ID: 1165732564

View in Genome Browser
Species Human (GRCh38)
Location 19:38155705-38155727
Sequence CAGCTCCCCCAGATGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165732559_1165732564 -10 Left 1165732559 19:38155692-38155714 CCCATCAGCACACCAGCTCCCCC 0: 1
1: 0
2: 0
3: 24
4: 227
Right 1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG 0: 1
1: 0
2: 3
3: 31
4: 319
1165732558_1165732564 -9 Left 1165732558 19:38155691-38155713 CCCCATCAGCACACCAGCTCCCC 0: 1
1: 0
2: 1
3: 32
4: 378
Right 1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG 0: 1
1: 0
2: 3
3: 31
4: 319
1165732557_1165732564 12 Left 1165732557 19:38155670-38155692 CCAGGCAGCTGGGAGAGCTGACC 0: 1
1: 0
2: 1
3: 27
4: 307
Right 1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG 0: 1
1: 0
2: 3
3: 31
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165732564 Original CRISPR CAGCTCCCCCAGATGCTGTG GGG Intronic
900229148 1:1547521-1547543 AAGCCCCACCAGAGGCTGTGAGG + Intronic
900865954 1:5268846-5268868 CAGGTCCCACAGCTGCTGAGTGG + Intergenic
901221680 1:7587039-7587061 CAGCTCCCCCAGAAGGGGAGGGG + Intronic
901779972 1:11587475-11587497 CAGCTATCCCCCATGCTGTGAGG + Intergenic
902387240 1:16082958-16082980 CACCTCCCAGAGCTGCTGTGAGG + Intergenic
902451289 1:16498643-16498665 CAGGGCCGCCGGATGCTGTGCGG - Intergenic
902501584 1:16914639-16914661 CAGGGCCGCCGGATGCTGTGCGG + Intronic
902892216 1:19452573-19452595 CAGCACGCCCAAATCCTGTGGGG + Intronic
903779932 1:25814619-25814641 CATCTCCCAAAGCTGCTGTGAGG - Intronic
903971951 1:27124719-27124741 CACTGCCCTCAGATGCTGTGAGG - Intronic
904345008 1:29862106-29862128 CAGCTCCCCAGGTTACTGTGTGG + Intergenic
904592638 1:31623566-31623588 CAGGTCCCCCAGCTGGTCTGAGG - Exonic
905224423 1:36469780-36469802 CAGCCTACCCAGAGGCTGTGAGG + Exonic
905447840 1:38038862-38038884 CAGCTCTACCAGCTTCTGTGTGG + Intergenic
906670482 1:47650744-47650766 CACCTCCCCCAGCTCCTTTGTGG + Intergenic
906773431 1:48506117-48506139 CAGCACCCCCAGTAGCTGAGAGG + Intergenic
907211205 1:52824262-52824284 CAGCTACTCCAGAGGCTGAGGGG - Exonic
909629376 1:77755582-77755604 CAGCTACTCCAGAGGCTGAGTGG + Intronic
911506651 1:98761393-98761415 CAGCTTGCCCAGAAGATGTGGGG - Intergenic
912713245 1:111964432-111964454 CAGCTGCCTCAGGAGCTGTGGGG - Intronic
913292693 1:117289334-117289356 CAGCTACTCCAGAGGCTGAGGGG - Intergenic
915511824 1:156390834-156390856 CAGCCTCCTCAGATGCTGTTGGG - Intergenic
915589086 1:156860660-156860682 CAGCTCCGGCAGACGCTGAGGGG - Intronic
916858253 1:168774429-168774451 CAGCTCAGCCAGCTGGTGTGAGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918605971 1:186426345-186426367 CTGCTCCACGTGATGCTGTGTGG + Intergenic
918790686 1:188823415-188823437 CAGCTACTCCAGAGGCTGAGGGG - Intergenic
920060419 1:203223417-203223439 CAGCCCCCACATGTGCTGTGGGG + Intronic
921293927 1:213684252-213684274 AAGCTCCCCGGGTTGCTGTGAGG - Intergenic
921358532 1:214308691-214308713 CAACTCCACCATCTGCTGTGTGG - Intronic
923860951 1:237891428-237891450 CATTTCCCCCAGATCCTGTGGGG - Intergenic
924002336 1:239568042-239568064 GACCTCCCTCAGTTGCTGTGAGG - Intronic
924926849 1:248691983-248692005 CAGCGCCCCCGGATGCTGGGTGG - Intergenic
1062900581 10:1142260-1142282 CAGCTCCACCAGTTGCAATGTGG - Intergenic
1063176721 10:3557377-3557399 CATCTCACCCAGAAGCAGTGAGG - Intergenic
1063812894 10:9734539-9734561 CAGCTACTCGAGAGGCTGTGAGG - Intergenic
1065964415 10:30759415-30759437 CACCTCCCACAGATGCTGTCAGG + Intergenic
1067314790 10:45151304-45151326 CGTCACCCCCAGATGCTGTGGGG - Intergenic
1069362888 10:67663532-67663554 CGGCTGCCCCAGATCCTGGGAGG - Intronic
1069842028 10:71345905-71345927 CAGCCCGCCCAGAGGATGTGGGG + Intronic
1070333277 10:75432749-75432771 CAGCTCCTACAGATGCAGTGAGG + Intronic
1072682794 10:97518536-97518558 CAGCTCTGCCAGATGCTCCGTGG - Intronic
1073331688 10:102674187-102674209 CAGCTCCCACGGCTGCTGGGAGG - Exonic
1073469445 10:103713797-103713819 CTCCTCCCCCACCTGCTGTGTGG - Intronic
1073985214 10:109200570-109200592 CAGCTCCACCAGCTCTTGTGGGG + Intergenic
1074523485 10:114245366-114245388 CACCTCCCCAGGCTGCTGTGAGG - Intronic
1074859554 10:117499914-117499936 CAGCTCTGCCACATCCTGTGTGG + Intergenic
1075418887 10:122286210-122286232 CAGCTCCCTCAGGGGGTGTGTGG - Exonic
1075780052 10:125011673-125011695 CAGCTTCCCCAGGGGCTCTGAGG - Intronic
1076185662 10:128446565-128446587 CAGCCCCCCAAGAAGCTGCGGGG + Intergenic
1076401403 10:130187938-130187960 CTGCTCACCCACATGCTCTGTGG + Intergenic
1076715768 10:132362983-132363005 CAGACCCCCGAGCTGCTGTGAGG - Intronic
1076980718 11:203282-203304 CAGCTCTCCCAGGTACTTTGGGG - Exonic
1077453473 11:2664468-2664490 CTTCTCCCCCAGATGGAGTGGGG - Intronic
1078153680 11:8779957-8779979 AGGCTCCCCCAGGTGCAGTGTGG + Intronic
1079142290 11:17819949-17819971 CAGCTCCCCTGGAGGCTGTCGGG - Intronic
1080771426 11:35345633-35345655 CCTCTGCCCCAGGTGCTGTGTGG - Intronic
1081582101 11:44359554-44359576 CAAGTCCCCCAGATGCAGAGGGG + Intergenic
1081807686 11:45899406-45899428 CAGCTCTCTCAGAGGCTGGGAGG + Intronic
1082776481 11:57248955-57248977 TAGCTGCCCCAGATGCTGCGGGG + Intergenic
1082824672 11:57568639-57568661 CATCTTCCCCAGATGCTGCTTGG - Intergenic
1083406428 11:62460444-62460466 GAGCTCCCCAAGAGGCAGTGTGG + Intronic
1083914019 11:65728255-65728277 CAGCTGCCCCAGAGCTTGTGGGG + Intergenic
1088737557 11:112740311-112740333 CATCTCCCAGGGATGCTGTGAGG - Intergenic
1089302783 11:117508559-117508581 CTGCTCCTCGAGATGCTTTGGGG + Intronic
1089730909 11:120518137-120518159 TTGCTCCCCCTGAGGCTGTGTGG + Intronic
1090026020 11:123168328-123168350 CAGCTGCCCTAGATGCTGTCTGG - Intronic
1091224945 11:133951510-133951532 GGGCTCCCCCAGCAGCTGTGAGG + Intronic
1091236071 11:134022963-134022985 CAGGTTCCCCAGCTCCTGTGAGG - Intergenic
1091612775 12:2025274-2025296 CAGCTCTTCCAGATGTTCTGTGG - Intronic
1092199440 12:6570938-6570960 GAATTCCCCCAGTTGCTGTGAGG - Exonic
1096809837 12:54162208-54162230 CTGCACCCCCAGATCCAGTGTGG + Intergenic
1100384222 12:94091014-94091036 CAGCACTCCCAGTAGCTGTGTGG + Intergenic
1100738804 12:97567999-97568021 CAGCTCCCCCAGAGCTAGTGAGG - Intergenic
1100827597 12:98489542-98489564 CAGCTACTCCAGAGGCTGAGAGG - Intronic
1101397336 12:104359895-104359917 CACCTCCCAGAGTTGCTGTGAGG + Intergenic
1101407719 12:104443363-104443385 CCTCTCCTCCAGAGGCTGTGGGG - Intergenic
1101706952 12:107229719-107229741 CAGCTCACCAAGTTGCTTTGAGG - Intergenic
1102034105 12:109761214-109761236 CCCCACCCCCAGATGCTGTAAGG + Intronic
1102227615 12:111240155-111240177 CAGCTCCACCATTGGCTGTGAGG - Intronic
1102520302 12:113473870-113473892 CACCTCCCCTAGATACTGTGGGG - Intergenic
1102639295 12:114352462-114352484 CACCTCCCCCAGATGGGGTTAGG + Intergenic
1102653695 12:114462265-114462287 CAGCTTCCCCTAATCCTGTGGGG + Intergenic
1103513749 12:121493154-121493176 CAGCTACTCCAGAAGCTGAGGGG - Intronic
1103941060 12:124501474-124501496 CAGAGCCCCCAGAGGCCGTGGGG - Intronic
1107274675 13:38664975-38664997 CAGTTGTCCCACATGCTGTGTGG - Intergenic
1110802007 13:79709038-79709060 AAGATCCCACAGATGCTCTGAGG + Intergenic
1113577947 13:111407559-111407581 CAGCTCCCCCAGATGGGCTCAGG + Intergenic
1113644246 13:111981171-111981193 CAGCTCCTCCTGAGGCTGTGGGG + Intergenic
1113698300 13:112364462-112364484 CAGCCCCGCCAGGTGCTGAGAGG + Intergenic
1115699059 14:35931201-35931223 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1115787911 14:36847070-36847092 ATGCTGCCCCAGATGCTGTTGGG + Intronic
1116436044 14:44896699-44896721 CAGCTCCGTCACTTGCTGTGTGG + Intergenic
1117092972 14:52268575-52268597 CAGCTCCTCCAGGGGCTGAGGGG - Exonic
1117139929 14:52778899-52778921 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1118502536 14:66375758-66375780 TTTCTCCCCCAGATTCTGTGTGG - Intergenic
1118616323 14:67576685-67576707 AAACTCCCCCAGATGCAGAGTGG - Intronic
1119119220 14:72058163-72058185 CAGCTTCCCCAGATGTGCTGAGG + Intronic
1121325988 14:93019837-93019859 CAGGTCTCCCAGATGCGATGGGG + Intronic
1121548395 14:94779792-94779814 CAGCTCCCCTAGAAGCTGGCTGG + Intergenic
1122029962 14:98905070-98905092 CTGCTCCCTCAGGTGCTGGGTGG + Intergenic
1122076329 14:99237468-99237490 TAGGTCCCCCAGATGCTCTGGGG - Intronic
1122387306 14:101357955-101357977 CAGCCCTCCCAGCTGCTCTGTGG - Intergenic
1122387320 14:101358026-101358048 CAGCCCTCCCAGCTGCTCTGTGG - Intergenic
1124195610 15:27624120-27624142 CCACTCGCCCAGCTGCTGTGGGG + Intergenic
1124383564 15:29187844-29187866 CTGCTCACCCACAGGCTGTGCGG + Intronic
1125032577 15:35087242-35087264 CTGCTCTCCCACATGCTGTGAGG - Intergenic
1125475412 15:40044870-40044892 CTGCTCCCCAACTTGCTGTGAGG + Intergenic
1125729218 15:41883351-41883373 CAGCTCCTCCAGCTGGTGGGAGG + Exonic
1126585523 15:50282081-50282103 CAGCTACTCAAGAGGCTGTGAGG + Intronic
1128081223 15:64858085-64858107 TAGCGACCCCAGATGCAGTGTGG + Intronic
1128562379 15:68677398-68677420 CAGCTCCACCCTCTGCTGTGTGG - Intronic
1128718257 15:69926168-69926190 CAGTTCCCACAGCTGCTGAGGGG + Intergenic
1129407185 15:75327587-75327609 TAGTGCCCCCAGCTGCTGTGCGG + Intergenic
1129413367 15:75361665-75361687 CAGCTCCCCCAGATCATGCACGG - Exonic
1129597837 15:76978949-76978971 CGGCTGCCCCAGAGCCTGTGGGG - Intergenic
1129858012 15:78838793-78838815 CAGCTCCCAAAGATGCTATGAGG - Intronic
1131164511 15:90132767-90132789 CAGCACCCACAGATACTGTCAGG + Intergenic
1131182650 15:90250945-90250967 CAGCTCCTCCAGATGTTGAAGGG - Intronic
1133866021 16:9644123-9644145 CTGCACCCCCACAGGCTGTGTGG - Intergenic
1134511095 16:14847347-14847369 CAGCTCCCCCATTTGCTGGCTGG + Intronic
1134698737 16:16245843-16245865 CAGCTCCCCCATTTGCTGGCTGG + Intronic
1134973097 16:18548830-18548852 CAGCTCCCCCATTTGCTGGCTGG - Intronic
1135668557 16:24355871-24355893 CAGCAGCCCGAGATGCTCTGGGG + Intronic
1136040027 16:27571527-27571549 CAGATCCCCAGGAGGCTGTGTGG + Intronic
1136368594 16:29821477-29821499 CTGCTCCCCCAGAACCTGGGAGG - Intronic
1136496363 16:30647498-30647520 CAGCTCCCCCAGGTGCCCTCTGG - Intergenic
1137477775 16:48825390-48825412 CATCTCCCCCAGACTCTCTGGGG - Intergenic
1138533980 16:57650076-57650098 CCGCTCCCCAAGAGGCAGTGAGG - Intronic
1139356063 16:66367564-66367586 CAGCTCTCCCATTTGCTCTGGGG + Intronic
1141257220 16:82414027-82414049 CATCTCCACCGGAGGCTGTGAGG - Intergenic
1141716513 16:85730087-85730109 CAGCTCCCCCAGGGGCTCTGAGG - Intronic
1142196052 16:88739782-88739804 CCTCGCCCCCAGCTGCTGTGTGG - Intronic
1142667125 17:1469591-1469613 CAACTCCCGCAGAAGCTCTGAGG + Exonic
1144712985 17:17414566-17414588 CAGCTCTCCCTGGGGCTGTGGGG + Intergenic
1145126889 17:20308421-20308443 CAGATTCCCCACATGCTTTGAGG - Intronic
1146717425 17:35098346-35098368 CAGCTCCTCGAGAGGCTGAGTGG - Intronic
1147643529 17:42019985-42020007 CAGCTCCCCCAGAGGCCGGCGGG - Intronic
1148262587 17:46196127-46196149 CAGCTACTCCAGAAGCTGAGGGG + Intronic
1148394285 17:47295807-47295829 CTCCTCCCCCAGCTGCTGTGAGG + Intronic
1148536349 17:48442238-48442260 CAGCTCCTACAGAAACTGTGTGG + Intergenic
1148670500 17:49406684-49406706 CAGCTTCCCCATTTGCTGGGTGG - Intronic
1148764658 17:50030196-50030218 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
1149527037 17:57364679-57364701 CAGCTCCCCCAGATGACATTCGG + Intronic
1150462620 17:65365097-65365119 CAGCTCCACCAAACCCTGTGCGG - Intergenic
1151047113 17:70933591-70933613 CAGCTACTCCAGAAGCTGAGGGG + Intergenic
1151244251 17:72782246-72782268 CTGCACCCCCAGAAGCTGGGAGG + Intronic
1151384712 17:73748000-73748022 CAGCTCCCCCAGTTTCTGGCTGG + Intergenic
1151528709 17:74690063-74690085 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1151854643 17:76712003-76712025 CAGCTCTCCCTGTTGCTGAGGGG - Intergenic
1152100297 17:78297591-78297613 CAGCACCCCCACAAGCAGTGGGG + Intergenic
1152425892 17:80218500-80218522 CAGCTCCCTCAGAGGCAATGTGG + Intronic
1152510398 17:80782966-80782988 CACCTCCCCCAGTAGCTCTGGGG - Intronic
1152632138 17:81415082-81415104 CAGGGCCACCAGATGCTGCGCGG + Intronic
1153917632 18:9759837-9759859 CAGCACCCCAAGATCCTCTGTGG - Intronic
1155172247 18:23275560-23275582 CAGCTCCTGAAGAGGCTGTGAGG - Intronic
1155966313 18:32038643-32038665 CAGCTTCCCCAGATCATGTGAGG + Intronic
1156375608 18:36512567-36512589 CAGCTGCCCCAGCTGCAGGGGGG + Intronic
1157609252 18:48946012-48946034 CAGGCCTCCCAGATGCTGAGTGG + Intronic
1157621951 18:49021765-49021787 CTCCTCCTGCAGATGCTGTGGGG - Intergenic
1157698646 18:49745308-49745330 CAGATGCCCCAGCTGCTGTGTGG + Intergenic
1158416912 18:57256848-57256870 CTGCTACCCCAGATGCTGCAGGG + Intergenic
1158902714 18:61981176-61981198 CAGCTACTCCAGAGGCTGAGCGG - Intergenic
1160240693 18:77120273-77120295 CAGCTGCACCAGATGCCGCGAGG - Intronic
1160491357 18:79338593-79338615 GGCTTCCCCCAGATGCTGTGTGG + Intronic
1160838545 19:1136156-1136178 CGGATCCCCCAGATGCTGGAGGG + Intronic
1161302306 19:3548588-3548610 CTTCTTCCCCAGATGCTGGGCGG + Intronic
1161391918 19:4025536-4025558 CACCGCCCCCACCTGCTGTGGGG + Intronic
1161456728 19:4373332-4373354 CAGAACTCCCAGATGCTGAGGGG - Intronic
1162809452 19:13155282-13155304 CAGCTCCACCTGATACTGTAGGG - Intergenic
1163245105 19:16088597-16088619 CAGCACTCCCGGATGCTCTGTGG - Intronic
1163261609 19:16194005-16194027 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
1163919575 19:20276155-20276177 CATCTCTCCCAGATTGTGTGGGG - Intergenic
1164818861 19:31228410-31228432 CAGCTACTCCAGAGGCTGAGGGG + Intergenic
1165103323 19:33453198-33453220 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG + Intronic
1166303347 19:41924049-41924071 CACCTCCCCCACAAGCTGTTTGG - Intronic
1166854780 19:45778087-45778109 CAGCAGCCCCAGTTGCTCTGTGG + Intronic
1166998662 19:46732131-46732153 CAGCTTCCCCAGAGGCTTTCAGG - Intronic
1167660351 19:50792490-50792512 CACCTCCCCAGGACGCTGTGAGG + Intronic
1168250091 19:55137088-55137110 CAGCTCCGGTAGGTGCTGTGGGG - Exonic
925472788 2:4180777-4180799 CAACCCCGCCATATGCTGTGTGG + Intergenic
926112540 2:10192409-10192431 GAGCTCCCCGAGCTGCTGTAGGG - Intronic
927151438 2:20198643-20198665 CCTTTCTCCCAGATGCTGTGGGG + Intergenic
928922606 2:36541212-36541234 CACCTCCCAGAAATGCTGTGAGG + Intronic
931071656 2:58658383-58658405 ATGCTCCCCCAGAAGCTGTGGGG - Intergenic
933811605 2:86036159-86036181 CAGCTCCACCACCTGCTGTTTGG + Intronic
934987443 2:98898007-98898029 CAGCTTCCCCAGCTGCATTGAGG - Intronic
935308188 2:101758517-101758539 CAATTCCCACAGATGCTCTGTGG - Intronic
936833522 2:116678911-116678933 CAGCTCCAGCAGTTGTTGTGAGG + Intergenic
936995538 2:118410029-118410051 CAGCTACTCCAGAGGCTGAGAGG + Intergenic
937216368 2:120316125-120316147 GAGTTCCCACAGCTGCTGTGTGG + Intergenic
937487987 2:122335680-122335702 CAGGCTCTCCAGATGCTGTGTGG - Intergenic
938120264 2:128628220-128628242 AAGCTCCTCCACAGGCTGTGAGG + Intergenic
938506973 2:131895601-131895623 ATGCTGACCCAGATGCTGTGGGG - Intergenic
938811184 2:134854336-134854358 CAGCTCCCAGAGTTCCTGTGAGG + Intronic
942431955 2:175921269-175921291 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
943952164 2:194144917-194144939 CTGTTCCCCCACATGGTGTGTGG - Intergenic
944017217 2:195056070-195056092 CATCTCTCCCTGATGCTTTGGGG - Intergenic
944771763 2:202921942-202921964 CAGCTTCCCAAGAAGCTATGGGG + Intronic
946245540 2:218385139-218385161 CAGCACCCAGAGAAGCTGTGAGG - Exonic
946661669 2:222007489-222007511 CAGCTCCTCAGGAGGCTGTGAGG + Intergenic
947136172 2:226978870-226978892 AAGCTCTCCCAGCTACTGTGTGG + Intronic
948174004 2:235928897-235928919 CACCTCCCCCGGCTGCTGTGAGG + Intronic
948789767 2:240371239-240371261 CAGCTCAGCCAAATGCTGTGGGG + Intergenic
948807902 2:240460852-240460874 CAGCTGCCCCGGAGGCTGGGAGG - Intronic
948907775 2:240987935-240987957 CAGCACCCCCAGATGGCCTGGGG - Intronic
1173169971 20:40716058-40716080 CATCACTCTCAGATGCTGTGTGG - Intergenic
1173369340 20:42420801-42420823 CAACACCCCCAAATGTTGTGAGG - Intronic
1174416093 20:50368190-50368212 CCGCTCTCCCTGCTGCTGTGTGG + Intergenic
1174570086 20:51495196-51495218 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1175826137 20:61937641-61937663 CACCCCTCCCGGATGCTGTGAGG + Exonic
1176123432 20:63464469-63464491 CAGGTCCCCAGGATGATGTGTGG - Intronic
1176786660 21:13264691-13264713 ATGCTGACCCAGATGCTGTGGGG + Intergenic
1178320391 21:31600727-31600749 TGGCTCCTCCAGAGGCTGTGAGG - Intergenic
1178396865 21:32250526-32250548 CAGCTGCCCCATAAGCTGTAGGG - Intergenic
1178772757 21:35521085-35521107 AAGCTCCCCCTGAAACTGTGGGG + Intronic
1179504086 21:41828608-41828630 CATCGTCCCCAGGTGCTGTGGGG - Intronic
1180049013 21:45322965-45322987 GGGCACCGCCAGATGCTGTGAGG - Intergenic
1180148782 21:45937012-45937034 CAGCACCCCCAGATTTTGTGGGG + Intronic
1180657691 22:17437086-17437108 CAGCTCTCAGAGATGCTGTTGGG + Intronic
1180746268 22:18091114-18091136 CAGCTACTCCAGAGGCTGAGGGG - Exonic
1180922235 22:19526879-19526901 CACGTCCCTGAGATGCTGTGAGG - Exonic
1181526722 22:23493740-23493762 CAGCTCACCCAGGAGCTGAGCGG + Intergenic
1181760039 22:25052011-25052033 CAGCTCCCCCAGCAGCTGTGTGG - Intronic
1182427281 22:30281205-30281227 CAGCTACTCAAGAGGCTGTGAGG - Intergenic
1183060927 22:35335950-35335972 CATCTTTCCCAGCTGCTGTGCGG - Intronic
1183406174 22:37631723-37631745 CAGCTTCCCCCGATGCTGTGTGG - Intronic
1184364552 22:44041770-44041792 CAGCTACCCCGGAGGCTGAGGGG + Intronic
1184495583 22:44839278-44839300 CAGCTCCCCGAGGTGCCCTGAGG - Intronic
1184926740 22:47646957-47646979 CAGCCCGCCCAGAGCCTGTGAGG - Intergenic
1185091626 22:48778816-48778838 CAGCTCCCCTGGCTGCTGTGGGG + Intronic
1185120499 22:48964714-48964736 CAGCTCTCTCAGTTGCTGAGAGG - Intergenic
1185162792 22:49239613-49239635 CAGGTCCCTCTCATGCTGTGAGG + Intergenic
952402444 3:32975469-32975491 CAACTCCCCTAACTGCTGTGAGG - Intergenic
952736057 3:36692592-36692614 CAGCTACTCCAGAGGCTGAGTGG + Intergenic
953168857 3:40489309-40489331 CAGCTTCCCAAGAAGCTGGGAGG + Exonic
954623131 3:52006908-52006930 CATCTTCCCCAGATGCTGTCAGG - Intergenic
954626787 3:52026179-52026201 CAGCTGCCCCAAATGCTCTCGGG + Intergenic
955338132 3:58103953-58103975 CAGCTCCTCCAGACCCTCTGTGG - Exonic
955521952 3:59783750-59783772 CAGCTCCCCCAGAGGATATTTGG - Intronic
958757717 3:98270903-98270925 CAGTTCCCCCAGGTCCTGGGAGG + Intergenic
959656491 3:108811292-108811314 CAGCTACTCCAGAGGCTGAGCGG - Intergenic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
961223603 3:125219504-125219526 CAGCTCCCCGGAATGCTGGGTGG - Intergenic
961357746 3:126349683-126349705 TAGCTCCTCTAGATGCCGTGAGG - Intronic
961435038 3:126911152-126911174 CAGTCCTCCCAGGTGCTGTGGGG - Intronic
961674664 3:128557219-128557241 CAGCTTCCCCAGCCGGTGTGAGG + Intergenic
961986518 3:131140436-131140458 CATCACCAGCAGATGCTGTGGGG + Intronic
962754427 3:138457214-138457236 CAGCTCCACCCTGTGCTGTGGGG + Intronic
962756548 3:138469340-138469362 CAGTTCCCCCAGATGCTCCTGGG + Intronic
966998558 3:185309394-185309416 CAGCTACTCCAGAGGCTGGGAGG + Intronic
967436921 3:189457859-189457881 CAGCTCGCCCAGATGTTATACGG + Intergenic
968626144 4:1627554-1627576 CAGCTCTCCACCATGCTGTGGGG - Intronic
968668518 4:1834736-1834758 GAGCTCCCCCAGGTGCTGGCTGG - Intronic
968697088 4:2036405-2036427 CAGCTCCCCCAGCTGCCATCAGG + Intronic
969028393 4:4192348-4192370 CAACTTCACCTGATGCTGTGAGG + Intronic
969363635 4:6681241-6681263 CAGCTCCCCCAGAGACCCTGGGG - Intergenic
969925748 4:10584181-10584203 CAGTTCTCCCAGCTGCTGGGTGG + Intronic
970005011 4:11401834-11401856 CTGCTGGCCTAGATGCTGTGGGG + Intronic
970453750 4:16200436-16200458 CAGCTACACCAGAGGCTGAGAGG - Intronic
971489613 4:27197867-27197889 CAGCTCCCACATATGGTGTTGGG - Intergenic
972636523 4:40889088-40889110 CAGCTGGGCCAGATGCTTTGGGG - Intronic
975008616 4:69321653-69321675 GAGCTCCTCCAGAATCTGTGAGG + Intronic
977177465 4:93834700-93834722 CAGCTCCCCGGGGAGCTGTGCGG + Intergenic
977801393 4:101237746-101237768 CAACTGCAGCAGATGCTGTGGGG + Intronic
983136669 4:164092414-164092436 CAGCTCCCCCACCTTCTGTCAGG - Intronic
985003242 4:185506070-185506092 CACCTCCCCAAGTTCCTGTGAGG + Intronic
985318098 4:188680008-188680030 CAGCTTCTCCAGCTGCTGCGGGG - Intergenic
985807856 5:2060309-2060331 CAGCTCCCACCAATGCTGAGTGG + Intergenic
985888130 5:2696007-2696029 CAGCTCCCCCCGTTCCTGTCTGG + Intergenic
985898194 5:2763134-2763156 GTGCTCCCCCAGAGGCTGAGGGG - Intergenic
986216492 5:5724368-5724390 CAGCGGCCCCAGAGGCTGTAAGG - Intergenic
988181255 5:27796991-27797013 CAGCTCCTCCAGCTGCAGTTGGG + Intergenic
992184019 5:74226129-74226151 AGGCTCCAGCAGATGCTGTGTGG + Intergenic
992708291 5:79421238-79421260 AAGTGCCCCCAGATGCTGTAAGG + Intronic
995262001 5:110114994-110115016 TAGCTCACCCAGTTGGTGTGGGG + Intergenic
995884774 5:116882086-116882108 CAGCTCCCAAACATGCTGGGTGG - Intergenic
997762017 5:136458533-136458555 CAGCTCACAGAAATGCTGTGAGG + Intergenic
998058233 5:139097257-139097279 CAGCTCCCCCAGGTGCTATGTGG - Intronic
999240100 5:150122423-150122445 CAGCTCCCCAAAGAGCTGTGGGG + Intronic
999320970 5:150614842-150614864 CAGCAACCCCAGGAGCTGTGGGG + Intronic
1000462928 5:161545275-161545297 CAGGTCCCCCCGTGGCTGTGGGG - Exonic
1000476495 5:161714810-161714832 CAGCTTCCCAAAGTGCTGTGAGG - Intergenic
1000800958 5:165725658-165725680 CACCTCCCTCAGATGCTGCCTGG + Intergenic
1001095323 5:168771371-168771393 CTTCTCTCCCAGATGCTGTGTGG + Intronic
1004398552 6:15267920-15267942 CAGCCCCCGAGGATGCTGTGGGG + Intronic
1006055183 6:31378808-31378830 TGTCTCCCCCAGGTGCTGTGAGG + Intergenic
1006148246 6:31971866-31971888 CAGGTCCTCCAAATGCAGTGAGG + Intronic
1006976276 6:38105291-38105313 CAGCTACTCCAGAAGCTGAGGGG + Intronic
1007834796 6:44666202-44666224 CAGCTTTCCCAGAGGTTGTGGGG + Intergenic
1008059134 6:46978356-46978378 TAGCTCCCTCAGATCCTTTGTGG + Intergenic
1011828673 6:91341752-91341774 CAGTTCCCCAAGATACTGTCAGG + Intergenic
1018313557 6:162534758-162534780 CAGCTCCAGTAGAGGCTGTGTGG + Intronic
1018741498 6:166732687-166732709 GAGCTCCCACAGATGATGTTAGG + Intronic
1019283113 7:210460-210482 CAGCTTCCCCTGGTGCTGCGTGG + Intronic
1019417937 7:935717-935739 CGGCTTCCTCAGATGCCGTGGGG - Intronic
1019494115 7:1329609-1329631 CACCTCCCCCACTTGCTGAGAGG - Intergenic
1019596862 7:1862104-1862126 CAGCTCCCCGAGTTTCTCTGTGG - Intronic
1019996667 7:4729162-4729184 CCGCTCCCCACCATGCTGTGTGG - Intronic
1020063524 7:5170134-5170156 CAGCTTCCCAAGTTGCTGTGGGG - Intergenic
1021625346 7:22587600-22587622 CAGGAAGCCCAGATGCTGTGTGG - Intronic
1021635047 7:22683765-22683787 CCACTTCCCCAGATGCTTTGGGG - Intergenic
1022638552 7:32160157-32160179 CAGCTCACCAAGATGGTGTCTGG - Intronic
1022649218 7:32259476-32259498 CAGCTCCCCCAGCTGGTGGGAGG - Intronic
1022860651 7:34363203-34363225 CAACTCCTCCAGCTCCTGTGGGG - Intergenic
1023776286 7:43610551-43610573 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1023795997 7:43792777-43792799 CAGCTCCCACAGTTCCTGAGCGG - Exonic
1026261146 7:68756541-68756563 CAGCTACTCCAGAGGCTGAGTGG - Intergenic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1027681930 7:81232786-81232808 CAGCTCACCAAGATGCTGGCAGG - Intergenic
1029421494 7:100474207-100474229 CAGCTACCCCGGGTGCTGGGCGG + Intronic
1032352966 7:131183026-131183048 CACATCCACCTGATGCTGTGTGG - Intronic
1033249760 7:139748458-139748480 CGGCTCCCTCCGAGGCTGTGAGG + Intronic
1034345662 7:150383928-150383950 CTCCTCCCCCAGCTGCTGTCTGG + Intronic
1035734851 8:1880851-1880873 CGGCTGCTCCAGAAGCTGTGTGG - Intronic
1035746051 8:1962698-1962720 CAGCATCCCCAGCTGCTGTGGGG + Intergenic
1036729185 8:11246838-11246860 CAGCTCCACCCCTTGCTGTGTGG + Intergenic
1042180266 8:66080504-66080526 CTGCTCCTCCAGATCCTCTGGGG - Exonic
1049221929 8:141432343-141432365 TGGCTCCCCCAGCTCCTGTGTGG + Exonic
1051850856 9:21506085-21506107 CAGCTCTCACATATGCTGTCTGG + Intergenic
1052192780 9:25678130-25678152 CCGCTCCTCCAGCTGCTGTCGGG + Exonic
1053618535 9:39793413-39793435 CAGTTCCCCAAGGTACTGTGGGG + Intergenic
1055019960 9:71659123-71659145 TCTCTCCCCCACATGCTGTGTGG + Intergenic
1055359860 9:75478078-75478100 GAGCTACCCCAGAGCCTGTGGGG + Intergenic
1055769462 9:79701987-79702009 AAGCTTCCTCAGATGCTGTCAGG - Intronic
1055787333 9:79884688-79884710 CTGCTCCCCCAGCTGTTCTGTGG + Intergenic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1059939488 9:119344027-119344049 CATCTCCCCAACATGCTGTAGGG - Intronic
1060018643 9:120109397-120109419 GAGGTCCCCCTGGTGCTGTGTGG + Intergenic
1060385793 9:123227080-123227102 CACCTCCCCAAGTTGCTGCGGGG + Intronic
1061259887 9:129474426-129474448 CAGCTCACCCAGGAGCTGAGAGG - Intergenic
1061631032 9:131872250-131872272 CAGCTCCCCCAGGCGCTGCTCGG - Intronic
1061673839 9:132204244-132204266 CAGCTTCCCCAGACCCTGTGGGG + Intronic
1062138144 9:134940508-134940530 CTGCTGCCCCATAGGCTGTGGGG + Intergenic
1062312257 9:135945151-135945173 AAGCTCCCCCAGAGGCCGAGGGG - Exonic
1062397714 9:136359104-136359126 CATCTCCCCCAGCTGGTGGGAGG - Exonic
1062601397 9:137320124-137320146 CACATCCCGCAGATGCTGGGTGG - Intronic
1186396044 X:9210156-9210178 TAGCTGCCCCAGAGACTGTGTGG - Intergenic
1186738366 X:12490688-12490710 AAGCTCACACAGATGCTATGAGG + Intronic
1187998029 X:24950078-24950100 CTACTCCCAGAGATGCTGTGAGG - Intronic
1188003191 X:25001083-25001105 CCTCACCCCAAGATGCTGTGGGG + Intergenic
1188133187 X:26463180-26463202 AACCTCCCCCAAATACTGTGAGG - Intergenic
1188978510 X:36705029-36705051 CAGCTCCATCAGATGCTTTAAGG + Intergenic
1190913442 X:54792275-54792297 CAGATCCACCATATGCTGTGTGG - Intronic
1190914147 X:54797891-54797913 CAGCTCACAGAGATGCTGTGAGG + Intronic
1191207355 X:57849159-57849181 GAGTTCCCCCAGACCCTGTGTGG + Intergenic
1195262157 X:103143251-103143273 CAGCTACTCCAGAGGCTGAGTGG - Intergenic
1198312355 X:135435210-135435232 CAGCTCTCCCAGCAGCTGAGCGG + Intergenic
1199666167 X:150098212-150098234 CAGCTCCCCTATCTCCTGTGGGG + Intergenic
1200696809 Y:6368248-6368270 CAGCTGCTCCTGAGGCTGTGTGG + Intergenic
1201037304 Y:9796451-9796473 CAGCTGCTCCTGAGGCTGTGTGG - Intergenic
1201769965 Y:17610104-17610126 AAGCTCCCCCAGAGGCTCAGGGG + Intergenic
1201831589 Y:18295883-18295905 AAGCTCCCCCAGAGGCTCAGGGG - Intergenic