ID: 1165731272

View in Genome Browser
Species Human (GRCh38)
Location 19:38147135-38147157
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165731272_1165731280 17 Left 1165731272 19:38147135-38147157 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1165731280 19:38147175-38147197 CCTCAACCTCCCATGAAGCTGGG 0: 1
1: 98
2: 5330
3: 114089
4: 232171
1165731272_1165731282 25 Left 1165731272 19:38147135-38147157 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1165731282 19:38147183-38147205 TCCCATGAAGCTGGGATTACAGG 0: 7
1: 1181
2: 56771
3: 174296
4: 573800
1165731272_1165731278 16 Left 1165731272 19:38147135-38147157 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1165731278 19:38147174-38147196 GCCTCAACCTCCCATGAAGCTGG 0: 1
1: 68
2: 4252
3: 99199
4: 215590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165731272 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr