ID: 1165732195

View in Genome Browser
Species Human (GRCh38)
Location 19:38152930-38152952
Sequence GACCAGCCAGGAGAGCACCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 278}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165732191_1165732195 -7 Left 1165732191 19:38152914-38152936 CCTCTTCCGGCGGCCTGACCAGC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1165732195 19:38152930-38152952 GACCAGCCAGGAGAGCACCATGG 0: 1
1: 0
2: 1
3: 25
4: 278
1165732185_1165732195 28 Left 1165732185 19:38152879-38152901 CCACTTCAGCCACGATGGGACGT 0: 1
1: 0
2: 2
3: 9
4: 187
Right 1165732195 19:38152930-38152952 GACCAGCCAGGAGAGCACCATGG 0: 1
1: 0
2: 1
3: 25
4: 278
1165732183_1165732195 30 Left 1165732183 19:38152877-38152899 CCCCACTTCAGCCACGATGGGAC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1165732195 19:38152930-38152952 GACCAGCCAGGAGAGCACCATGG 0: 1
1: 0
2: 1
3: 25
4: 278
1165732187_1165732195 19 Left 1165732187 19:38152888-38152910 CCACGATGGGACGTCCAGCGGCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1165732195 19:38152930-38152952 GACCAGCCAGGAGAGCACCATGG 0: 1
1: 0
2: 1
3: 25
4: 278
1165732189_1165732195 5 Left 1165732189 19:38152902-38152924 CCAGCGGCGACTCCTCTTCCGGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1165732195 19:38152930-38152952 GACCAGCCAGGAGAGCACCATGG 0: 1
1: 0
2: 1
3: 25
4: 278
1165732184_1165732195 29 Left 1165732184 19:38152878-38152900 CCCACTTCAGCCACGATGGGACG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1165732195 19:38152930-38152952 GACCAGCCAGGAGAGCACCATGG 0: 1
1: 0
2: 1
3: 25
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165732195 Original CRISPR GACCAGCCAGGAGAGCACCA TGG Exonic