ID: 1165728826

View in Genome Browser
Species Human (GRCh38)
Location 19:38131159-38131181
Sequence AGGGAGCAGGCACTTTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165728826_1165728831 -3 Left 1165728826 19:38131159-38131181 CCACAACAAAGTGCCTGCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1165728831 19:38131179-38131201 CCTTGCGGTTTGTGTTCTACAGG 0: 1
1: 0
2: 0
3: 0
4: 54
1165728826_1165728834 22 Left 1165728826 19:38131159-38131181 CCACAACAAAGTGCCTGCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1165728834 19:38131204-38131226 AAGACAGGCCGTGAAGAAATAGG 0: 1
1: 0
2: 1
3: 12
4: 228
1165728826_1165728832 -2 Left 1165728826 19:38131159-38131181 CCACAACAAAGTGCCTGCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1165728832 19:38131180-38131202 CTTGCGGTTTGTGTTCTACAGGG 0: 1
1: 0
2: 0
3: 11
4: 86
1165728826_1165728833 7 Left 1165728826 19:38131159-38131181 CCACAACAAAGTGCCTGCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1165728833 19:38131189-38131211 TGTGTTCTACAGGGAAAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165728826 Original CRISPR AGGGAGCAGGCACTTTGTTG TGG (reversed) Intronic
900002980 1:25175-25197 AGGTAGCAAGCACCTTGTAGGGG - Intergenic
900022700 1:195700-195722 AGGTAGCAAGCACCTTGTAGGGG - Intergenic
900833333 1:4980585-4980607 AGGGAGCTGGCACTGTCTTCTGG - Intergenic
902117037 1:14129600-14129622 TGGGGGAAGGCACCTTGTTGGGG + Intergenic
902216512 1:14937607-14937629 AGGGAGCAGGCACACTGGGGTGG - Intronic
904774233 1:32896814-32896836 AGAGATGAGGCACTCTGTTGTGG - Intronic
906364814 1:45198573-45198595 AATGAGCAGGAACATTGTTGTGG - Intronic
906733548 1:48103362-48103384 TGTGTGCAGGCACTTTGCTGGGG + Intergenic
909294923 1:73935328-73935350 AGGGAGCAGGTTCATTATTGAGG + Intergenic
909903981 1:81174258-81174280 AGGGAGCAGGGATTTAGCTGTGG + Intergenic
910403699 1:86863030-86863052 GAGGAGCAGGCAATCTGTTGAGG + Exonic
910652114 1:89580919-89580941 AGGGAGCAGGGACTCTGTAATGG + Intronic
915005087 1:152628422-152628444 AAGGAGGAGGCTCTTTGATGAGG - Intergenic
915043167 1:152985377-152985399 AGGGCTCAGGCACTTTGGGGTGG - Exonic
915115941 1:153599621-153599643 AGGGAACAGGCACAGTATTGAGG + Intergenic
915985512 1:160460336-160460358 AAAGAGCAGGAACTTTGTCGTGG - Intergenic
918405910 1:184211947-184211969 AGCTAGCAGGCACTTAGTTTAGG - Intergenic
919569761 1:199232924-199232946 TGGGATCAGGCACATTTTTGAGG + Intergenic
920793385 1:209114200-209114222 AGGGAGCAGGTACTTTAGTTAGG + Intergenic
921714764 1:218406626-218406648 AGGGAGCTGACATTTTGATGAGG + Intronic
1062927246 10:1326680-1326702 TGTGAGGAGGCACTGTGTTGTGG - Intronic
1064197144 10:13253468-13253490 AGTGAGAAGGCACTGTCTTGGGG + Intergenic
1064226367 10:13489241-13489263 AGGGAGCAGGCTCTTAGGTCAGG - Intronic
1068892131 10:62159028-62159050 AGGCAGCAAGTCCTTTGTTGAGG - Intergenic
1069712711 10:70500280-70500302 AGGGAGGAGGCACCATGTGGAGG - Intronic
1070313273 10:75288907-75288929 AGGGACCAGGCGCTTGGTTGAGG + Intergenic
1072764480 10:98084425-98084447 ATGTAGCAGACACTTTGTTAAGG + Intergenic
1073039043 10:100586970-100586992 AGAGAGAAGGCTTTTTGTTGAGG - Intergenic
1075096706 10:119476323-119476345 AGAGAGGAGGAACTTTGCTGAGG + Intergenic
1075603397 10:123787357-123787379 AGTGAGCAGGCACTTGGTTTGGG - Intronic
1076151747 10:128168108-128168130 AGGGAGAAGTCACTCTGGTGCGG - Intergenic
1079923456 11:26460968-26460990 GGGGAGCAGGCACTGGCTTGTGG - Intronic
1080638726 11:34145905-34145927 AGGGGGCAGGCATTGTGCTGGGG - Intronic
1080700224 11:34638383-34638405 AGGTACCAGGCACTCTGCTGTGG + Intronic
1081758889 11:45563197-45563219 GGGGACCAGCCACTGTGTTGAGG - Intergenic
1083871617 11:65491691-65491713 AGGTTTCAGGCACTTTGTCGGGG - Intergenic
1086078736 11:82880905-82880927 TGGGAGCAGGCACTTGGCAGTGG - Intronic
1090347156 11:126080659-126080681 ACATAGCAGGCACTTTGCTGAGG + Intergenic
1091376398 12:27238-27260 AGGTAGCAAGCACCTTGTAGGGG - Intergenic
1091820757 12:3473677-3473699 TGAGAGAAGGAACTTTGTTGTGG - Intronic
1096723694 12:53544187-53544209 AGGGCAGAGGCACTGTGTTGAGG - Intronic
1097176023 12:57143375-57143397 GGGGTTCTGGCACTTTGTTGGGG - Intronic
1098326882 12:69312445-69312467 AGGGATAAGGCACTATGTAGTGG - Intergenic
1098371317 12:69763254-69763276 AATGAGCAGGAACATTGTTGTGG + Intronic
1098466546 12:70793649-70793671 AATGAGCAGGAACATTGTTGTGG - Intronic
1101033056 12:100678580-100678602 TCAGAGCAGGGACTTTGTTGGGG + Intergenic
1102458593 12:113086598-113086620 AGGGCAAAGGGACTTTGTTGTGG + Intronic
1103612748 12:122133917-122133939 TGGGAGCAGGCACTATTTTGTGG - Exonic
1103981453 12:124739443-124739465 AGAGAGCAGGTACTGTTTTGGGG + Intergenic
1104823870 12:131694627-131694649 AGGGAGCAGGCACTCTTTGTAGG - Intergenic
1104825929 12:131709875-131709897 AGAGATCAGGGACATTGTTGGGG - Intergenic
1106061300 13:26295240-26295262 AGGGAACAGGCTCTTTTTTTGGG + Intronic
1106135182 13:26968319-26968341 AGGACGCAGGGACTTTGTGGGGG + Intergenic
1111690592 13:91558523-91558545 AGGAAGAAGGGACTTTGTTCTGG + Intronic
1112191192 13:97179547-97179569 AGGGAGAAAGCACTTTGCTAAGG - Intergenic
1112230000 13:97580440-97580462 AGGGAGCTGCCACTCTATTGAGG - Intergenic
1112555276 13:100462009-100462031 ACAGAGCAGACACTTTGTGGAGG + Intronic
1114634511 14:24179732-24179754 AGGGAGGTGGCACCTTGATGGGG + Intronic
1116167733 14:41354841-41354863 AGGGAGGAGGCAATTTGAGGAGG + Intergenic
1116639372 14:47441315-47441337 AGGGAGCAGGCAGACTGGTGAGG + Intronic
1117262101 14:54046243-54046265 AGACAGCAGTCACATTGTTGTGG + Intergenic
1117521198 14:56552913-56552935 AAGGAGCAGTCACTTCTTTGGGG - Intronic
1117523460 14:56574579-56574601 AGGGACGAGGCTTTTTGTTGGGG - Intronic
1120919621 14:89743022-89743044 GGGGAGCAGGCAATGTGTTGGGG + Intergenic
1123036409 14:105473738-105473760 AGGGCGGAGGCACTGTGGTGAGG + Intronic
1123711569 15:22991547-22991569 AGGGAGCTGCCACTGTGTTGTGG + Intronic
1126674092 15:51144338-51144360 AGTCAGCAAGCACTTTGTTGGGG + Intergenic
1127069152 15:55271199-55271221 AAGGAGCAGGGATTTTATTGTGG - Intronic
1127906394 15:63379525-63379547 AGGGAGCAGGCCCTTCCTGGAGG + Intronic
1128112299 15:65084308-65084330 AGGGAGCTAGCACTGGGTTGCGG + Intergenic
1128133440 15:65245856-65245878 AGAGAGCAGGCAATGGGTTGTGG - Intronic
1129590514 15:76910953-76910975 AAGGAGCAGGCACATTCTGGAGG - Intergenic
1129978460 15:79844458-79844480 AGGGAGCAATAATTTTGTTGTGG - Intronic
1132450526 15:101965764-101965786 AGGTAGCAAGCACCTTGTAGGGG + Intergenic
1134182782 16:12061229-12061251 AGGGAGCCTGCAGTCTGTTGGGG - Intronic
1137720421 16:50624590-50624612 TGGGAGCAGGCAGTGTGTAGGGG + Intronic
1141376038 16:83531664-83531686 AGGGAGGAGGCAATGTGATGTGG + Intronic
1141677415 16:85524986-85525008 AGGGAGCAGGTTGTTTGTTTGGG - Intergenic
1143281570 17:5758430-5758452 ACGCAGCAGGCACTGTGCTGGGG - Intergenic
1143571319 17:7760397-7760419 AGGGAGCAGGGGCTTGGATGGGG + Intronic
1143628689 17:8125028-8125050 AGGGAGCAGGCAGTTTACTAAGG + Intergenic
1144217928 17:13072925-13072947 AGGGATCAGGCTGGTTGTTGTGG + Intergenic
1145304428 17:21665499-21665521 AGGGAGTGGGCACTGTGTGGTGG - Intergenic
1145934286 17:28705863-28705885 AGGGAGCAGGCACTGGCTTGGGG + Intronic
1147169062 17:38607496-38607518 AGGCAGCAGGCTCTGTGTGGGGG + Intergenic
1148796092 17:50197533-50197555 GGAGAACAGTCACTTTGTTGGGG + Intronic
1148874754 17:50680352-50680374 GGGCAGCATGCCCTTTGTTGGGG + Intronic
1149983947 17:61333094-61333116 AGGGAGAAAGCACCTTGCTGGGG - Intronic
1151303969 17:73251015-73251037 GGAGAGCAGGCACTCTGTTGGGG + Intronic
1154452095 18:14486782-14486804 AGAGAGCAGGAACTTGGTCGGGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156613916 18:38760641-38760663 AGTGAGCATGCACTTTTATGTGG - Intergenic
1156997526 18:43485519-43485541 TGTGAGCAGGCACTTTGCAGTGG + Intergenic
1160128636 18:76204312-76204334 AAGGGGCAGGCACTTGGCTGAGG + Intergenic
1160634731 19:66783-66805 AGGTAGCAAGCACCTTGTAGGGG - Intergenic
1161704471 19:5812649-5812671 AGGGAGGGGGCACATTTTTGTGG + Intergenic
1162091581 19:8283740-8283762 AGGGAGTAGGCACTTTGAGCAGG + Intronic
1162093818 19:8298589-8298611 AGGGAGTAGGCACTTTGAGCAGG + Intronic
1163636786 19:18440756-18440778 AGGGAGCCCACACTTTGCTGGGG - Intergenic
1163738121 19:18994276-18994298 AGGGAACATCAACTTTGTTGGGG + Exonic
1165728826 19:38131159-38131181 AGGGAGCAGGCACTTTGTTGTGG - Intronic
1166550942 19:43665628-43665650 ATAGAGCAGGCTCCTTGTTGGGG - Intronic
1167377393 19:49119378-49119400 AGGGAGGAGGAATTTTTTTGGGG + Exonic
1167507991 19:49881243-49881265 AGGGAGACGGCACTGTGTTGGGG - Intronic
1168153369 19:54460642-54460664 AGCCAGCAGGCACTGTGCTGAGG + Intronic
927063848 2:19449649-19449671 AGGGAACAGGCAAATTGTTGAGG + Intergenic
928419610 2:31128189-31128211 AGGGACCAGACTCTTTGTGGAGG - Intronic
928911786 2:36429382-36429404 AGGGAACAGGCAAACTGTTGAGG - Intronic
931581629 2:63781705-63781727 AGGGAGCAATCACTTTGCTTGGG + Intronic
932327432 2:70872363-70872385 ACGGAGCAGTTACTTTGATGAGG - Intergenic
935376096 2:102399434-102399456 AGGCTGCAGGCACTTTTCTGGGG + Intergenic
935475408 2:103514908-103514930 AGAGAGCAGGGATTTTCTTGAGG + Intergenic
935920031 2:108002569-108002591 AAGGTGCAGGCACTTTGAGGAGG + Intronic
936566747 2:113588244-113588266 AGGTAGCAAGCACCTTGTAGGGG + Intergenic
936838793 2:116742995-116743017 TGGGAGCAAGCACTTTATTTGGG + Intergenic
937977529 2:127590726-127590748 ATGGAGCAGGGACTCCGTTGTGG - Intronic
938160892 2:128983540-128983562 AGGCAGCAGAGGCTTTGTTGAGG - Intergenic
939148121 2:138441099-138441121 TGGGAGCAGGAATTTTGTTTTGG - Intergenic
940279680 2:151976434-151976456 AGAGAGAAGTCACTTTTTTGGGG + Intronic
940903360 2:159146993-159147015 AGGCAGCAGCCACTGTGCTGGGG + Intronic
941318449 2:164024568-164024590 AATGAGCAGGCGCATTGTTGTGG + Intergenic
941620003 2:167766717-167766739 AATGAGCAGGTACATTGTTGTGG + Intergenic
941634327 2:167919182-167919204 AATGAGCAGGAACATTGTTGTGG - Intergenic
941772983 2:169363335-169363357 AGGGAGGTGGATCTTTGTTGGGG + Intergenic
942616018 2:177793075-177793097 AGGGAGCAGTCACCTTTGTGTGG + Intronic
942713546 2:178865277-178865299 AGGGAGCAGACACTTTGCTTTGG - Intronic
943591277 2:189799899-189799921 AGTGAGCAGTCAGTTTATTGGGG - Intronic
945258928 2:207826176-207826198 AGGGAGAAGGCACTTTGCCATGG + Intergenic
1170783402 20:19447292-19447314 AGGGAGCAGGCTCAGTGGTGAGG + Intronic
1171521945 20:25782931-25782953 AGGGAGTGGGCACTGTGTGGTGG - Intronic
1171554880 20:26072952-26072974 AGGGAGTGGGCACTGTGTGGTGG + Intergenic
1173344447 20:42185879-42185901 AGGGGTCAGGCACTCTGCTGAGG + Intronic
1176099929 20:63360330-63360352 AGGGGGCTGGCACCTCGTTGGGG - Intronic
1176655755 21:9587926-9587948 AGGGAGTGGGCACTGTGTGGTGG - Intergenic
1177193334 21:17876007-17876029 ATGGACCAGGCACTGTGCTGTGG + Intergenic
1177955904 21:27598850-27598872 AGGGGGCAGGCAAGTTGTTCAGG + Intergenic
1178865680 21:36325111-36325133 AGGAAGGAGTCATTTTGTTGGGG + Intronic
1179022275 21:37651223-37651245 AAGGAGCAGTGACTGTGTTGTGG + Intronic
1180729580 22:17971587-17971609 AGGCACCAGACACTGTGTTGGGG + Intronic
1181393427 22:22600411-22600433 AGAGATCAGGCACTTTGCAGAGG - Intergenic
1182661677 22:31929498-31929520 AGGGAGCAGGCACCTGAATGAGG + Intergenic
949760163 3:7461829-7461851 AGTGAGCATGCAATTTGTTGTGG + Intronic
950270754 3:11612979-11613001 TGGAATCAGGCACTTTGCTGGGG + Intronic
950522621 3:13505749-13505771 GGGGCCCAGGCACTTTGGTGAGG - Exonic
951297456 3:20956413-20956435 AATGAGCAGGAGCTTTGTTGTGG - Intergenic
951541151 3:23783265-23783287 GGGGAGCAGGCACTGGGGTGGGG + Intergenic
951990690 3:28673040-28673062 ATGGAGCAGGGATTTTGATGGGG - Intergenic
953925023 3:46978465-46978487 AGGGATCAGGCTCTTTGTTGGGG - Intronic
954851452 3:53604431-53604453 ATGGGGCTGGCACATTGTTGAGG + Intronic
954989615 3:54829452-54829474 AGGGTGCAGAGACTTTGTTTGGG + Intronic
955611158 3:60758763-60758785 AGAGAGTAGGCATTTTGTTTTGG - Intronic
959688930 3:109177542-109177564 AGGCAGCAGGGACTTTGTAGAGG + Intergenic
961059484 3:123816394-123816416 AGGGAACCAGCACTGTGTTGAGG - Intronic
961359447 3:126357642-126357664 AGGGACCAGGCAGCGTGTTGGGG - Intergenic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
963009382 3:140754986-140755008 AGGGAGCCAGCACTGTGCTGGGG + Intergenic
963336861 3:143985111-143985133 AGGCAACAGGCACTGTGTTACGG - Intronic
964790396 3:160449477-160449499 AGGGAGGAGGCCCTCTGTGGTGG - Intronic
964830979 3:160884235-160884257 AGGGAGAAGCCAGTTAGTTGTGG + Intronic
965049346 3:163624688-163624710 AAAGAGCAGGATCTTTGTTGTGG - Intergenic
969156576 4:5216305-5216327 TGGTACCAGGCACTTTGTTAGGG + Intronic
969261265 4:6035652-6035674 AGGGAGAAGGCACTTTGGTTTGG + Intronic
969429306 4:7144980-7145002 TGGGACCAGGGACTGTGTTGGGG - Intergenic
969482308 4:7453258-7453280 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482320 4:7453316-7453338 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482332 4:7453372-7453394 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482374 4:7453576-7453598 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482386 4:7453632-7453654 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482397 4:7453688-7453710 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482401 4:7453706-7453728 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482424 4:7453822-7453844 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482445 4:7453918-7453940 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482468 4:7454034-7454056 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482485 4:7454110-7454132 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482534 4:7454338-7454360 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482572 4:7454542-7454564 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482592 4:7454638-7454660 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482617 4:7454748-7454770 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482628 4:7454803-7454825 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482648 4:7454897-7454919 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482683 4:7455083-7455105 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482701 4:7455179-7455201 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482726 4:7455291-7455313 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482751 4:7455401-7455423 TGGGGTCAGGCACTGTGTTGGGG + Intronic
970745636 4:19291690-19291712 AGTTTGCATGCACTTTGTTGAGG + Intergenic
972343488 4:38173174-38173196 TCGGAGCAGGGAATTTGTTGGGG - Intergenic
974204564 4:58684111-58684133 AGTGAGCAGGAACATTGTCGTGG - Intergenic
977732990 4:100377971-100377993 AAGGAGCAGGAGCATTGTTGTGG - Intergenic
978041258 4:104065454-104065476 AGGAAGTAGGCTCTTTTTTGCGG + Intergenic
979440869 4:120748659-120748681 AGGGAGCAGGTCCTCTTTTGGGG - Intronic
979691880 4:123568155-123568177 AGTTAGCAGGTATTTTGTTGAGG + Intergenic
982042527 4:151409597-151409619 AGGGAGCAGGCATTGGGCTGGGG + Intronic
985780499 5:1868426-1868448 AGGGAGGAAGGGCTTTGTTGGGG + Intergenic
985936517 5:3101770-3101792 AGGGAGAATGGACTTTGTAGGGG - Intergenic
986158766 5:5204059-5204081 AGAGGGCAGGCACTTTCCTGCGG + Intronic
986840276 5:11688382-11688404 ATGGAACAGACACTTTTTTGGGG - Intronic
989363367 5:40628473-40628495 ATGGGGCAGGCACTTTATTTTGG - Intergenic
992013191 5:72551082-72551104 AGGAAGCAGTCACTGTGGTGAGG - Intergenic
994722846 5:103400734-103400756 TGGGTGCAGGCAGTTTGTTTGGG + Intergenic
997267141 5:132501440-132501462 AGGGTGCAGGCACAATGCTGCGG + Intergenic
997276105 5:132592491-132592513 AATGAGCAGGAACATTGTTGTGG + Intronic
997580669 5:135014802-135014824 AGGAAGCAGGCCCTGTATTGTGG + Intergenic
999014993 5:148092982-148093004 AAGGAGAAGGGACTTTGCTGTGG + Intronic
1000122193 5:158208032-158208054 AGAGAGCTGGCACTTGGTTGGGG + Intergenic
1002536602 5:179879456-179879478 ACGGAGCAGGCACTCTCTGGGGG - Intronic
1002887706 6:1311608-1311630 GGGGAGCAGGGACTTTGCTCGGG - Intergenic
1003353661 6:5344520-5344542 AGGGAGGAGGCAGTGTGTTATGG + Intronic
1005194009 6:23261168-23261190 AGGGAGCTGGGACTTTAGTGAGG - Intergenic
1007315620 6:40986253-40986275 AGGGAGCCAGCACCTGGTTGGGG + Intergenic
1007559104 6:42791124-42791146 TGGGAGCAGCAACTTTGTTCTGG + Intronic
1011411852 6:87074445-87074467 ATGGAGCAGGCACTGGGGTGGGG + Intergenic
1014758011 6:125323214-125323236 AAAGAGCAGGCATTTTGTAGAGG + Intergenic
1015745751 6:136507914-136507936 AGGGAGCTTGCAGTGTGTTGTGG - Intronic
1016740428 6:147522841-147522863 AGGCAGCAGCCACATAGTTGTGG + Intronic
1018830784 6:167441777-167441799 AGCGAGCAGGCACCCTGTTCTGG - Intergenic
1019978690 7:4605192-4605214 AGGGAGCAGGCATTTTGGGCAGG - Intergenic
1022254031 7:28637673-28637695 AGGACGAAGGCACTTTGGTGGGG + Intronic
1022522392 7:31016614-31016636 AGGGAGGAGACACTGTGCTGAGG + Intergenic
1023055319 7:36285795-36285817 TGGGAGCAGCCCCTGTGTTGAGG + Intronic
1023836853 7:44073611-44073633 CCGGAGCAGGTACATTGTTGGGG - Exonic
1023856933 7:44189742-44189764 AGGGAGCAGGCAGCTTGGCGTGG + Intronic
1023989793 7:45121909-45121931 AGTGAGCAGGCTCTTTCTTCTGG + Intergenic
1024172555 7:46805220-46805242 ATGGAGCAGGTGCTGTGTTGGGG + Intergenic
1024583346 7:50819239-50819261 AAGCAGAAGCCACTTTGTTGAGG + Intergenic
1025282447 7:57638113-57638135 AGGGAGTGGGCACTGTGTGGTGG - Intergenic
1025302283 7:57827406-57827428 AGGGAGTGGGCACTGTGTGGTGG + Intergenic
1029474317 7:100773923-100773945 AGGCAGCAGGGAGTCTGTTGGGG - Intronic
1029548022 7:101221554-101221576 CGGGAGCAGGTTCTGTGTTGAGG + Intronic
1029930237 7:104363114-104363136 AGGGAGAAGGGAGTTTGTTTTGG + Intronic
1030077970 7:105752819-105752841 AGGGTGCGGCCACTGTGTTGAGG - Intronic
1030673439 7:112362133-112362155 AGGAAGCTGCCACTTTGTGGTGG - Intergenic
1031458427 7:122013209-122013231 AGGAAACAGCAACTTTGTTGAGG - Exonic
1033157015 7:138965907-138965929 AGGCAGCAGGCACTCAGGTGTGG - Intronic
1035574871 8:697900-697922 AGGGACCAGGAGCTTTGTTGTGG + Intronic
1037644183 8:20775267-20775289 AGTGAGCAGTCATTGTGTTGGGG + Intergenic
1040007013 8:42629255-42629277 AGGCAACAGGCATGTTGTTGGGG - Intergenic
1042836746 8:73085945-73085967 AGGGAGAAAGCACTTGTTTGTGG - Intronic
1043742435 8:83831023-83831045 AGGTAACAGGTACTTTGTTCTGG + Intergenic
1046281235 8:112034882-112034904 AATGAGCAGGAGCTTTGTTGTGG - Intergenic
1049802781 8:144525892-144525914 AAGGAGCAGGGAGTTTGCTGGGG + Exonic
1049885784 9:25288-25310 AGGTAGCAAGCACCTTGTAGGGG - Intergenic
1053346725 9:37383583-37383605 AGGGAGCAGGCGCTGAGTTCTGG + Intergenic
1055822573 9:80285042-80285064 AGGGACCAGGCACTAGGTAGAGG + Intergenic
1056037835 9:82627664-82627686 ACATAGCAGGCACATTGTTGGGG - Intergenic
1057089081 9:92239949-92239971 AGGGAGCAGAATTTTTGTTGAGG + Intronic
1057370092 9:94463228-94463250 AGCGAGCAAGCACCTTGTTTGGG - Intergenic
1057734425 9:97641553-97641575 AAAGAGCAGGCACTCTGTAGAGG - Exonic
1059358305 9:113718557-113718579 ATGGAGCATGCACTTGCTTGTGG - Intergenic
1061391865 9:130321179-130321201 AGGGAGCAGGGATTTAGTGGAGG + Intronic
1061486835 9:130924421-130924443 AGGGGGCAGGGGCTCTGTTGGGG + Intronic
1062245063 9:135561909-135561931 GGGGAGCGGGCACTTTACTGTGG + Intronic
1062492803 9:136815479-136815501 GGGGAGCAGCCATTTTCTTGGGG + Intronic
1062559741 9:137136206-137136228 AGAGAGGAGGGACTTTGTGGAGG + Intergenic
1203633472 Un_KI270750v1:91387-91409 AGGGAGTGGGCACTGTGTGGTGG - Intergenic
1187593511 X:20745171-20745193 AGGGTCCAGCCATTTTGTTGGGG + Intergenic
1188861917 X:35268603-35268625 AGGGTGCAGGTATTTTGTTGAGG + Intergenic
1189144199 X:38638906-38638928 AGCAAGCAGGGACTTTGCTGGGG + Intronic
1189377988 X:40480704-40480726 TGAGAGCAGGTAGTTTGTTGGGG + Intergenic
1192397694 X:70799396-70799418 AATGAGCAGGAACATTGTTGTGG + Intronic
1196189937 X:112783578-112783600 AGAGAACAGTCACTTTGTTGGGG - Intronic
1199541041 X:148958389-148958411 AGGGAGCAAGCAGATAGTTGTGG - Exonic
1200031724 X:153302523-153302545 AGGGAGCAGGGAATCTTTTGTGG + Intergenic