ID: 1165738968

View in Genome Browser
Species Human (GRCh38)
Location 19:38194420-38194442
Sequence TGGCGAAACCTGGCCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165738958_1165738968 23 Left 1165738958 19:38194374-38194396 CCCACAACTGAAAGACAGTACGT 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 176
1165738955_1165738968 26 Left 1165738955 19:38194371-38194393 CCCCCCACAACTGAAAGACAGTA No data
Right 1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 176
1165738959_1165738968 22 Left 1165738959 19:38194375-38194397 CCACAACTGAAAGACAGTACGTA 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 176
1165738956_1165738968 25 Left 1165738956 19:38194372-38194394 CCCCCACAACTGAAAGACAGTAC 0: 1
1: 0
2: 5
3: 63
4: 625
Right 1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 176
1165738957_1165738968 24 Left 1165738957 19:38194373-38194395 CCCCACAACTGAAAGACAGTACG 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 176
1165738963_1165738968 -9 Left 1165738963 19:38194406-38194428 CCATGCTCACTGGGTGGCGAAAC 0: 1
1: 0
2: 1
3: 2
4: 77
Right 1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 176
1165738954_1165738968 27 Left 1165738954 19:38194370-38194392 CCCCCCCACAACTGAAAGACAGT 0: 1
1: 0
2: 0
3: 14
4: 126
Right 1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165738968 Original CRISPR TGGCGAAACCTGGCCTGGAG GGG Intronic
900938084 1:5779721-5779743 TGGAGAGAGCTGGTCTGGAGGGG + Intergenic
902284812 1:15400701-15400723 TTGAGAAACCTGGTCTAGAGAGG + Intergenic
902623801 1:17665232-17665254 AGTCGCCACCTGGCCTGGAGTGG + Intronic
904040779 1:27583578-27583600 GGGAGAGACCTGGCCAGGAGAGG - Intronic
905110885 1:35593621-35593643 TGGAGAAACCTAGCCAGGACGGG + Intronic
907028996 1:51152359-51152381 TGGCTAAAGCTGGCCTAAAGAGG - Intergenic
907809011 1:57850039-57850061 TGGGGATACCTGGCTTGGACAGG + Intronic
908077127 1:60532455-60532477 TGGAGAAATTTGGACTGGAGAGG - Intergenic
908401312 1:63774679-63774701 GGGCAAACCCTGGCCTGGCGGGG - Intronic
908734972 1:67266922-67266944 TGGCGAAAACTGGCCTGTTTAGG + Intergenic
908819235 1:68066273-68066295 TGGTGGAACCAGGCCTGAAGAGG - Intergenic
914446848 1:147757853-147757875 TGGCAAAAGCTGGCCTGGAAGGG - Exonic
917216325 1:172681954-172681976 TGGAGCCTCCTGGCCTGGAGTGG - Intergenic
917796193 1:178534461-178534483 TGGCAAAACCTGGCTTGCGGTGG - Intronic
919786544 1:201261850-201261872 GGGCGAATCCTGGTCTGGATGGG + Intergenic
921046160 1:211479319-211479341 TGCCGGAACCTGGGCGGGAGGGG + Exonic
922672415 1:227520875-227520897 TGGTGAGACCTAGGCTGGAGGGG - Intergenic
922798603 1:228353625-228353647 TGGAGATACCTGGCCTGGTTTGG + Intronic
924670295 1:246117423-246117445 CTGCGAAACCTGGCTTCGAGAGG - Intronic
1063081785 10:2774283-2774305 AGGGGTAACCTGGCCTGCAGAGG + Intergenic
1064016730 10:11778780-11778802 TGGCCAAGGCTGGCCTCGAGGGG - Intergenic
1064107098 10:12509297-12509319 TGGCCAAACCTGGTCTCTAGTGG - Intronic
1064747514 10:18492328-18492350 TGGGAAAACCTGGCCGGGCGTGG + Intronic
1067268248 10:44766297-44766319 TGGAGAAACCAGGCCTGGTCTGG - Intergenic
1068992767 10:63166801-63166823 TGGCTGAACCTTGCCTGAAGTGG + Intergenic
1070330001 10:75409717-75409739 GGGCGGAGCCTGGCCTGGAGCGG - Intergenic
1070681602 10:78452926-78452948 TGGCCAAGCCTGGTGTGGAGGGG - Intergenic
1071117527 10:82239444-82239466 TGGTGCAACCTGGCCAGGTGCGG - Intronic
1071691931 10:87829542-87829564 TGGTGAATCCTGGCCGGGCGAGG - Intronic
1073424146 10:103446090-103446112 TGGAGAAACCTGGGCTGCTGAGG + Exonic
1074382329 10:112991237-112991259 TGGGGAACCCTGGCCGGGCGCGG + Intronic
1076453081 10:130570393-130570415 TGGGGAAGCCTGGCCTGGCGTGG - Intergenic
1076725187 10:132409808-132409830 GCGAGAAACCTGGCCTGGACTGG + Intronic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1080942482 11:36935189-36935211 TGGCAAAACCTGACCTGGACTGG - Intergenic
1081571041 11:44291035-44291057 TCGGGAAACCTGAACTGGAGAGG - Intronic
1086602995 11:88658370-88658392 TGGCTAAACCTGACCTGAATGGG + Intronic
1089317549 11:117602268-117602290 TGGGCACACGTGGCCTGGAGTGG + Intronic
1089960310 11:122611520-122611542 TAGGGAAACCTGGCCAGGAATGG + Intergenic
1089979689 11:122762080-122762102 TGGCGAAAACCGGCCAGGCGCGG - Intronic
1090639554 11:128718526-128718548 TGGAGAAACCAGGACTGGGGCGG + Intronic
1091690755 12:2595860-2595882 AGGCGAAACCTGTACGGGAGAGG - Exonic
1092183870 12:6464351-6464373 TGGAGAAGCCTGGGCTGGAATGG + Exonic
1093461730 12:19413015-19413037 TGGGGTCCCCTGGCCTGGAGCGG + Intronic
1096352201 12:50909773-50909795 TGGAGAAACCTGGCCTCCTGAGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097695357 12:62769839-62769861 AGGCGAAAAGTGGGCTGGAGGGG + Intronic
1103724220 12:122989821-122989843 AGGCAAGCCCTGGCCTGGAGAGG - Exonic
1103907490 12:124335071-124335093 TGGGGGCACCAGGCCTGGAGAGG - Intronic
1105592802 13:21810263-21810285 TGGGTAAACCTGGCCGGGAACGG - Intergenic
1111993369 13:95138832-95138854 TGGCCCAACCTGGCCTGGGCAGG + Intronic
1113837403 13:113337537-113337559 TGGCGAAACCTGGTATCAAGAGG + Intronic
1113842105 13:113366129-113366151 TGGCCAGGCCTGGGCTGGAGCGG - Intergenic
1115711783 14:36059011-36059033 TGGAGAAAGCTGGTCTGCAGTGG - Intergenic
1117133282 14:52707123-52707145 GGGCGAAACCCTGCCTGGAGGGG - Intergenic
1117685780 14:58251444-58251466 TGGCGAAACCTGGCTTAGCCAGG - Intronic
1118834270 14:69465204-69465226 AGGTGAAACCTGGCCAGGCGTGG + Intergenic
1121232002 14:92365052-92365074 TGGCTACCCCTGGCCTGAAGCGG + Intronic
1121324334 14:93011313-93011335 TGGCGAAGCCTGGCCTCGCTTGG + Intronic
1122031114 14:98913259-98913281 TGGGGAAACCAGGCCGAGAGGGG - Intergenic
1122929887 14:104928316-104928338 TGGCCAGAGCTGGCCTGGAAGGG - Intronic
1124230872 15:27945216-27945238 TGGTGAGATGTGGCCTGGAGTGG - Intronic
1125889550 15:43255438-43255460 TGGAGAGACCTGGACAGGAGTGG - Intronic
1128863275 15:71092503-71092525 TGGGGAAACCTGACCTGAGGTGG + Intergenic
1130305731 15:82711050-82711072 TGGAGAAAACTGGCCTGGGTGGG + Intergenic
1132872016 16:2119554-2119576 TGGGGAAACCAAGCCAGGAGAGG + Intronic
1133970873 16:10567305-10567327 TGGCGAGACCTGGAGTGGGGAGG - Intronic
1134520509 16:14917342-14917364 TGGGGAAACCAAGCCGGGAGAGG - Intronic
1134551065 16:15138632-15138654 TGGGGAAACCAAGCCGGGAGAGG + Intronic
1134708181 16:16315993-16316015 TGGGGAAACCAAGCCGGGAGAGG - Intergenic
1134715397 16:16356026-16356048 TGGGGAAACCAAGCCAGGAGAGG - Intergenic
1134951421 16:18352652-18352674 TGGGGAAACCAAGCCGGGAGAGG + Intergenic
1134959360 16:18396133-18396155 TGGGGAAACCAAGCCAGGAGAGG + Intergenic
1135200263 16:20431095-20431117 TGGCAAGGCCTGGCATGGAGAGG + Intronic
1135218428 16:20592512-20592534 TGGCAAGGCCTGGCGTGGAGAGG - Intergenic
1137253815 16:46759090-46759112 CAGGGAAACCTGGCCTGGTGAGG + Intronic
1141169940 16:81684877-81684899 TGGCCAAGGCTGGCCTGGGGTGG - Intronic
1143403871 17:6663516-6663538 TGTCCAAACCTGGCCAGGCGCGG - Intergenic
1144791155 17:17860141-17860163 TGGCCAACCCTGGCCTGCACTGG - Intronic
1145390004 17:22448253-22448275 TGGCTAAACCTGGCCTGTTGGGG + Intergenic
1145998388 17:29117391-29117413 TGGGGAAAACTGGTCTGGGGAGG + Intronic
1146393752 17:32445010-32445032 TGGCGAAACCAGCTCTGGACAGG + Intronic
1147595680 17:41715674-41715696 TGGCCAAACCTGGCCAAGTGAGG - Intronic
1147703334 17:42409629-42409651 GGGGGAAACCTGGCCTGGAGTGG - Intronic
1149088767 17:52752052-52752074 TGCTGAAACCAGGCCTGGAAAGG - Intergenic
1150150157 17:62802630-62802652 GGGCATAACCTGGTCTGGAGGGG + Intronic
1152013480 17:77735031-77735053 TGGCAAGACCTAGGCTGGAGGGG - Intergenic
1155998188 18:32354673-32354695 TGGCTAAACATGGCCCGGGGAGG + Intronic
1159667904 18:71185864-71185886 GGTAGAAACCTGCCCTGGAGAGG - Intergenic
1160394209 18:78559824-78559846 TGATGAACCCTGGCCTGGCGTGG - Intergenic
1162291983 19:9786795-9786817 TGGAAAAACCAGGCCTGGAGCGG - Intronic
1162698577 19:12496294-12496316 TGGCTAAAACTGGCCTGTTGGGG - Intronic
1163266799 19:16226854-16226876 GGGAGAAACCTGGCCTGGGAGGG - Intronic
1163430583 19:17264764-17264786 TGGCCAAGCCTGGCCTGGGAGGG + Exonic
1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG + Intronic
1167464377 19:49642389-49642411 CGGCGAAACCTGGCGCCGAGAGG + Intronic
1167608940 19:50496872-50496894 TGGCCTGGCCTGGCCTGGAGGGG + Intergenic
1167887557 19:52514612-52514634 TGTTGAAACATGGGCTGGAGTGG + Intergenic
1167892921 19:52556908-52556930 TGTTGAAACATGGGCTGGAGTGG + Intronic
927870162 2:26618250-26618272 TGCAGAGACCTGGGCTGGAGGGG - Intronic
928387945 2:30885465-30885487 TGGCGAAAGGTGGGGTGGAGGGG + Intergenic
929612107 2:43278626-43278648 AGGCGAAACCTGCCCTGGTGCGG + Intronic
934095310 2:88596606-88596628 TTGCAAAGCCTGGCCTGGCGTGG - Intronic
939020081 2:136948128-136948150 TGACTAAACCTAGCCTGGAGTGG + Intronic
940786946 2:157991451-157991473 TGGAGAATCCTGGCTTGGAAAGG - Intronic
941563463 2:167078544-167078566 CGGCAAAAACTGGCCGGGAGTGG + Intronic
944049316 2:195449537-195449559 TAGGGAAACCTGGCCGAGAGTGG + Intergenic
946245405 2:218384432-218384454 TGGAGAAACATGGCCAGCAGGGG - Intronic
946862729 2:224015183-224015205 TGGGGAAGCCTGGTCTAGAGGGG + Intronic
947537296 2:230948258-230948280 TGGGGAAGTCAGGCCTGGAGGGG - Intronic
947665572 2:231903452-231903474 TGGCCCAGCCTGGCCTGAAGGGG + Intergenic
948030570 2:234814274-234814296 TGGGGAATGCCGGCCTGGAGTGG + Intergenic
948050368 2:234975317-234975339 TGGGGAAGCCAGGCCTGGCGAGG + Intronic
948126701 2:235569358-235569380 AGGGGACACCTGGCCAGGAGAGG - Intronic
948239304 2:236416316-236416338 TGGTGTAACCTCGCCTGTAGTGG + Intronic
948906733 2:240983214-240983236 TGGGGAAACTGAGCCTGGAGGGG + Intronic
1175097903 20:56556525-56556547 TCCAGAAAGCTGGCCTGGAGTGG - Intergenic
1175251930 20:57615150-57615172 TGAGGAAACCAGGCCTTGAGGGG - Intronic
1175793276 20:61756032-61756054 TGGCGCAGCCTGCCCTGCAGTGG - Intronic
1175908725 20:62394540-62394562 TGGAGAAACCTGACCAGGCGTGG - Intronic
1179310974 21:40196138-40196160 TGCCGCACCCTGGCCTGCAGAGG + Intronic
1181585699 22:23852372-23852394 AGGTGAAACCTGGCCAGGTGTGG - Intergenic
1181851827 22:25754963-25754985 TGGCCAGGCCTGGGCTGGAGAGG + Intronic
1182475538 22:30574636-30574658 CGGCGGCACCTGGCCGGGAGCGG - Intergenic
1182539277 22:31028266-31028288 TGGCAAAAACTGGCCAGGTGGGG + Intergenic
1183354505 22:37351008-37351030 AGGAGGAACCGGGCCTGGAGAGG - Intergenic
1183639537 22:39084638-39084660 TGGGGAATCCTGGCCTTGTGAGG - Intronic
1183930124 22:41231127-41231149 TGAAGAAACCATGCCTGGAGGGG + Exonic
1184473371 22:44708041-44708063 TGGGGAAACCTGGCCAGGCGTGG + Intronic
1184800194 22:46754288-46754310 ACGTGAAGCCTGGCCTGGAGTGG - Intergenic
1184942493 22:47779456-47779478 TGGCGAATCCTGCCCTGGTAAGG + Intergenic
1185065058 22:48627995-48628017 TGGGGGAACCTTGCCCGGAGCGG + Intronic
1185088381 22:48752848-48752870 TGGGGCAGCCTGGCCAGGAGAGG + Intronic
1185410461 22:50678929-50678951 GGGCGGGGCCTGGCCTGGAGGGG + Intergenic
954265384 3:49467358-49467380 GCACCAAACCTGGCCTGGAGTGG + Intergenic
963187819 3:142438709-142438731 GGGAGAAACCTGGCCTCGTGAGG + Intronic
964827304 3:160842801-160842823 GGGCCAAACCTGGCCTGCGGAGG + Intronic
966532386 3:180995334-180995356 AGGAGAAACATGGGCTGGAGGGG - Intergenic
967068751 3:185943614-185943636 TTACGAAACCTGGCCAGGGGTGG - Intergenic
967998963 3:195188309-195188331 TGGCTAAAACAGGTCTGGAGTGG + Intronic
968598285 4:1496454-1496476 GAGCCAAACCTGGCCTGGAAGGG + Intergenic
969725538 4:8916085-8916107 TGGCGAGGCCTCGGCTGGAGGGG - Intergenic
972393091 4:38631745-38631767 TGGAGAATCCTGGCCGGGCGCGG + Intergenic
975471854 4:74778785-74778807 TGGAGCAACCTGGCATGGGGAGG + Intronic
975922468 4:79408347-79408369 AGGTGAAGCCTGGGCTGGAGGGG - Intergenic
983787432 4:171751332-171751354 TGGCAAAAACTGGCCAGGTGTGG + Intergenic
984705580 4:182845017-182845039 TGGGGAGCCCTGGGCTGGAGTGG - Intergenic
987742463 5:21927777-21927799 TGGTGAAAACAGGCCTGGTGCGG + Intronic
989516500 5:42349395-42349417 TGGTGAAATGTGGGCTGGAGTGG - Intergenic
991360522 5:65815153-65815175 TGGCGAAGCTTGGCTGGGAGAGG - Intronic
992776794 5:80096057-80096079 TGGTGAAACCTAGCCGGGTGTGG - Intergenic
1001257567 5:170196028-170196050 TGGGGAAACAGGGCCTGGAGAGG + Intergenic
1002791083 6:438182-438204 TGGAGAAGCCTGCCCTGGTGAGG - Intergenic
1003334641 6:5159100-5159122 GGGAGAAAGCTGGGCTGGAGGGG + Intronic
1006070011 6:31491358-31491380 TGCAAAAACCTGGCCTGGCGTGG + Intergenic
1006460292 6:34154156-34154178 TGAGGAAACCTGGGCTGGAGAGG - Intronic
1007055706 6:38881994-38882016 TGGAGAAACCTTGCCTGAAATGG - Intronic
1007258042 6:40542297-40542319 TTAGGAAACCTGGCCCGGAGAGG + Intronic
1007538791 6:42621749-42621771 TGGCCAAGGCTGGCCTGGCGCGG - Intronic
1012492924 6:99802503-99802525 GGGGGAAACTTGCCCTGGAGAGG + Intergenic
1018086100 6:160302469-160302491 AGGAGGAACCTGGCCTGGAAGGG + Intergenic
1019902576 7:4033985-4034007 TGGAGAAACCTGGCAGTGAGTGG + Intronic
1020733378 7:11913127-11913149 TGGCTAAACGTGGCCAGGCGCGG + Intergenic
1023981737 7:45074437-45074459 TGTCCAAACCTGGCTTGGAGAGG + Intronic
1025778496 7:64578870-64578892 TCGCGAAAACTGGAGTGGAGTGG + Intergenic
1029682001 7:102117789-102117811 TGGCGAAGCCTGTCTTGGGGAGG + Intronic
1032964778 7:137083298-137083320 TGGCAAAATCCGGCCAGGAGTGG - Intergenic
1033165644 7:139036269-139036291 GGGCGAAGCCTGGCCTTGAGGGG + Intergenic
1034276168 7:149824724-149824746 TGGGGGGACCTGGCCGGGAGGGG + Intergenic
1035594501 8:844840-844862 TGGCCAGGCCTGGCCTGGGGAGG - Intergenic
1038752721 8:30312206-30312228 TTGGGAAACCTGGCCTTGATTGG + Intergenic
1043060299 8:75491989-75492011 GGAGTAAACCTGGCCTGGAGAGG - Intronic
1049174555 8:141183827-141183849 TGGCAAAAGCTGTCCTGGCGGGG + Intronic
1051745373 9:20290436-20290458 TGGCCAAGGCTGGCCTGAAGAGG - Intergenic
1052026758 9:23582150-23582172 TGGCCAAAACCAGCCTGGAGAGG - Intergenic
1052603693 9:30671790-30671812 TGGTAAAACCTGGCCTGGTAGGG + Intergenic
1057646037 9:96876037-96876059 TGGCAGAACCTGGCCAGGCGAGG - Intergenic
1057720418 9:97527750-97527772 TGGGGACACATGGACTGGAGGGG + Intronic
1058772258 9:108247456-108247478 TTGGGAAACCTGGGCTGGGGAGG - Intergenic
1058830860 9:108815203-108815225 TGCTGATACTTGGCCTGGAGGGG - Intergenic
1060204330 9:121673839-121673861 TGGGGAAACCAGGCCCTGAGAGG - Intronic
1061825051 9:133252675-133252697 AGGACAAACCGGGCCTGGAGGGG - Intronic
1062064886 9:134521503-134521525 TGGGAGAACCAGGCCTGGAGAGG + Intergenic
1062542408 9:137047456-137047478 TGGAGAAAACTGGCTTGGGGAGG + Intergenic
1203351100 Un_KI270442v1:82098-82120 TGGAGAAAATTGGACTGGAGTGG + Intergenic
1187879064 X:23829609-23829631 TAGTGAAAACTGGCCAGGAGCGG + Intergenic
1187932628 X:24307517-24307539 TGGCAAAAACTGGCCGGGCGCGG + Intergenic
1189442804 X:41052326-41052348 TGGCAAAACTTGGCCGGGTGTGG + Intergenic
1190765016 X:53468796-53468818 TGGTGAAACCTGGCCCAGTGCGG - Intergenic
1192831712 X:74756989-74757011 GGGCGAAACAGGTCCTGGAGAGG + Intronic
1201757338 Y:17500613-17500635 TGGTGAGACCCAGCCTGGAGGGG + Intergenic
1201844216 Y:18405369-18405391 TGGTGAGACCCAGCCTGGAGGGG - Intergenic