ID: 1165730481

View in Genome Browser
Species Human (GRCh38)
Location 19:38141634-38141656
Sequence AACCCAGAGCTCCCCAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165730481_1165730483 23 Left 1165730481 19:38141634-38141656 CCAGTGCTGGGGAGCTCTGGGTT 0: 1
1: 0
2: 1
3: 36
4: 256
Right 1165730483 19:38141680-38141702 CGACTGAAGCTCTGCTTTTTAGG 0: 1
1: 0
2: 1
3: 7
4: 133
1165730481_1165730484 27 Left 1165730481 19:38141634-38141656 CCAGTGCTGGGGAGCTCTGGGTT 0: 1
1: 0
2: 1
3: 36
4: 256
Right 1165730484 19:38141684-38141706 TGAAGCTCTGCTTTTTAGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 191
1165730481_1165730485 28 Left 1165730481 19:38141634-38141656 CCAGTGCTGGGGAGCTCTGGGTT 0: 1
1: 0
2: 1
3: 36
4: 256
Right 1165730485 19:38141685-38141707 GAAGCTCTGCTTTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165730481 Original CRISPR AACCCAGAGCTCCCCAGCAC TGG (reversed) Intronic
900469886 1:2848475-2848497 AACCCAGAGCTGCCCCTCCCAGG - Intergenic
900507537 1:3037203-3037225 CACCCACCCCTCCCCAGCACAGG + Intergenic
900561870 1:3311199-3311221 AAACCAGAGCTCTCCTGCAGTGG + Intronic
900563043 1:3317493-3317515 AACCCAAAGATCCCCAGACCTGG - Intronic
902704032 1:18192071-18192093 AGCCCAGCCTTCCCCAGCACTGG + Intronic
902897080 1:19486015-19486037 AACCCAGCCCAACCCAGCACTGG + Intergenic
903333375 1:22608925-22608947 ACCCTCCAGCTCCCCAGCACTGG + Intergenic
903801720 1:25973697-25973719 AATCCAGAGCCCTCGAGCACTGG - Intronic
905309963 1:37042497-37042519 CTCCCAGAGCTACCCAGAACTGG + Intergenic
905907046 1:41626177-41626199 CACCCCGCCCTCCCCAGCACCGG + Intronic
907141551 1:52190202-52190224 AACCCAGAGGTACCCTGCAGAGG - Intronic
907434890 1:54439182-54439204 AACCCAGACCTAGCCAGGACTGG - Intergenic
907441354 1:54480569-54480591 AACCCCCATCCCCCCAGCACTGG + Intergenic
907794145 1:57697878-57697900 AACCCCAATCTCCCTAGCACTGG + Intronic
908360829 1:63367438-63367460 ACCCGAGAGGTCCCCAGCCCCGG - Intergenic
910648193 1:89535982-89536004 AACCCAGAGGGCCCCAGGAAAGG - Intronic
910820447 1:91339258-91339280 ACCACACAGCTCCCCAGCAATGG + Intronic
910913932 1:92268998-92269020 AGCCCAGACCTCCCAGGCACAGG + Intronic
912484671 1:110016358-110016380 AACACAGAGCTTCCCAGCTTTGG - Exonic
912629289 1:111233233-111233255 AACGCAGATCTCCCCACCCCCGG - Intronic
914900414 1:151708520-151708542 AACTCACAGCTCTCCAGCAAAGG - Intronic
915568714 1:156732133-156732155 AGCCTTGAGTTCCCCAGCACAGG - Intronic
920094759 1:203479077-203479099 GACCCAGAGCTACCCTGCAGTGG - Intronic
920173199 1:204084227-204084249 AACCCACAGCACCACACCACAGG - Intronic
922720358 1:227897062-227897084 CACCCAGAGTCCCCCAGCACTGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063265981 10:4451356-4451378 AACGCAGAGCTCCAGAGCACAGG + Intergenic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1069614825 10:69800437-69800459 AACCCAGAGCTCCTGGCCACGGG + Intergenic
1070823078 10:79374637-79374659 AACCCTGACCTCCCCAGTACAGG - Intergenic
1073755083 10:106572778-106572800 TACCCAGATCTCTCCAGCACAGG + Intergenic
1074436252 10:113436785-113436807 ACCCCAGAGCTGCCCACAACTGG + Intergenic
1077046734 11:550013-550035 AGCCCAGGCCTCCCCAGCCCAGG - Intronic
1080099140 11:28439102-28439124 AATCCAGAGATCCCTAGCAAAGG - Intergenic
1082732259 11:56814342-56814364 CACCCAGAGATCTCCAGCACTGG + Intergenic
1083272732 11:61580430-61580452 CACCCGAGGCTCCCCAGCACCGG - Intronic
1083477414 11:62923202-62923224 AACCCAGGGCAGCCCAGCAGGGG - Intergenic
1083592487 11:63903877-63903899 CTGCCAGAGCTCCCCAGCTCTGG + Intronic
1084683303 11:70679571-70679593 GACCCACTTCTCCCCAGCACAGG - Intronic
1088727123 11:112649113-112649135 AAGCCAGAGCTCAGCAACACAGG + Intergenic
1089082423 11:115788016-115788038 AACCCCTGGCTCCCCAGCACAGG - Intergenic
1089282023 11:117381381-117381403 TCCCCAGAGCTCACCAGCACTGG - Intronic
1089332417 11:117699255-117699277 AGGCCAGAGCTCCCCACCACAGG - Intronic
1091200663 11:133778079-133778101 AAACCTGTGCTCCCCAGCATAGG + Intergenic
1095727573 12:45470078-45470100 ACCACAGATCTCCCCAGCCCCGG + Intergenic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1097955268 12:65478912-65478934 CAACCAGAGCTCCCCAGCTCAGG + Intronic
1098570237 12:71980185-71980207 AACCCAGAGCTCCCAGCCTCAGG - Intronic
1100353452 12:93806948-93806970 AACTCAGAACTACCCAGGACTGG + Intronic
1101970840 12:109310650-109310672 AACTCAGGGCTCCCCTGGACTGG + Intergenic
1102254716 12:111408804-111408826 AACCCAAGGATCCCCAGCAATGG - Intronic
1103276114 12:119713140-119713162 AACCCAGGTCTCCCCAGTGCTGG - Intronic
1103950094 12:124545759-124545781 AAGCAAGAACTTCCCAGCACGGG - Intronic
1104573906 12:129949312-129949334 AACCCACAGCTCCTCTTCACTGG + Intergenic
1104744864 12:131204344-131204366 AGCCCAGAGCTGCCCTGCCCAGG + Intergenic
1104773987 12:131381773-131381795 AGCCCAGAGGTTCCCAGCCCAGG + Intergenic
1104800953 12:131554995-131555017 AGCCCAGAGCTCCCCAGGCAAGG + Intergenic
1104840790 12:131824372-131824394 AAGCCAGAGGTGCCCAGCCCTGG - Intergenic
1107128021 13:36865400-36865422 ATCTCAGAGCTCACCAGCCCTGG + Intronic
1107740446 13:43444919-43444941 AACCCAGGTCTCCCTAGCCCAGG - Intronic
1112139540 13:96623314-96623336 TGCCCAGTGCCCCCCAGCACAGG - Intronic
1113675197 13:112202239-112202261 CATCCAGAGCTCCTGAGCACTGG - Intergenic
1114736576 14:25049470-25049492 GACCCCGAGCTCCCCCACACTGG + Intronic
1116288358 14:43002068-43002090 AACTCAGAACTCACCAGCAAGGG + Intergenic
1117537815 14:56718717-56718739 AGCCCAGTGGTCCCCAGCCCTGG + Intronic
1117942874 14:60987739-60987761 AACCCACAGCTCCCCTCCACTGG + Intronic
1119333011 14:73809562-73809584 AGCCCAGCGCTCCCCAGCCGCGG + Intergenic
1119539496 14:75428826-75428848 AGCCCAGAGCTCCGAAGCAATGG - Intronic
1120080825 14:80214247-80214269 AAACCAGTGCTCCCCTGCAGTGG + Intronic
1121843159 14:97151282-97151304 AACTCAGAGCTCCACACCGCTGG - Intergenic
1122129615 14:99597520-99597542 GACACAGCGCTCCCCAGCCCTGG + Intronic
1122813929 14:104303101-104303123 CACTGAGAGCTCCCCAGCCCAGG - Intergenic
1122872461 14:104646221-104646243 ACCCCAGGCCTCCACAGCACAGG + Intergenic
1122882928 14:104698091-104698113 TCCTCAGAGCTCCCCAGCCCCGG - Intronic
1124636905 15:31371318-31371340 AACCCAGAGCACCCCATTATAGG - Intronic
1124725105 15:32149305-32149327 AGCACAGGGCTGCCCAGCACTGG + Intronic
1125578900 15:40772255-40772277 AAACCAGAGCCCAGCAGCACTGG + Exonic
1125744503 15:41989351-41989373 AACCCAGGGTGGCCCAGCACTGG + Intronic
1128543903 15:68554882-68554904 ATCCCAGAGCTGCCTTGCACTGG - Intergenic
1128744621 15:70104649-70104671 ACCCCAGAACTCCCCTCCACTGG - Intergenic
1128759019 15:70202703-70202725 CAGCCAGAGCTGCCCAGAACAGG - Intergenic
1129068841 15:72934228-72934250 AACCCAGACCTTGCCAGAACTGG + Intergenic
1129243911 15:74268462-74268484 ACCCCAGAGGGCCCCAGCCCTGG - Intronic
1130547164 15:84865173-84865195 TACCCAGAACTCCCCAACAAAGG + Intronic
1131530935 15:93191137-93191159 TTCCCAGAGCCCCCCAGCAATGG + Intergenic
1132420003 15:101657345-101657367 AGCCCCGAGCTCCGCAGCCCTGG + Intronic
1132570170 16:641041-641063 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570194 16:641090-641112 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570265 16:641295-641317 AGCACAGAGCCCCCCAGCACAGG + Intronic
1132570298 16:641384-641406 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570321 16:641447-641469 AGCACAGAGCCCCCCAGCACAGG + Intronic
1132616163 16:842078-842100 AGCCCAGAGTTCCCCAGCCCAGG - Intergenic
1132745188 16:1433513-1433535 AACCCAGAGGTCACCAGGGCTGG + Intergenic
1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG + Intronic
1133999121 16:10768963-10768985 AACACAGCCCTCCCCAGCACAGG + Exonic
1134317003 16:13127811-13127833 GAGCCAGAGCTCCCAAGCACAGG + Intronic
1134747788 16:16601310-16601332 AAGCCAGAGCTCCTCAGAACAGG - Intergenic
1134997680 16:18752353-18752375 AAGCCAGAGCTCCTCAGAACAGG + Intergenic
1135188283 16:20333699-20333721 ATCTCTGAGCTCACCAGCACTGG + Intronic
1135597500 16:23755256-23755278 AACCCAGCGATCCCAGGCACAGG - Intronic
1135835603 16:25822602-25822624 AACCCAGTGGTCCTCAGCAGAGG - Intronic
1136394205 16:29984038-29984060 GGCACAGGGCTCCCCAGCACTGG - Intronic
1137016925 16:35386319-35386341 AACACAGAGTCACCCAGCACAGG - Intergenic
1137378788 16:47978419-47978441 AACCCACAGCATCACAGCACAGG + Intergenic
1137446364 16:48534891-48534913 AACCCCCACCTCCCCAGCCCAGG - Intergenic
1137672050 16:50284710-50284732 AAACCAGGGCTCCTCAGCCCAGG - Intronic
1138162855 16:54772413-54772435 AAGCCAGAGCTGCCCAGAAATGG - Intergenic
1138385415 16:56632805-56632827 AACCCAGAGACCCTCAGTACTGG - Intronic
1138385986 16:56635892-56635914 AACCCAGAGACCCTCAGTACTGG - Intergenic
1139587776 16:67915394-67915416 AACCCAGAGCTCTCCACAGCGGG - Intronic
1140125138 16:72112295-72112317 GGCCCAGAGCTCCCCACCATGGG + Intronic
1141663179 16:85452705-85452727 AACCCAGAGACCCTCAGCACAGG + Intergenic
1141728007 16:85802649-85802671 ATACCAGATCTCCCCAGCAGAGG + Intronic
1142169203 16:88611688-88611710 AACCCAGAGCTCTCCAACGCAGG + Intronic
1142272412 16:89097021-89097043 AACCCAGAGCTCAGCAGAGCTGG - Intronic
1143526691 17:7477361-7477383 ACGCCAGAGCTCCTCAGCCCTGG + Intronic
1144110267 17:12023735-12023757 AACCCAGAACTCCAGAGCTCTGG - Intronic
1144762492 17:17715244-17715266 AGCTCAGAGCAGCCCAGCACAGG - Intronic
1146397531 17:32480653-32480675 AAGACAGAGCTGCCCAGCCCTGG - Intronic
1148066649 17:44875886-44875908 AACCCAGAGCCTCCGAGGACAGG + Intronic
1148808265 17:50274947-50274969 ATCCCAGGGTCCCCCAGCACTGG - Intronic
1150099277 17:62407858-62407880 AACCCAGAGCTCCACAGGGTGGG - Intronic
1150289235 17:63972100-63972122 CTCCCTGAGCTCCCCAGCCCTGG - Intronic
1150651021 17:67010208-67010230 AACCCAGGGCCCCACACCACTGG - Intronic
1151552273 17:74828919-74828941 AGCCCATAGACCCCCAGCACAGG + Intronic
1152029387 17:77832291-77832313 AGCCCAGGGGTCCCCAGCCCCGG + Intergenic
1152147980 17:78580693-78580715 ACCCCAGAGCTCCCAGACACAGG + Intergenic
1152206299 17:78976423-78976445 AGCCCTGAGTTCTCCAGCACTGG + Intronic
1152314733 17:79573541-79573563 CACCCTGACTTCCCCAGCACGGG + Intergenic
1155268482 18:24116905-24116927 AGCCCAGACCTCCCCGGCTCAGG + Intronic
1156497113 18:37533185-37533207 AACTCAAAGCTCTCCAGCAATGG - Intronic
1157326702 18:46674379-46674401 AGCCCCGAGCTCCCCTGGACAGG + Intronic
1157342578 18:46792320-46792342 AACCCAGTGATTCCCAGCCCTGG - Intergenic
1157708775 18:49833298-49833320 AGCCCAGAGCGCCCAAGCAATGG + Intronic
1160116126 18:76081326-76081348 AAGCCAGTGCTCCCAAACACTGG - Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1161021435 19:2013418-2013440 AACCCAGAGACCCCCAGCTCCGG - Intronic
1162790295 19:13059342-13059364 AGGCCAGAGCCCCCCAGCACAGG + Intronic
1162818614 19:13210057-13210079 CACCCAGAGCTCCCTAGCTTGGG - Intronic
1163451439 19:17379557-17379579 CACCCAGAGCCCCCCAGAGCTGG + Intergenic
1163584640 19:18157142-18157164 AAACCAGAGTCCCCCAGCGCAGG + Intronic
1164638457 19:29808170-29808192 AGTCCAGAGCTCCCGAGCATTGG - Intergenic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1165795370 19:38516249-38516271 AGTCCAAATCTCCCCAGCACAGG + Intronic
1166796650 19:45430172-45430194 TCCCCAGCGCTGCCCAGCACAGG + Intronic
1167356240 19:49006017-49006039 ACCCCAGTGCTGCCCAGCACAGG - Intronic
1167816569 19:51887629-51887651 AACGAAGACCTCCCAAGCACTGG + Intronic
926153776 2:10439353-10439375 AACTCTGAGCTCCCCAACAAGGG - Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
927446292 2:23164973-23164995 AACCAAGTCCTCCCAAGCACAGG + Intergenic
927466509 2:23340691-23340713 AACCCAGAGATCCCCTCCCCAGG + Intergenic
927927882 2:27025833-27025855 AAGCCAGAGGTCCCCACCTCAGG - Intronic
928426059 2:31178782-31178804 AGCCCAGAGCACAGCAGCACTGG + Intronic
929890352 2:45913481-45913503 AACCCAGAGCTCCACTGAGCAGG - Intronic
931649482 2:64454768-64454790 AGCCCAGAGCCCCGCAGCCCGGG - Intronic
932429891 2:71667883-71667905 ACCCCACAGCCACCCAGCACAGG - Intronic
932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG + Intronic
932818032 2:74877263-74877285 AGCCCAGAGCTTCTCAACACCGG + Exonic
933547230 2:83729889-83729911 AACCCAGATATCCCCATCCCTGG - Intergenic
934582668 2:95457724-95457746 AAACCAGAGTTCTCCAGCACAGG - Intergenic
934596782 2:95618990-95619012 AAACCAGAGTTCTCCAGCACAGG + Intergenic
934769831 2:96900606-96900628 AATCCAGAGTGCCCCAGCACTGG - Intronic
935652477 2:105393977-105393999 AACGCACAGATCCCCAACACGGG + Intronic
937478987 2:122239964-122239986 ACCTCAGAGCTCCCCATAACAGG + Intergenic
941491621 2:166149190-166149212 TTCAGAGAGCTCCCCAGCACTGG - Intergenic
942041328 2:172066616-172066638 AACGCAGAGCACCACAGCACTGG + Intronic
944208215 2:197179714-197179736 AGGCCTGAGCTCTCCAGCACTGG - Intronic
946001249 2:216484463-216484485 AAACCAGAGCTGCCCAATACAGG - Intergenic
947788813 2:232850013-232850035 AACCCAGAGTTAACCAGGACAGG + Intronic
947830664 2:233139371-233139393 AATCCACAGATCACCAGCACTGG + Intronic
948158211 2:235801589-235801611 AACCCAAAGCCCCCCAGCCTGGG - Intronic
948169394 2:235888860-235888882 AAGCCAGAGCTCCCCACTGCTGG - Intronic
948464783 2:238147304-238147326 CACCCAGGGCTCCCGAGCCCAGG + Intronic
948655348 2:239473513-239473535 ATCCTGGAGCTCCCAAGCACAGG - Intergenic
948912544 2:241011703-241011725 AACCCCTCTCTCCCCAGCACTGG - Intronic
1170677644 20:18497178-18497200 AGGCCAGAGTTCCCCAGCGCGGG + Exonic
1172634299 20:36399537-36399559 CACCCATAGCTCCCCAGTGCTGG - Intronic
1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG + Intronic
1173399831 20:42714976-42714998 ATTCCAGAGGTTCCCAGCACTGG - Intronic
1173406859 20:42773830-42773852 AACACAGAGTTTCCCAGCATTGG - Intronic
1174564924 20:51457737-51457759 ACCCCAGACCTGCCCAGCCCAGG + Intronic
1174997772 20:55590030-55590052 AACCCCAAGCTCCACAGCAGAGG - Intergenic
1175955443 20:62606721-62606743 AGCCCAGTGCTCCCTAGCACGGG - Intergenic
1177067832 21:16463135-16463157 AACTCACAGCTCCACATCACTGG - Intergenic
1179005846 21:37513318-37513340 CACTCAGACCTCCCCAGGACTGG - Intronic
1179943795 21:44656941-44656963 ATCCCAGACCCCCCCAGCATGGG + Intronic
1181590234 22:23879706-23879728 AACCCAGAGCTCCTGGGCCCAGG + Intronic
1181911907 22:26245089-26245111 AAACCAGAGCGCCCCAACAAAGG - Intronic
1182893771 22:33841801-33841823 AGCCAAGAGATCCTCAGCACAGG + Intronic
1183032805 22:35118108-35118130 AAACCAGAGCTGCCCAGGAAAGG + Intergenic
1184834357 22:47012350-47012372 AACCCAGACTAGCCCAGCACTGG + Intronic
1184835818 22:47020268-47020290 ATCCCAGAGCCTCCCACCACCGG - Intronic
950471864 3:13191280-13191302 AACCCAGACCTCTCCAGAGCTGG + Intergenic
950574132 3:13821047-13821069 AACACAGATATCCCCAACACAGG + Intronic
952031968 3:29153916-29153938 AACCAATAGCTCCTCACCACAGG - Intergenic
952943182 3:38458630-38458652 TACCCTGAGCTCCCAAGCAGAGG - Intronic
953019553 3:39104849-39104871 GGCCCAGAGCTCCCCTGCAGCGG - Intronic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
959530700 3:107431434-107431456 AACCCAGAGCGCCCGGGCCCAGG - Intergenic
963085392 3:141430964-141430986 GTCCCAGAGTTCCCCAGGACAGG - Intronic
966307863 3:178557086-178557108 AATCAAGACCTCCACAGCACTGG + Intronic
967221299 3:187250200-187250222 GATACTGAGCTCCCCAGCACTGG - Intronic
967917277 3:194588064-194588086 GACCCAAGGCCCCCCAGCACAGG + Exonic
967963383 3:194942412-194942434 GACCCAGAGCTCCCAGGCCCTGG - Intergenic
968516686 4:1018505-1018527 AGCCGAGAGGCCCCCAGCACAGG - Intronic
968545562 4:1195960-1195982 AACCCAGATCCCCACAGCAAAGG - Intronic
968591355 4:1461231-1461253 CACCCAGAGCCCCACAGCAAAGG - Intergenic
969114102 4:4860474-4860496 AGCCCACGGCTCCCTAGCACCGG - Intronic
969638132 4:8381216-8381238 AACCCAGAGCTTCACCGCTCTGG + Intronic
969641989 4:8404375-8404397 AACCCAGAACTCTGCAGGACAGG + Intronic
969929080 4:10612681-10612703 ACCCCAGAGCTCATCAGCATGGG - Intronic
970108964 4:12616565-12616587 AACAGAGATCTCCCCAGCAGGGG - Intergenic
971458933 4:26873478-26873500 GACCCAGAGCCCCCCTGCTCTGG - Intronic
973860923 4:55063803-55063825 AGCCCAGAGCTCCTGAGCTCAGG - Intergenic
974657942 4:64849144-64849166 AATCCAGGGGTCCCCAGTACTGG - Intergenic
981448683 4:144870405-144870427 AATCTAGAGCTCACCAGCTCAGG - Intergenic
982000048 4:151014515-151014537 AAACCAGGGCTCCCCATCAGGGG - Exonic
982327407 4:154142943-154142965 AACCCAGAGTTTCTCAGCATTGG + Intergenic
984639424 4:182145020-182145042 ACCCCGGGGCTCCCCAGTACGGG - Intronic
985631749 5:1017658-1017680 AGCCCACAGCCCCCCACCACGGG + Intronic
985695474 5:1337761-1337783 AAGGCAGTGCTTCCCAGCACGGG + Intronic
999381974 5:151127672-151127694 CAGCCAGTTCTCCCCAGCACAGG + Intronic
1001788134 5:174431349-174431371 AACCCAAATCAACCCAGCACAGG - Intergenic
1002252462 5:177938389-177938411 ACCCCAGGACCCCCCAGCACAGG + Intergenic
1003712547 6:8608900-8608922 AATCCTGAGCTGCCCAGCCCAGG + Intergenic
1005366959 6:25088354-25088376 AACCCAAAGCTTGACAGCACTGG + Intergenic
1007219515 6:40267447-40267469 ACCCCATAGCCCCCCAACACAGG + Intergenic
1007759534 6:44125616-44125638 CACCCAGATCTCCCCAGCCTGGG + Intronic
1009045810 6:58236715-58236737 ACCCAATAGCTCCCCAGCAATGG - Intergenic
1009221624 6:60991028-60991050 ACCCAATAGCTCCCCAGCAATGG - Intergenic
1010175718 6:73025848-73025870 AACCCACAGCTACTCAGCCCTGG - Intronic
1011785922 6:90844996-90845018 AAGCCAGAGCTGCTCAGCCCAGG + Intergenic
1012447081 6:99317739-99317761 AACACAGAGATCCCCAGCTGTGG - Intronic
1013428434 6:110035136-110035158 GAAGGAGAGCTCCCCAGCACCGG - Intergenic
1014800635 6:125774013-125774035 AGCCAAGAGCTCCACAGCAGAGG - Intergenic
1017747848 6:157462766-157462788 AGCCCAGTGCCCCCCAGCCCTGG + Intronic
1019004502 6:168784780-168784802 CACCCAGAGCTGCTCAGCGCAGG - Intergenic
1019198904 6:170297685-170297707 GGCCAACAGCTCCCCAGCACGGG - Intronic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019937439 7:4265674-4265696 ACCTCAGACCTCCCCAGCCCTGG + Exonic
1020098885 7:5383348-5383370 GACCCAGGGCTCCCCTGCACAGG + Intronic
1021090707 7:16479316-16479338 AAGCCTGGCCTCCCCAGCACTGG - Intronic
1022801536 7:33781465-33781487 AACACAGAGCTGCCCAGACCAGG - Intergenic
1024077835 7:45831712-45831734 AATGCACAGCTCCCCAGCAATGG - Intergenic
1024157342 7:46638806-46638828 AAACCAGACCTGCCCAGCTCAGG - Intergenic
1024701299 7:51906905-51906927 AACCCACAGCCCCCCAGTCCTGG - Intergenic
1024985966 7:55193401-55193423 ATCCCAGTGTTGCCCAGCACTGG + Intronic
1026152066 7:67796358-67796380 GACCCAGCGCTCCCCTGCAGTGG + Intergenic
1026773658 7:73217816-73217838 CACCCTGAGGTCCCCAGCCCTGG - Intergenic
1026833424 7:73623528-73623550 AACCCAGGCCTCCCGGGCACCGG + Intronic
1026995165 7:74611035-74611057 AGACCAGACCTCCCCTGCACAGG + Intergenic
1027014517 7:74771210-74771232 CACCCTGAGGTCCCCAGCCCTGG - Intergenic
1027073516 7:75174747-75174769 CACCCTGAGGTCCCCAGCCCTGG + Intergenic
1029610265 7:101622874-101622896 TACCCTGTGCTCCCCAGCACAGG + Intronic
1032708345 7:134441461-134441483 AACCCAGAGCCCCACTGCACAGG - Intergenic
1034780346 7:153873683-153873705 AAGGCAGAGCTCCCCATCACTGG - Intergenic
1035206976 7:157300132-157300154 AACCCCGGGCTCCCCCGCCCCGG - Intergenic
1035412040 7:158652269-158652291 TACTCAGAACTCCCCAGGACGGG - Intronic
1036210136 8:6834812-6834834 AACCCAGAGCCCGCCAGCCGCGG - Intronic
1037696785 8:21230472-21230494 AACTCAGTGGTTCCCAGCACAGG + Intergenic
1037743107 8:21622847-21622869 ACCCCAGAGCCCACCAGCCCTGG + Intergenic
1037994158 8:23340681-23340703 AGCCCAGAGAACCCCAGCTCAGG - Intronic
1038658335 8:29474593-29474615 AACCCACAGCTCCCGACCCCAGG - Intergenic
1039407992 8:37329166-37329188 AGCCCAGAGCTCCCTGCCACTGG + Intergenic
1041175675 8:55193811-55193833 TACCCAGAGCTCCCAAACACTGG - Intronic
1041596694 8:59663103-59663125 TCCCCAGAGCACCTCAGCACTGG + Intergenic
1045420497 8:102009963-102009985 ACCCAAGTGCTCCCCAGTACTGG - Intronic
1046907681 8:119591647-119591669 AACCCAGAGTACCCCAGATCTGG + Intronic
1047250916 8:123181732-123181754 AACCCAGATGTCCACAGCAGTGG + Intronic
1048214757 8:132483909-132483931 ATCACAGCGCTCCACAGCACAGG + Intergenic
1048325734 8:133437474-133437496 AACTCAAAGCTCCCCATTACGGG + Intergenic
1048882821 8:138884228-138884250 AACCCTGAGCTCCTCAGCAGGGG + Intronic
1049355086 8:142183634-142183656 AACCCAGAGCTCTACTGCCCCGG + Intergenic
1052968818 9:34363868-34363890 GACTGAGAGCTCCCCAGAACGGG + Intergenic
1053010113 9:34628124-34628146 CCCCCAGAGCCCCCCAACACAGG + Intergenic
1054144194 9:61550299-61550321 ACACCAGAGCTCCTCACCACTGG + Intergenic
1055394082 9:75854922-75854944 CACCCAGAGTTGGCCAGCACTGG + Intergenic
1055513538 9:77016801-77016823 CACGCAGAGCTCCTCAGCAGCGG + Intergenic
1059451899 9:114376212-114376234 ACCCCAGGGCTCCCCACCCCAGG + Intronic
1060239780 9:121892935-121892957 AGCCCAGAACTCCCCCTCACTGG + Intronic
1060748366 9:126152629-126152651 AACGTAGGGCTGCCCAGCACAGG - Intergenic
1061805471 9:133135360-133135382 ACCGCAGGGCTCCCCTGCACTGG + Intronic
1061877860 9:133553918-133553940 AACCCAGAGCCCCACTGCCCAGG - Intronic
1061908035 9:133708744-133708766 ACCCCAGGACTCCCCAGCACTGG - Intronic
1062037210 9:134387781-134387803 AGCCCAGAGATGCCCAGGACAGG - Intronic
1062401751 9:136375879-136375901 AACCAAGACCACCCCAGCGCCGG + Intronic
1062681937 9:137786858-137786880 AACGCTGATGTCCCCAGCACCGG - Intronic
1188516529 X:30993473-30993495 AAACCAGAGATCCCCAATACAGG - Intergenic
1189555833 X:42144380-42144402 TAACCAGAGCTCTTCAGCACAGG - Intergenic
1191670911 X:63747705-63747727 AACCCAGTGGTTCTCAGCACTGG - Intronic
1193360440 X:80573613-80573635 AGCCCAGAGCTTCTCAACACCGG - Intergenic
1193928914 X:87527701-87527723 ATCCCAGAGCTCCACAGCCTAGG + Intronic
1198080267 X:133233178-133233200 GACCCAAAGGTCCACAGCACAGG + Intergenic
1198830528 X:140745190-140745212 AACACCAAGCTCCCCAGTACTGG - Intergenic