431412-70431434 CTCCTGGCCCACCCCTCTCCGGG - Intronic
1084957246 11:72697876-72697898 GACCTGGGCCCCCAGCCTCCAGG - Intronic
1088109669 11:106247082-106247104 GTAAGGGGCCACCATCCTCCAGG + Intergenic
1088910434 11:114186872-114186894 GTCCTGGGCCACAACTGTGCAGG - Intronic
1089080734 11:115774252-115774274 GGCCTGGGCCCCAACCCTCTTGG + Intergenic
1090653260 11:128824707-128824729 GCCCTCGGCCACCCCCCACCCGG - Intergenic
1091816925 12:3445907-3445929 GTCCTGAGCCACCTACCTCCTGG + Intronic
1096491597 12:52015668-52015690 GTGCTGGTCCTCCTCCCTCCTGG + Exonic
1097261058 12:57720540-57720562 GTCCTGGCCCCCAGCCCTCCTGG + Intronic
1097264720 12:57738453-57738475 GCCCTGCGCCCCCACCCTCTTGG + Intronic
1097729880 12:63116457-63116479 CTCCTTGGGCTCCACCCTCCAGG + Intergenic
1097950310 12:65419854-65419876 GTCCTGCTCCACCAGCTTCCGGG - Intronic
1100647411 12:96545875-96545897 TCCCAGGACCACCACCCTCCAGG - Intronic
1102038673 12:109786819-109786841 GCAGTGGGCCACCACCATCCTGG - Exonic
1102151193 12:110689744-110689766 GTCCTGGGCCGCCTTGCTCCGGG + Intronic
1103261608 12:119593689-119593711 GTCCTCTGCCAGCACCCGCCCGG - Exonic
1103278488 12:119734037-119734059 TTCCTGGGTCACAAGCCTCCTGG - Intronic
1103699703 12:122842731-122842753 GGCCTGGGCCAGCAGCCTCTCGG + Intronic
1103704550 12:122864241-122864263 GTCCTGCTCCCCCACCCTCTTGG + Intergenic
1103923007 12:124409261-124409283 GCCCTGGCCCACCTCCCTCAGGG + Intronic
1104408791 12:128541246-128541268 TTCCTGGGATACCACCTTCCAGG + Intronic
1104408796 12:128541262-128541284 TTCCAGGGACACCACCTTCCAGG + Intronic
1105940783 13:25146174-25146196 TTCTTGGGGCACCATCCTCCAGG - Intergenic
1106466285 13:30017334-30017356 GTACTGGGCTTCCAGCCTCCAGG - Intergenic
1109284900 13:60397691-60397713 GGTCTGGGCCGCCACCCGCCCGG - Intronic
1111386541 13:87536209-87536231 TCCCTGGGGCACCACTCTCCAGG - Intergenic
1112874868 13:104024730-104024752 TTCCTGAGCCTCCACCCTCAAGG - Intergenic
1113175503 13:107558994-107559016 TTCCTGGCCCCCCACCCTGCAGG + Intronic
1113350585 13:109525321-109525343 GTCCTCAGCCACCAGCCTCAGGG + Intergenic
1114329049 14:21617782-21617804 GCCCGGGGCTACCAGCCTCCTGG + Intergenic
1114584438 14:23797216-23797238 TTCCTGGGTCTCCAGCCTCCTGG + Intergenic
1115167148 14:30461773-30461795 ACCCTGCCCCACCACCCTCCAGG - Intergenic
1115984054 14:39085207-39085229 TCTCTGGGGCACCACCCTCCAGG - Intronic
1117190805 14:53289254-53289276 TTTCTGGGGCACCGCCCTCCAGG - Intergenic
1119187169 14:72651178-72651200 ATCCTGGGCCACCTCCCTCAGGG - Intronic
1119998564 14:79278860-79278882 GGCTTGGGCGACCACTCTCCAGG - Intronic
1121548878 14:94783179-94783201 GCCCTGGGCCCCCACCCTAGAGG - Intergenic
1121582185 14:95039470-95039492 GCCCCGGGCCTGCACCCTCCAGG + Intergenic
1121645316 14:95514383-95514405 GTCCTGGCTCACCCCCCTCATGG - Intergenic
1122216234 14:100206465-100206487 CTGCTGGCACACCACCCTCCAGG - Intergenic
1122355985 14:101123071-101123093 GGCCTGGGCTCCCAGCCTCCTGG - Intergenic
1122811521 14:104291728-104291750 GCCTTGGCCCAGCACCCTCCAGG + Intergenic
1122826324 14:104372567-104372589 GTCCTCAGCCACTACCCTACAGG + Intergenic
1122861034 14:104582484-104582506 GTCCTGGGCCTCAGCCCTCATGG + Intronic
1122983620 14:105202410-105202432 CTCCAGGGCCAACACCCTCCAGG - Intergenic
1124649345 15:31463392-31463414 CTCCCTGGGCACCACCCTCCAGG - Intergenic
1125734073 15:41911586-41911608 TTCCTTGGCCTCCACCTTCCTGG + Intronic
1128563768 15:68685603-68685625 GGCCTGGGCCTCCTGCCTCCTGG - Intronic
1128825352 15:70710787-70710809 CTCCTGGTTCACCATCCTCCAGG + Intronic
1129064457 15:72889428-72889450 CTCCCTGGGCACCACCCTCCAGG - Intergenic
1129193966 15:73953396-73953418 GGACTGGGCCAGAACCCTCCTGG - Intergenic
1129456086 15:75676851-75676873 GCCCCAGGCCACCACCCACCAGG + Exonic
1130074192 15:80674576-80674598 TCCCTGGAGCACCACCCTCCAGG - Intergenic
1132590621 16:724860-724882 TTCTGGGGCCCCCACCCTCCAGG + Intronic
1132744126 16:1429687-1429709 CTCCTGGGCCTTCACCTTCCAGG - Intergenic
1135385715 16:22037811-22037833 CTCCTGGCATACCACCCTCCAGG + Intronic
1135407480 16:22208241-22208263 GGCCTGAGCCACCACGCCCCTGG - Intronic
1137664446 16:50241462-50241484 GCTCTGGGCCACCAACATCCTGG + Intergenic
1139521219 16:67483639-67483661 GAACTGTGCCCCCACCCTCCAGG - Exonic
1139846564 16:69925457-69925479 CCCCTGGGCCCCCTCCCTCCTGG + Exonic
1142214087 16:88822353-88822375 CTTCTGGGCCACCATCCACCTGG - Intronic
1142244042 16:88960729-88960751 GGCCTGGGCCACCCGCCTCTGGG + Intronic
1143143516 17:4757318-4757340 ATCCTGAGCCTCCATCCTCCTGG - Intergenic
1143188065 17:5022465-5022487 ATCCCGGGCCACAGCCCTCCAGG - Exonic
1143240579 17:5439785-5439807 ACCCTGGGCCACCACCCTCCAGG - Intronic
1143240712 17:5440572-5440594 TCCCTGGACCACCACCCTCCAGG - Intronic
1143515004 17:7415112-7415134 GTCCTGGTCCACCAGCTCCCGGG - Exonic
1143591494 17:7887985-7888007 GGCCTCGGCCACCACCAGCCAGG - Intronic
1144782092 17:17813487-17813509 GCCCTGAGCCTCCACTCTCCTGG - Intronic
1145087652 17:19956214-19956236 GGCCTGGGTCACTACCCTTCTGG - Intronic
1145783152 17:27577312-27577334 CTCCCTGGCCCCCACCCTCCAGG - Intronic
1146677751 17:34785176-34785198 CTCCTGGGGGACCACCATCCTGG + Intergenic
1148050451 17:44767625-44767647 CTCCTGGGCCACCTCCAGCCAGG + Intronic
1148451509 17:47781105-47781127 CAGCTGGGCCACCACCCTTCAGG + Intergenic
1148555815 17:48578020-48578042 CTCCTGCGCCGCCACCCGCCGGG - Exonic
1151974464 17:77476470-77476492 GCCCTGAGCCAGCACCCTCTGGG - Intronic
1152469509 17:80482988-80483010 CTCCTGTGACATCACCCTCCAGG - Intergenic
1152613972 17:81329550-81329572 GGCCTGGGCCAGCCCCTTCCTGG - Intronic
1153415192 18:4838521-4838543 TTCCCTGGGCACCACCCTCCAGG + Intergenic
1154154187 18:11930896-11930918 CCCCAGGGCCACCACCCTTCAGG + Intergenic
1154171797 18:12057564-12057586 ATCCCGGGCCACAGCCCTCCAGG + Intergenic
1155030370 18:21978871-21978893 CTCCTGGGCCTTCTCCCTCCCGG - Intergenic
1156293919 18:35773281-35773303 GCCCTTGGCCTCCATCCTCCAGG + Intergenic
1157662615 18:49459529-49459551 CTCCACGGCCTCCACCCTCCAGG + Intronic
1157701293 18:49762792-49762814 GTCTTGGGCCACCACTCATCCGG - Intergenic
1160432061 18:78819275-78819297 GACCTGCCCCCCCACCCTCCAGG - Intergenic
1162070915 19:8151604-8151626 CTGCTGGGCCACCTCCATCCTGG - Intronic
1162079114 19:8208567-8208589 GGGCTGCGCCACCACCCACCCGG + Intronic
1162473718 19:10887531-10887553 GTCCTGGGCCACAAAGCTGCAGG - Intronic
1163008364 19:14410152-14410174 GTCCTGGGGCCCCAGGCTCCAGG + Intronic
1164617427 19:29675300-29675322 GTCCTGTGTCACCTCTCTCCAGG + Exonic
1164952137 19:32345687-32345709 GTCCTTGCCCACCTCTCTCCCGG - Exonic
1165529032 19:36380982-36381004 GTATTGTGCCACCACACTCCAGG - Intergenic
1165726963 19:38119629-38119651 GTCCTGGGCCACCACCCTCCAGG - Exonic
1167104852 19:47424157-47424179 GTCCTGGGCCACCATCAGACAGG + Intergenic
1167156255 19:47741125-47741147 GTCCTTGGTCACCACCCACTCGG - Exonic
1167570825 19:50288015-50288037 GCCTTGGGGCACCACCCTACAGG - Intronic
1167605955 19:50481345-50481367 TCCCTGGGCCACATCCCTCCCGG - Intronic
1167719456 19:51168422-51168444 GTCCTGGACCTCCTCTCTCCTGG - Intergenic
1167725856 19:51212123-51212145 GTCCTGGTCCTCCTCTCTCCTGG - Intergenic
1167807702 19:51799993-51800015 GCCATGGGCCACCAGGCTCCTGG + Intronic
925171877 2:1755042-1755064 CTCCTGGGTCCCCAGCCTCCAGG + Intergenic
925172349 2:1758079-1758101 GTCCTGGGGCAAAAACCTCCAGG - Intergenic
927946099 2:27136139-27136161 TTCCTTTGACACCACCCTCCAGG + Intergenic
928385013 2:30859687-30859709 ACCCTGGGACACCTCCCTCCTGG - Intergenic
929825521 2:45306690-45306712 GTTGGGGGGCACCACCCTCCTGG + Intergenic
931703886 2:64931042-64931064 GTCATGGCCCTCCAACCTCCTGG - Intergenic
931958127 2:67451175-67451197 CTCCTGGCCCAACACCCTCCAGG + Intergenic
931980237 2:67686479-67686501 GTCCTGGCTCACGACCCTCTGGG - Intergenic
932743214 2:74307843-74307865 GTCCTGCTCCACCAGCTTCCAGG - Intronic
934051869 2:88218075-88218097 GTCCTGGCCAACAGCCCTCCGGG - Intergenic
934949643 2:98567497-98567519 CCCCTGGGCCACCTCCCTGCTGG - Intronic
934950723 2:98573566-98573588 GTGCAGTGCCACCTCCCTCCTGG - Intronic
936048461 2:109204576-109204598 GTCCCTGGCCTCCATCCTCCAGG + Intronic
936473240 2:112817178-112817200 CCTCTGGGGCACCACCCTCCAGG + Intergenic
939575187 2:143887078-143887100 GTCCAGGGACACCAGCCTCCAGG - Intergenic
942277455 2:174333653-174333675 GGCCTGGTCCTCCGCCCTCCCGG + Intergenic
942526801 2:176861707-176861729 CTCCAGGTGCACCACCCTCCAGG + Intergenic
946338670 2:219055128-219055150 TTCCAGGGCCAGCTCCCTCCTGG + Exonic
947524923 2:230871986-230872008 GGCCTGAACCACCCCCCTCCAGG + Intronic
947651911 2:231793843-231793865 CTCCAGGGCCACCAACCACCTGG - Intronic
947728572 2:232415969-232415991 GGGCTGGGCCACCACCTTCCCGG + Intergenic
948421717 2:237864156-237864178 GGCCTGGGCCAGCTCACTCCAGG + Intronic
948892858 2:240915714-240915736 CTGCTGGGCCACCCCCCTCAGGG + Intergenic
1168856616 20:1013448-1013470 GTCCTCAGCCACCTCCTTCCTGG + Intergenic
1169196913 20:3688351-3688373 CTCCAGGGTCAACACCCTCCTGG + Exonic
1171424287 20:25039933-25039955 GTCCTGGGCTGCCAGCCTGCAGG - Intronic
1171500495 20:25589204-25589226 CTCCCTGGGCACCACCCTCCAGG + Intergenic
1173448275 20:43139424-43139446 GTCCTGGGAGACCACGTTCCAGG + Intronic
1173747349 20:45448069-45448091 CTCCTGAGCCACCCCCCTCCAGG + Intergenic
1175541172 20:59748591-59748613 GTCCTGGGCCTCACACCTCCAGG - Intronic
1175778492 20:61667597-61667619 GTCCTGGGCCATCACCTCCCAGG - Intronic
1176271911 20:64239706-64239728 GCCCTTGGCCCCCATCCTCCTGG - Intronic
1176516697 21:7789562-7789584 GACCCAGGCCAGCACCCTCCTGG - Intergenic
1177296393 21:19181771-19181793 GACTTGTGCCAGCACCCTCCTGG + Intergenic
1177387454 21:20426072-20426094 GTCCTGCTCCACCAGCTTCCGGG - Intergenic
1178650725 21:34419574-34419596 GACCCAGGCCAGCACCCTCCTGG - Exonic
1178858046 21:36266564-36266586 CTCCTAGGGCACCACCCTCTAGG + Intronic
1179029000 21:37703674-37703696 CCACTGGGCCACCACCTTCCTGG + Intronic
1180564839 22:16654276-16654298 GTCCTGTGCCCCCCACCTCCTGG + Intergenic
1180612681 22:17108217-17108239 GTCCTGGTCCAGGCCCCTCCTGG + Intronic
1180839998 22:18954781-18954803 GGCTTGGGCCGCCGCCCTCCAGG + Intergenic
1180914916 22:19479229-19479251 GTCCCGGGCACCCCCCCTCCGGG - Intergenic
1181016255 22:20070562-20070584 GTCCTGGACCCAGACCCTCCAGG + Intergenic
1181055530 22:20258948-20258970 GTCCAGCGCCTCCACCCTCCTGG - Intronic
1181055543 22:20259005-20259027 GTCCAGTGCCTCTACCCTCCTGG - Intronic
1181061902 22:20285699-20285721 GGCTTGGGCCGCCGCCCTCCAGG - Intergenic
1181280822 22:21719152-21719174 CAGCTCGGCCACCACCCTCCAGG + Intronic
1181558011 22:23683265-23683287 GTCCTGCTCCCTCACCCTCCTGG + Intergenic
1182774872 22:32823533-32823555 ATCCCAGACCACCACCCTCCAGG - Intronic
1183936340 22:41264572-41264594 GCCCTTGGCCACCACCATCTGGG - Intronic
1184155671 22:42665142-42665164 GTGCTGGACCTCCACCCTACAGG - Intergenic
1184434672 22:44463254-44463276 TGCCTGGGCCACCACCCACCTGG + Intergenic
1184751551 22:46489257-46489279 GTCCTGGGGCACCTTCCCCCTGG + Intronic
1184960047 22:47922102-47922124 GTCCTGGGGAACCAGGCTCCAGG - Intergenic
1185239539 22:49735272-49735294 GTCCCTGCCCCCCACCCTCCCGG + Intergenic
949171125 3:998447-998469 CTCCTGGTGCACCACCCCCCAGG - Intergenic
950054064 3:10011399-10011421 CTCCTGGGCCACTTCCCTGCGGG + Intergenic
950408276 3:12817787-12817809 GCACTCGGCCACCACCCCCCGGG - Exonic
952319065 3:32259095-32259117 GTCCTGCTCCACCAGCTTCCAGG + Intronic
952324926 3:32312541-32312563 GTTGGGGGTCACCACCCTCCTGG + Intronic
953977894 3:47396062-47396084 GTCCTGGGCAAGCACCAACCAGG - Intronic
954093089 3:48301116-48301138 GGGCTGGGCCGCCGCCCTCCAGG - Intronic
954117196 3:48473436-48473458 GCCCTGTTCCACCAGCCTCCAGG + Intronic
956694406 3:71906460-71906482 CTCCTGGGGCAGCACCCACCTGG + Intergenic
961593178 3:127996106-127996128 GCCCTGGGCCACTTCTCTCCTGG + Intergenic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
962967179 3:140365930-140365952 CTCCTGGGGGACCACGCTCCAGG + Intronic
964476440 3:157101961-157101983 GGACTGGGCCACCAACCCCCCGG + Intergenic
967020069 3:185514984-185515006 CTCCTGGGCCTTCACCCACCTGG + Intronic
967894476 3:194384988-194385010 GACCTTGGTCAGCACCCTCCAGG - Intergenic
968441060 4:624811-624833 CTCCTGGGCCAGCTCCCTGCAGG - Intergenic
968510954 4:995712-995734 GTCCAGGGTCTCCTCCCTCCGGG - Intronic
968762729 4:2450859-2450881 GTGCTGGGCCAGCATCCACCTGG + Intronic
968879293 4:3291003-3291025 TTCTTGGGCCACCCCCCTGCTGG + Intergenic
968897245 4:3411828-3411850 GTCCTTGGCCCCAGCCCTCCTGG + Intronic
969128388 4:4971744-4971766 GTCCAGGCGCATCACCCTCCAGG + Intergenic
969323716 4:6428422-6428444 GTCCTGGTCCACCAGCCTTTAGG + Intronic
969528903 4:7719048-7719070 GTCCTAGGCGCTCACCCTCCGGG - Intronic
969717324 4:8874041-8874063 GCTCAGGGCCACCACCCGCCTGG - Intergenic
970628031 4:17911817-17911839 GTCCTGCTCCACCAGCTTCCAGG + Intronic
970691978 4:18630713-18630735 GGCCTTGGCCACCTCCCTGCAGG - Intergenic
971376007 4:26056308-26056330 TTCCTGGCCCACCACCCTGGGGG + Intergenic
972732571 4:41809258-41809280 GTCCTGGGAGACCTCCTTCCAGG + Intergenic
973990865 4:56405668-56405690 TTCCAGGGGCACCACCCTCCAGG - Intronic
977716006 4:100184745-100184767 CTCCAGGCCCACCATCCTCCAGG + Intergenic
980095230 4:128483154-128483176 GTCCTGGGCCACTGCCCAGCTGG + Intergenic
981196386 4:141925802-141925824 GGCGTGAGCCACCACCCGCCCGG + Intergenic
981245455 4:142531990-142532012 GTTCTTTGCCACCACCATCCTGG + Intronic
983768635 4:171519527-171519549 CCCCTGGGGCACCACCCTCCAGG + Intergenic
984361697 4:178742768-178742790 CTCCGGGGCTACCAGCCTCCTGG + Intergenic
984977508 4:185242609-185242631 CTCCCTGGGCACCACCCTCCAGG + Intronic
985006816 4:185542424-185542446 GTCCTGCTCTACCACTCTCCAGG - Intergenic
985789096 5:1915821-1915843 GTCTTGGGGCACCTCCCTCCCGG - Intergenic
986442083 5:7791745-7791767 ATCCTGGGCCACCACCAGCCTGG - Intronic
988833046 5:35005576-35005598 GCTCTGGGCCAGCACCCTCTTGG + Intronic
991447623 5:66717135-66717157 ATCCTGGGTCTCCATCCTCCAGG - Intronic
996545928 5:124678875-124678897 GTCCTGGGCAACAAATCTCCAGG + Intronic
996558781 5:124806214-124806236 GGCTTGAGCCACCACCCACCCGG + Intergenic
996623332 5:125537849-125537871 GTTGTGGTGCACCACCCTCCTGG + Intergenic
997282132 5:132656104-132656126 GTCCCTGGAGACCACCCTCCAGG + Intergenic
997650998 5:135520551-135520573 CTCCTGGTGCACCACCCTCCAGG + Intergenic
997905808 5:137815853-137815875 TTCCAGGGCAACCAGCCTCCAGG + Intergenic
998257081 5:140596270-140596292 GTCAGGGTCCATCACCCTCCTGG + Intergenic
999389592 5:151180527-151180549 CTGCTGGGCCACCAACCTTCAGG + Intergenic
1000226570 5:159267058-159267080 GAAGAGGGCCACCACCCTCCAGG + Intronic
1001746505 5:174096632-174096654 CTCCTGGGCCTCCAGCCTCTAGG - Intronic
1002327054 5:178416474-178416496 CTCCTGGGCCCCACCCCTCCGGG - Intronic
1002359719 5:178661030-178661052 GCCCATGGCCACCACCTTCCTGG + Intergenic
1002441146 5:179265199-179265221 GGCCAAGGCCACCATCCTCCGGG + Intronic
1002485100 5:179529908-179529930 GTCATCCGCCACCATCCTCCAGG - Intergenic
1004294119 6:14394760-14394782 TCCCTGGGACGCCACCCTCCAGG - Intergenic
1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG + Intergenic
1004590915 6:17050735-17050757 TTCCCGGTGCACCACCCTCCAGG - Intergenic
1004925233 6:20410063-20410085 GTCCAGAGCTACCACCCTTCAGG - Intronic
1005637064 6:27762579-27762601 GTCCTGAGCCCACACCTTCCAGG - Intergenic
1005895235 6:30172136-30172158 GTGCTGGGCCAGCACCTCCCCGG + Exonic
1006788680 6:36684624-36684646 GTCCTGGTCCAGCATGCTCCAGG + Intronic
1006837411 6:37007405-37007427 TTCCTGGCCCACCACCCCCTTGG + Intronic
1006934182 6:37705797-37705819 GTCTTGGCCCCTCACCCTCCAGG + Intergenic
1007628976 6:43262307-43262329 CTCCTCTGCCATCACCCTCCAGG - Intronic
1010863082 6:80937669-80937691 GCCCCAGGCCACCAACCTCCTGG + Intergenic
1013082547 6:106825090-106825112 GCCCTTGGCCCCCAGCCTCCTGG + Intergenic
1013308695 6:108873436-108873458 GTCCTGGGCCTGCCCCCTCACGG + Intronic
1013667409 6:112362561-112362583 GTCCTGCTCCACCAGCTTCCGGG - Intergenic
1014844366 6:126257887-126257909 GTCCTGAGCCACCATTCACCTGG + Intergenic
1015593363 6:134843415-134843437 ACCCTGGGGCACCACCCTGCAGG - Intergenic
1016986393 6:149898900-149898922 GTTCTAGGCCACCGTCCTCCTGG + Intergenic
1017358111 6:153534220-153534242 CTCTTGGTGCACCACCCTCCAGG + Intergenic
1017695067 6:157006344-157006366 GTCCTCCCCCACCTCCCTCCTGG + Intronic
1018772770 6:166986472-166986494 TGCCTGGGGCGCCACCCTCCAGG + Intergenic
1018830148 6:167436059-167436081 ATCCTGGGCCTCCACACTGCTGG + Intergenic
1018993026 6:168688473-168688495 TTCCTGGGTCTGCACCCTCCTGG + Intergenic
1019093610 6:169561126-169561148 ATCCTGGACCTCCAGCCTCCAGG - Intronic
1019510997 7:1417251-1417273 GTCCTTGACCAGCACCCACCTGG + Intergenic
1019546682 7:1580914-1580936 GTCCTGGGCAAGGAGCCTCCCGG + Intergenic
1019639557 7:2096187-2096209 GTCCTGAGGGACCAGCCTCCAGG + Intronic
1019734609 7:2644577-2644599 GCCCTGCACCCCCACCCTCCAGG - Intronic
1021725331 7:23543097-23543119 CTCCAGGTGCACCACCCTCCAGG - Intergenic
1021725399 7:23543644-23543666 CTCCAGGTGCACCACCCTCCAGG + Intergenic
1021813469 7:24425760-24425782 ATCCTGGGTCACCACCAGCCAGG - Intergenic
1023069809 7:36418144-36418166 TCCCTGGGGCGCCACCCTCCAGG + Intronic
1023392236 7:39721421-39721443 TCCCTGGGGCACCGCCCTCCAGG + Intergenic
1025015999 7:55439622-55439644 GTCCCGGGACACCAGCCCCCAGG - Intronic
1025102087 7:56143849-56143871 CTCCGGGCTCACCACCCTCCAGG - Intergenic
1025201826 7:56966887-56966909 GTCCTGCTGCCCCACCCTCCTGG - Intergenic
1025670120 7:63610041-63610063 GTCCTGCTGCCCCACCCTCCTGG + Intergenic
1025723968 7:64041435-64041457 GTCCAGCAACACCACCCTCCTGG - Intronic
1028404468 7:90460867-90460889 TCCCTGGTGCACCACCCTCCAGG + Intronic
1028967248 7:96816140-96816162 GTCCTGGGGCAGCACACTTCAGG - Intergenic
1029391887 7:100280778-100280800 GGCATGAGCCACCACCCCCCCGG - Intergenic
1029473399 7:100768534-100768556 CCCCAGGGCCACCATCCTCCTGG - Intronic
1029543599 7:101198769-101198791 GTGCTGGGCGCCCACCCTCATGG - Exonic
1031083143 7:117277860-117277882 GTCTGGGCCCACCACCCTCCCGG + Exonic
1033165503 7:139035760-139035782 GGACACGGCCACCACCCTCCAGG + Exonic
1034184396 7:149163515-149163537 GGCCTGTGCCACCACGCCCCTGG + Intronic
1034204607 7:149304629-149304651 ATCTTGGGCCTCCAGCCTCCAGG + Intergenic
1035068049 7:156122187-156122209 GTCCGGTCCCACCACCCTGCGGG - Intergenic
1035283834 7:157793990-157794012 TTCCCGGGTCCCCACCCTCCAGG + Intronic
1035677482 8:1465567-1465589 CTCCCAGGGCACCACCCTCCAGG + Intergenic
1036583388 8:10099794-10099816 GTCCAGGGCCACCCCACACCAGG - Intronic
1037826470 8:22163353-22163375 GTCCTTAGCCACCTCCCTCTAGG - Intronic
1037948319 8:23003224-23003246 GGCCTCGGCATCCACCCTCCTGG - Intronic
1037986942 8:23296015-23296037 GGCCCGGGCCACCAGCCGCCGGG - Exonic
1039820140 8:41127640-41127662 CTCCTGGGACACCACCCTCCAGG - Intergenic
1042553719 8:70016469-70016491 GTCCTGGGACTCCACACTCTAGG + Intergenic
1045996651 8:108370317-108370339 CCTCTGGGACACCACCCTCCAGG - Intronic
1048192549 8:132302946-132302968 CTTCTGATCCACCACCCTCCTGG + Intronic
1048310736 8:133320663-133320685 GTCCTGGCCCACCACCACCGAGG - Intergenic
1048991291 8:139761691-139761713 GTGCTGGGTCACCCCCCTCAGGG + Intronic
1049202827 8:141350241-141350263 GGCTGGGGCCACCACTCTCCTGG - Intergenic
1049257561 8:141621965-141621987 GTGCTGGGCCAGCTTCCTCCTGG + Intergenic
1049540725 8:143207658-143207680 GTCCCGGGCAGCCACACTCCAGG - Intergenic
1049571252 8:143371279-143371301 GTGCTGGGCTTCCACCCTCCTGG + Intronic
1052796924 9:32931452-32931474 CTCCTGCGCCCCCTCCCTCCTGG + Intergenic
1052949127 9:34193748-34193770 TTCTTGGGGCACCACCATCCAGG + Intronic
1053123366 9:35561672-35561694 TTTCTGGGCCACCCGCCTCCAGG - Exonic
1054924158 9:70572066-70572088 TTCCTGGGCCCTCACACTCCAGG - Intronic
1056508768 9:87282949-87282971 GTCCTGGGGCCCAAGCCTCCTGG - Intergenic
1056528444 9:87465841-87465863 GTGCTGGGTCTCCACCTTCCTGG - Intergenic
1056662981 9:88558324-88558346 CTCCGGGAACACCACCCTCCAGG - Intronic
1056718528 9:89053915-89053937 GTCCTGTGCCACGCCCCTCCCGG + Intronic
1057619032 9:96619142-96619164 GCCCTGGCCCACCTCCCACCGGG - Intronic
1057906826 9:98989837-98989859 GGCCTGGACCTCCTCCCTCCTGG + Intronic
1059303963 9:113339602-113339624 GTTCTAGGCCACCACTCTCACGG + Intronic
1059409532 9:114123481-114123503 GTCCTGGGCTGCCACCACCCTGG + Intergenic
1060404640 9:123367327-123367349 TTCCTGTGCCACTGCCCTCCTGG + Exonic
1061006259 9:127929885-127929907 GTCCTGTGCCTCCTCCCACCAGG - Exonic
1061059185 9:128242210-128242232 CTCCTGCCCCATCACCCTCCAGG + Exonic
1061290209 9:129646458-129646480 GCCCTGGGGCACCACCCTGTGGG + Intergenic
1061377811 9:130236435-130236457 GCCCTGGGCCACCACATTTCTGG + Exonic
1061497033 9:130981018-130981040 ATCCTGGGCCACCCACCTCTCGG + Intergenic
1061537233 9:131257787-131257809 CTCCAAGCCCACCACCCTCCAGG + Intergenic
1062006326 9:134240167-134240189 TGCCTGGGCCACCAGTCTCCGGG - Intergenic
1062060517 9:134493020-134493042 GTCCTGGGTCACCAACTCCCTGG - Intergenic
1062473400 9:136716095-136716117 GTCCTGGGGCTCCTCCCTTCTGG + Intronic
1062564248 9:137156920-137156942 GGCCTGGGCCACCACGCCCACGG - Exonic
1185627727 X:1494177-1494199 GTCCTGGGGGACCCTCCTCCTGG + Intronic
1185910525 X:3976574-3976596 TTCCTGCAGCACCACCCTCCAGG - Intergenic
1186203887 X:7181534-7181556 GACCTGGACCAGCACACTCCAGG - Intergenic
1186808285 X:13161871-13161893 CTCCCTGGGCACCACCCTCCAGG + Intergenic
1189999909 X:46675965-46675987 CTCCCGGGACACCACCGTCCAGG - Intronic
1194538539 X:95140963-95140985 TTCCTGGGTCTCCACCCTGCAGG - Intergenic
1195344159 X:103931995-103932017 TCCTTGGGTCACCACCCTCCAGG - Intronic
1195362787 X:104101214-104101236 TCCCTGGGTCACCACCCTCCAGG + Exonic
1196043529 X:111231649-111231671 GTACTGGGCTACCACCCTACAGG - Intergenic
1198975217 X:142328139-142328161 GTGCAGGGCCACCACACACCAGG - Intergenic
1200000902 X:153059278-153059300 GTACAGGGCCACCAGACTCCTGG + Intronic
1200085955 X:153605183-153605205 GTCCTGCTCCACCAGCTTCCAGG - Intergenic
1200210532 X:154344981-154345003 CTCCTGGGCCACCTGCCTGCTGG + Intergenic
1200211678 X:154349426-154349448 GCCCTTGGCCACCACCTTGCTGG + Exonic
1200220320 X:154387111-154387133 CTCCTGGGCCACCTGCCTGCTGG - Intergenic